Abstract
Background
Lettuce (Lactuca sativa L.) is considered the most important vegetable in the leafy vegetable group. However, bolting affects quality, gives it a bitter taste, and as a result makes it inedible. Bolting is an event induced by the coordinated effects of various environmental factors and endogenous genetic components. Although bolting/flowering responsive genes have been identified in most sensitive and non-sensitive species, non-coding RNA molecules like long non-coding RNAs (lncRNAs) have not been investigated in lettuce. Hence, in this study, potential long non-coding RNAs that regulate flowering /bolting were investigated in two lettuce strains S24 (resistant strain) and S39 (susceptible strain) in different flowering times to better understand the regulation of lettuce bolting mechanism. For this purpose, we used two RNA-seq datasets to discover the lncRNA transcriptome profile during the transition from vegetative to reproductive phase.
Results
For identifying unannotated transcripts in these datasets, a 7-step pipeline was employed to filter out these transcripts and terminate with 293 novel lncRNAs predicted by PLncPRO and CREMA. These transcripts were then utilized to predict cis and trans flowering-associated targets and Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. Computational predictions of target gene function showed the involvement of putative flowering-related genes and enrichment of the floral regulators FLC, CO, FT, and SOC1 in both datasets. Finally, 17 and 18 lncRNAs were proposed as competing endogenous target mimics (eTMs) for novel and known lncRNA miRNAs, respectively.
Conclusion
Overall, this study provides new insights into lncRNAs that control the flowering time of plants known for bolting, such as lettuce, and opens new windows for further study.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12870-022-04031-8.
Keywords: Bolting, Long non-coding RNA, Lettuce, Regulation
Background
Lettuce (Lactuca sativa L.) is an annual and leafy vegetable belonging to the Asteraceae family [1, 2]. It is considered of great importance as it contributes to human nutrition. Lettuce is rich in fiber, minerals, flavonoids, chlorophyll, and carotenoids and is widely used as a raw vegetable in salads, sandwiches, wraps, or cooked [3, 4]. For these reasons, it is cultivated in many countries in addition to being widely grown in some home gardens. China, U.S., Spain, Italy, India, and Japan are the leading producers; however, the cultivation of Lactuca is accompanied by several problems that could decrease its productivity and quality [3]. One of these undesirable traits in leafy lettuce is bolting.
Bolting is the fast transition from the vegetative to the reproductive period which characterizes a fundamental step in the development of flowering plants [5]. During this, the vegetative phase ends so quickly to be followed by rapid floral stem elongation and bud differentiation, thus initiating the reproductive stage [6]. This phenomenon is controlled by environmental as well as genetic factors that determine the flowering time. External conditions mainly involve temperature, light intensity, and light exposure duration [5]. In fact, more light is shed on investigating the genetic regulatory mechanisms that control bolting and other agronomic traits, mainly those affecting the quality of crops [7]. Genetically speaking, genes, transcriptomes, and proteins are all players that are molecularly involved in intercalated regulation pathways. According to findings, five major flowering pathways including vernalization, photoperiod, autonomous, aging, and phytohormone especially gibberellin (GA) pathways along with circadian clock, ambient temperature, development, and FRIGIDA (FRI)-dependent pathways have been determined to control bolting and flowering time [8]. Around 300 genes found in Arabidopsis thaliana are involved in controlling flowering, for example, FLOWERING LOCUS T (FT), SUPPRESSOR OF OVEREXPRESSION OF CO 1 (SOC1), and LEAFY (LFY) serve as main contributors to determine the inflorescence time [9]. Furthermore, two genes, LsFT and LsSOC1, are known to intervene in the heat-induced bolting process. Expression of LsFT can be promoted by heat treatment, while its knockdown delays bolting, and in consequence plants fail to respond to high temperatures [3]. LsSOC1 also acts by activating bolting upon high temperatures. In addition, MADS-box genes and GAs can as well regulate bolting in lettuce [10].
What is still slightly ambiguous, is the putative roles of non-coding genes. Transcripts of non-coding genes have revealed regulatory functions in different pathways affecting flowering and the reproductive switch [11]. One of these types of transcripts is the long non-coding RNA known as lncRNA. LncRNAs are non-coding RNAs that are largely heterogeneous accounting for a length equal or greater than 200 nucleotides. They are similar to coding mRNA in being transcribed by RNA Pol II and acquiring a poly-adenylated tail [12]; however, they are not translated into proteins. LncRNAs originate from intergenic regions or the intronic and exonic regions of the coding genes [11], and they usually regulate the expression of other genes and act as miRNA sequesters to allow the expression of mRNAs targeted by miRNA.
Various biological processes; development (from pollen to roots), reproduction (flowering/bolting), and stress responses are under the control of lncRNAs which indicate their fundamental regulatory roles [13]. Functional analysis of lncRNAs has also discovered the potential roles of lncRNAs in regulating the flowering/bolting time. For example, the lncRNAs COLDAIR [14], COLDWRAP [15], and COOLAIR [16] are transcribed from FLC and function in FLC epigenetic silencing. COOLAIR functions in the regulation of flowering in Arabidopsis in both vernalization and autonomous pathways by modulating FLC expression through multiple mechanisms [16]. COLDAIR and COLDWRAP also function in the regulation of flowering through the vernalization pathway [14, 15]. COLDAIR acts by associating with Polycomb group proteins to mediate silencing of FLC and by affecting chromatin looping at FLC in response to vernalization, while COLDWRAP coordinates vernalization-mediated Polycomb silencing of the FLC in addition to forming intragenic chromatin loop that represses FLC [14]. Research has also identified the Antisense Long (ASL) transcript being involved in early-flowering Arabidopsis, specifically those that do not need vernalization to flower [17]. Although ASL is alternatively spliced, it is not polyadenylated, contrary to other lncRNAs transcribed from FLC. Its length is more than 2000 nucleotides, starting at the same promoter as COOLAIR but transcribed from the antisense strand. It is true that both COOLAIR and ASL 5′ regions overlap; however, ASL spans intron 1, which is prominent for keeping FLC silenced, and includes the COLDAIR region which is transcribed in the sense direction. By physical contact, the ASL transcript collaborates with the FLC locus and H3K27me3, suggesting that ASL and COOLAIR perform distinctly in FLC silencing and expectedly in the maintenance of H3K27me3 [17]. ASL functions in the regulation of flowering in the autonomous pathway in Arabidopsis. AtRRP6L adjusts ASL to balance H3K27me3 levels [17, 18]. Other findings have discovered a flowering associated intergenic lncRNA (FLAIL) that suppresses flowering in Arabidopsis. Knock-down of FLAIL RNA levels has led to early flowering along with genomic mutations, revealing the trans-acting role of FLAIL RNA in restraining the flowering of Arabidopsis by interfering in transcriptionally regulating genes directly bound by FLAIL [19].
An overall review of the RNA section reveals that the lncRNAs are detected and assessed through high throughput sequencing, and bioinformatics approaches [20]. Similarly, several publications have identified lncRNAs implicated in bolting. Ghorbani et al. [11] performed transcriptome and qPCR analyses to reveal lncRNAs and hub genes associated with spinach bolting in two accessions. Correspondingly, Tu et al. [21] identified the miRNA-lncRNA-TF regulatory networks attributed to leaf and flower development in Liriodendron chinense, a common ornamental tree species in southern China. Their findings were based on integrating small RNA, degradome, Illumina, and PacBio sequencing data [21]. Besides, the characterization and comprehensive analysis of lncRNAs involved in the flowering development of trifoliate orange (Poncirus trifoliata L. Raf.) was done by Wang et al. [22] through performing paired-end strand-specific RNA sequencing (ssRNA-Seq). Likewise, Shea et al. [23] identified long noncoding RNA in Brassica rapa L. following vernalization by performing similar methods of obtaining RNA-seq data.
Therefore, there is a critically important role of lncRNAs in controlling flowering time in plants that are known for bolting. Hence, to provide a novel insight into lncRNAs activity mechanisms in lettuce flowering, we identified flowering/bolting-related lncRNAs using transcriptome sequencing data in two lettuce lines with different bolting times. Besides, we performed a quantitative reverse transcription PCR (RT-qPCR) analysis to validate lncRNAs expression and constructed a co-expression network using weighted gene co-expression network analysis (WGCNA) based on differentially expressed mRNAs and lncRNAs. In summary, the flowering-associated function of identified lncRNAs was unveiled by predicting the potential lncRNA trans-regulated target genes involved in the six main flowering-related pathways. The potential novel lncRNA- miRNA- mRNA interactions in regulating the lettuce flowering/bolting process were also discovered. Additionally, the relationships between co-expressed lncRNAs and master regulators modulating the switch to flowering were unraveled within the identified key modules. The outcome of this research can be used as a baseline for subsequent future functional genomics studies on understanding the molecular basis underlying the lettuce flowering process.
Results
Identification of novel lncRNAs
To identify the novel lncRNAs associated with flowering/bolting in L. sativa, two RNA-seq datasets under the BioProject accession numbers PRJNA325073 [9] and PRJNA422994 [3], with respectively 6 and 16 cDNA libraries, were exploited. These data belonged to line S24 as a bolting resistance line and S39 as a bolting sensitive line. Indeed, both lines S24 and S39 belong to leafy lettuce with serrated leaves. As compared to S24, line S39 generally grows faster and its leaves are bigger. More importantly, S39 is prone to bolting and is very sensitive to high temperatures, where S24 is bolting resistant and heat intensive. For this case, about 1121.1 million raw reads were analyzed utilizing a pipeline shown in Fig. S1. After quality control and trimming, high-quality clean reads (score > Q30) with a minimal length of 50 bp were aligned to the lettuce reference genome (L. sativa cv Salinas V8, https://genomevolution.org/coge/GenomeInfo.pl?gid=28333) using HISAT2 [24]. The percentage of mapped reads was between 78 and 98. Using StringTie v.2.1.1 [25], 186,558 transcripts were identified and quantitated. Among these, 97,041 transcripts in class codes of ‘u’ (intergenic), “o” (generic overlap with known exon), “i” (intronic), and “x” (overlap with a known gene on the opposite strand) were recognized as unannotated transcripts, of which 1114 transcripts were expressed with CPM > 1 in at least 21 samples. After filtering transcripts with lengths of > 200 bp and < 15 Kb, 924 transcripts remained. In the next step, 835 transcripts non-homologous to tRNA and rRNAs were screened. After excluding transcripts with at least one significant (E-value,1e-5) hit against the UniProt release, 512 remaining transcripts were assessed for protein-coding potential using the CPC2 [26] (https://github.com/gao-lab/CPC2_standalone). By using this program, 450 noncoding transcripts were detected, and inputted into PLncPRO [27] (https://github.com/urmi-21/PLncPRO), and CREMA [28] (https://github.com/gbgolding/crema) for rigorous prediction of novel lncRNAs. Ultimately, 293 potential lncRNAs (Table S1) were predicted by both PLncPRO and CREMA (Fig. 1A). In this study, 51 differentially expressed lncRNAs (DE-lncRNAs) were identified by the DESeq2 package on the IDEAMEX web server, using the FPKM value. The results of the filtration-based lncRNA identification procedure are summarized in Table 1.
Fig. 1.
A Venn diagrams illustrating the number of both shared and distinct lncRNAs predicted by PLncPRO and CREMA. B Venn diagrams illustrating the BLAST results of lncRNA sequences against GreeNC and PLncDB databases. C Length distribution of lettuce lncRNAs. D Bean plots represent the differential expression levels of the lncRNA and mRNA transcripts. DE refers to differentially expressed genes
Table 1.
The results of filtration step in the lncRNA identification pipeline. Numbers represent the total number of transcripts filtered out in each step
| Step | Number |
|---|---|
| Potential novel transcripts (Class codes: i, u, x, o, e) | 97,041 |
| Transcripts with CPM > 1 in at least 21 samples | 1114 |
| Transcripts with length > 200 bp and < 15 kb | 924 |
| Transcripts after filtering out tRNAs and rRNAs | 835 |
| Transcripts with no significant hit against UniProt, Pfam, and Rfam. | 512 |
| Noncoding transcripts predicted by CPC2 | 450 |
| Novel LncRNAs predicted by PLncPRO, and CREMA | 293 |
The length distribution of identified lncRNAs showed that they are distributed from 393 nt to 10,600 nt (Fig. 1C). Compared to mRNA transcripts, lncRNAs were longer in length but fewer in exon number (Fig. S2). The log fold change (logFC) of all identified lncRNAs, DE-lncRNAs, and DE-mRNAs were also compared. The expression distribution results demonstrated that mRNAs had significantly higher expression diversity than lncRNAs. Additionally, the logFC of all lncRNA and DE-lncRNAs was differently distributed. The highest density of DE-lncRNAs was found with the approximate logFC range of − 2 to − 5 and 2 to 5, while a large number of lncRNAs appeared nearly with − 2 < logFC < 2 (Fig. 1D).
To obtain a deeper insight into the conservation of lncRNAs identified in this study, their sequences were aligned with plant lncRNA sequences publicly available in the GREENC [29], and PLncDB v.2.0 [30] databases. The BLAST search results demonstrated that 146 lncRNAs (~ 50% of all pulled-out lncRNAs) had at least one significant hit. Furthermore, around 24% of lncRNAs displayed significant homology with only lncRNA sequences in the GreeNC database, and 15.35% of candidate lncRNAs had significant hits solely in the PLncDB database (Fig. 1B).
Identification and functional enrichment analysis of potential target genes
To investigate the possible regulatory function of cis-acting lncRNAs, protein-coding genes from 100 kb upstream and downstream of known and novel lncRNAs were explored. In this regard, for 768 known lncRNAs, 1753 and 1544 potential cis-regulated target genes were deciphered upstream and downstream of lncRNAs, respectively. For 293 novel lncRNAs detected in this study, 1337 and 1159 upstream and downstream target genes were identified. Besides, 51 DE-lncRNAs were found to be adjacent to 231 upstream and 262 downstream target genes. Subsequently, to obtain a deeper understanding of the probable cis-regulatory function of both known and novel lncRNAs, GO enrichment and KEGG pathway enrichment analyses were conducted on the screened potential target genes.
The GO enrichment analysis revealed that potential target genes of known lncRNAs and novel lncRNAs were enriched completely differently. Most known lncRNA cis-regulated potential target genes were mainly enriched into biological processes associated with “Peptidyl- amino acid modification”, “Cellular response to lipid”, and “Cell morphogenesis”, while for novel lncRNA potential target genes, the most highly enriched category was “Gametophyte development”, as a GO term directly associated with flower development (Fig. 2). The KEGG enrichment analysis results showed that “phagosome”, “Porphyrin metabolism”, “SNARE interactions in vesicular transport”, “Inositol phosphate metabolism”, and “Riboflavin metabolism” were significantly enriched among upstream and downstream novel lncRNAs target genes. The target genes of known lncRNA were mainly enriched in “biosynthesis of cofactors” and “plant-pathogen interaction”. Furthermore, enrichment analysis indicated that these genes were exclusively assigned to “circadian rhythm-plant”, as an indispensable pathway during the floral transition (Fig. 3).
Fig. 2.
GO enrichment (BP: biological process) of protein-coding transcripts located 100 Kbp upstream and downstream of both known and novel lncRNAs
Fig. 3.
KEGG enrichment of protein-coding transcripts located 100 Kbp upstream and downstream of both known and novel lncRNAs
Assessment of lncRNAs-mRNAs interaction using LncTar
Since lncRNA-mediated regulation is also carried out by base-pairing with complementary mRNAs [13], LncTar (http://www.cuilab.cn/lnctar) was employed to predict potential lncRNA trans-regulated target genes. Interestingly, several predicted target genes were found to be involved in flowering-related pathways. According to the results, two DE-lncRNAs including, XR_002852627.1 and XR_002850851.1 were identified to target XM_023917191.1 (Dof-type zinc finger domain-containing protein; CDF2) and XM_023876432.1 (Matrix metalloprotease; MMP), respectively, which are involved in photoperiodism pathway. The circadian pathway-associated target gene, XM_023884739.1 (LIGHT-REGULATED WD 1; LWD1) was shown to be potentially regulated by DE-lncRNAs XR_002851856.1, and XR_002852627.1. Another circadian target gene was XM_023909739.1 (ZEITLUPE; ZTL), which was detected as a trans-target of XR_002852627.1. The participation of two DEGs, XM_023886038.1 (MADS AFFECTING FLOWERING 1; MAF1) and XM_023890738.1 (LIGHT-RESPONSE BTB 2; LRB2), has been asserted in the vernalization pathway. In this study, MAF1 was found to be regulated by three DE-LncRNA including, XR_002844960.1, XR_002851856.1, and XR_002852780.1. Furthermore, LRB2 was detected as the target of XR_002852627.1. LEAFY (XM_023888266.1; LFY), a gene involved in the integrator pathway, was predicted to be the target gene of XR_002852627.1 and XR_002846433.1. The trans-regulatory activity of XR_002854255.1 on XM_023882685.1 (GA REQUIRING 1; GA1), XR_002860308.1 on XM_023879739.1 (REPRESSOR OF GA; RGA), and also XR_002853569.1 on XM_023891863.1 (AUXIN RESPONSE FACTOR 8; ARF8) was also predicted by lncTar. The involvement of these flowering-associated target genes was detected in the hormone pathway. Another flower-related pathway identified in this study was “autonomous” in which XM_023902615.1 (FVE), XM_023892071.1 (LUMINIDEPENDENS; LD), XM_023917173.1 (UBIQUITIN-CONJUGATING ENZYME 2; UBC2_i1), XM_023917174.1 (UBC2_i2), XM_023917175.1 (UBC2_i3), XM_023881249.1 (ABA HYPERSENSITIVE 1; ABH1), XM_023901095.1 (VERNALIZATION INDEPENDENCE 3; VIP3), and XM_023905511.1 (CADMIUM SENSITIVE 2; CAD2) were revealed to be targeted by both novel and known DE-lncRNAs (Fig. 4).
Fig. 4.
Flowering-related pathways unraveled through the prediction of potential lncRNA trans-regulated target genes by lncTar
Assessment of lncRNAs as the competing endogenous target mimics (eTMs) for miRNAs
In the current study, lncRNAs were also investigated for the possibility of being miRNAs’ eTMs using the psMimic algorithm [31]. According to the results, a total of 17 novel lncRNAs (Table S2) were predicted to be potential eTMs for 15 miRNAs. Of these, six lncRNA were found to be DE-lncRNAs. In further analysis, utilizing the psRobot toolbox [32], 695 putative unique target genes were identified for 15 miRNAs that previously exhibited mimicry with lncRNAs. Among predicted target genes, the putative flowering-related genes including, protein CDC73 homolog (PHP) involved in the vernalization pathway, cyclic dof factor 1-like (CDF2), metalloendoproteinase 3-MMP-like (At2-MMP) involved in photoperiodic pathway, lysine-specific histone (LDL2), protein MODIFIER OF SNC1 1 (MOS1), pre-mRNA-processing-splicing factor 8 A (PRP8), and protein MRG1 (MRG1) involved in autonomous pathway were detected.
Similarly, among known lncRNAs, a total of 18 DE_lncRNAs were predicted to be potential eTMs for 18 miRNAs (Table S3), of which 5 miRNAs were shared with novel lncRNAs (Lsa-miRN1644, Lsa-miRN1673, Lsa-miRN1704, Lsa-miRN1716, Lsa-miRN1719). Additionally, 782 putative unique target genes for 18 miRNAs were predicted. Among predicted target genes, PHP involved in the vernalization pathway, CDF2 and light-mediated development protein DET1 (DET1) involved in photoperiodism, LDL2, MOS1, PRP8, LOW QUALITY PROTEIN: homeobox protein LUMINIDEPENDENS (LD) and histone-lysine N-methyltransferase ATXR7 isoform X1 (ATXR7) involved in autonomous, and two-component response regulator-like APRR3 (PRR3) involved in circadian clock were found as the putative flowering-related genes.
Co-expression network analysis
To acquire a general view on the regulatory networks involved in the lettuce flowering process, WGCNA analysis was conducted to construct a gene co-expression network of the mRNAs and lncRNAs. Utilizing the hierarchical clustering of 1-TOM and the DynamicTree Cut algorithm, 4,539 unique DEGs, 51 novel DE-lncRNAs, and 768 known DE-lncRNAs were categorized into 8 modules with distinguished colors (Table S4).
The blue module contained the largest number of DE-lncRNAs (225 known DE-lncRNAs and 19 novel DE-lncRNAs). On the other hand, the salmon module, with 23 known DE-lncRNAs and 1 novel DE-lncRNAs, included the lowest number of DE-lncRNAs.
Regarding WGCNA analysis, in each module (except for the greenyellow), the novel relevance between DE-lncRNAs and flowering-associated genes were deciphered, which can reveal the lncRNA/mRNA interaction mediated regulation of the flowering process. For instance, in the blue module, the potential association was detected between lncRNAs and 26 neighboring DEGs involved in the regulation of flowering. These differentially expressed genes include EARLY FLOWERING 9 (ELF9), FVE, CONSTANS (CO), RED AND FAR-RED INSENSITIVE 2 (RFI2), GA REQUIRING 2 (GA2), GIBBERELLIC ACID INSENSITIVE (GAI), PHOSPHOGLUCOMUTASE, STARCH-FREE 1 (PGM), PSEUDO-RESPONSE REGULATOR 9 (PRR9), PHYTOCHROME E (PHYE), INSENSITIVE DWARF1B (GID1B), and ABRE BINDING FACTOR 4 (ABF4). The possible relationship between DE-lncRNAs and 11 flowering-related genes such as MADS AFFECTING FLOWERING 1 (MAF1), TERMINAL FLOWER 1 (TFL2), MEDIATOR 18 (MED18), BHLH48, HISTONE H2A PROTEIN 9 (HTA9), TBP-ASSOCIATED FACTOR 15B (TAF15B), and MULTICOPY SUPRESSOR OF IRA1 (MSI1) were unraveled in the magenta module. The co-expression of DE-lncRNAs with TILTED 1 (TIL1), SQUAMOSA promoter-binding protein-like 10 (SPL10), and LUMINIDEPENDENS (LD), as the DEGs involved in flowering regulation was found in the pink module. In the rest of the modules, DEGs included FLOWERING LOCUS C EXPRESSOR-LIKE 4 (FLL4) (in the purple module), gibberellin 3-beta-dioxygenase 1-like and BTB/POZ domain-containing protein POB1-like (in the salmon module), and COLD, CIRCADIAN RHYTHM, AND RNA BINDING 2 (CCR2) (in the tan module). These DEGs were the lncRNA’s neighboring flowering-associated genes. To evaluate the relationship among co-expression modules and days after planting traits, the Pearson correlation coefficient analysis was performed between eigengene values in each module and the individual gene expression values related to different growth stages in S24 and S39 lines. As shown in the module-trait relationship heatmap (Fig. S3), the significantly correlated modules exhibited low and mostly positive correlation coefficient values. These significant positive correlations were observed in the modules, including blue (in S39_4L), magenta (in S24_20DS), pink (in S24_45DS), salmon (in S24_4L), purple (in S39_20DS). Furthermore, the greenyellow and tan modules were positively correlated with S39-35DS (concurrent with bolting time in S39), while conversely, a negative correlation was observed between these modules and S24-35DS. These opposite correlation coefficient values can represent the eigengenes in these modules and/that may regulate early bolting in S39. Besides, the purple module was positively correlated with S39_20DS, while negatively correlated with S39-35DS. This observation suggested that genes in this module may negatively regulate bolting in S39.
LncRNA expression study by qPCR
To accredit the expression of predicted DE-lncRNAs, qPCR analysis was performed for nine DE-lncRNAs in two different lettuce genotypes, Qomi and Sefid-e-Neishabour, which were grouped by [33] as the early and late bolting genotypes, respectively. A near concordance between the expression results obtained from qPCR and RNA-Seq was observed. According to the qPCR expression data obtained from shoot apical meristem samples in 5 different growth stages (from vegetative to reproductive growth stage), it was demonstrated that the expression of XR_002846902.1 and XR_002854255.1 were significantly up-regulated in the late bolting genotype compared to the early bolting one. On the other hand, XR_002851856.1, XR_002852627.1, XR_002852780.1, and XR_002860308.1 were found to indicate a higher expression in the early bolting compared to the late one (Fig. 5). Concerning both the RNA-seq and qPCR results, the upregulation of XR_002850851.1 was observed during different vegetative growth stages in both late bolting lettuce plants, Sefid-e-Neishabour (evaluated by qPCR) and S24 (evaluated by RNA-seq). The higher expression of this lncRNA in two late bolting plants could reveal its probable role in resistance against bolting followed by the delay in flowering time. On the other hand, MSTRG.45132.1 was detected with the highest expression in the early flowering stage Qomi and S39 (early bolting plants) in comparison with the late bolting ones. Hence, it can be inferred that this lncRNA can play a crucial role in inducing flowering.
Fig. 5.
Relative expression of nine selected lncRNAs by qPCR collected from shoot apical meristem samples in 5 different growth stages in two different lettuce genotypes, Qomi (early bolting) and Sefid-e-Neishabour (late bolting). Q, SN, D, S, and F represent Qomi, Sefid-e-Neishabour, days after planting, flowering and shoot apical meristem, respectively. The examined days after planting are included; 10, 20, 30, and 40. Bars display mean values of three replicates (+/− standard deviation). *p-value < 0.05 and **p-value < 0.01 indicate significant differences
In further, we evaluated the expression of target genes of bolting/flowering-related lncRNAs by RT-qPCR (Fig. 6). These results revealed that the selected coding genes (target genes) expression patterns exhibited an inverse correlation with their corresponding lncRNAs, indicating that these lncRNAs could negatively regulate their corresponding target genes. GA1, LD, and LFY target genes corresponding to XR_002854255.1, XR_002846902.1, and XR_002852627.1 lncRNAs respectively indicated higher expression in vegetative stages of early bolting Qomi genotype. However, UBC2 and MAF1 associated with MSTRG.45132.1 and XR_002851856.1 lncRNAs, indicated higher expression in late bolting Sefid-e-Neishabour genotype.
Fig. 6.
The relative expression of putative target genes determined by RT-qPCR in two genotypes at different development stages. *p-value < 0.05 and **p-value < 0.01 indicate significant differences
Discussion
In commercial lettuce varieties, premature bolting has a major negative impact on the quality and marketability through the thickening of the leaves and the induction of secondary metabolite production, which renders a bitter and disagreeable taste in the leaves [34]. Since flowering initiation is a highly intricate developmental patterning process influenced by the interconnections between environmental stimuli and molecular signaling pathways, broadening knowledge and understanding of the molecular basis underlying the lettuce flowering process is vital to restraining early bolting [3, 35]. LncRNAs are one of the major endogenous genetic components contributing to flowering time and flower development. They act as interplay with DNA, RNA and protein molecules, and they modulate the expression level of their targets at the epigenetic, transcriptional, post-transcriptional, or translational levels [36–38]. Until recently, several lncRNAs have been revealed to implicate a major role in the flowering regulation of some model plant species, particularly Arabidopsis thaliana [39]. Over the past decade, different genetic and molecular studies have been performed to unravel the putative genes and pathways controlling the flowering/bolting process in lettuce [7].However, the knowledge about the pivotal role of lncRNAs, particularly in the transition from the vegetative to reproductive phase as well as the flowering time, is still enigmatic. Accessing lncRNAs and identification of the lncRNA-mRNA co-expression networks can also provide a holistic insight into the architecture of gene regulatory networks regulating flower development in lettuce. Hence, in this study, the deep transcriptome datasets obtained from two early and late-bolting near-isogenic lettuce lines in different developmental stages from vegetative to reproductive phase were analyzed for the identification and characterization of the potential flowering/bolting-associated lncRNAs. The framework of this study was briefly summarized in the following steps: identification of novel lncRNAs, evaluation of lncRNAs conservation, differential expression analysis of mRNAs and lncRNAs, prediction of the potential function of lncRNAs, validation of lncRNAs expression by qPCR, and construction of the regulatory lncRNA-mRNA co-expression network using the WGCNA analysis.
Utilizing a rigorous multi-filter bioinformatic pipeline, 293 novel lncRNAs were identified, 51 of which were DE-lncRNAs. To precisely clarify the lncRNAs-mediated regulatory mechanisms, GO enrichment and KEGG pathway analysis were conducted on the cis-acting target genes of DE-lncRNAs (both known and novel lncRNAs). GO enrichment results displayed that cis target genes of novel and known lncRNAs were enriched in 29 and 15 terms, respectively, among which, “Gametophyte development” is directly associated with the flowering process [40, 41].
Indeed, the enrichment of cis-acting target genes of lncRNAs in “Gametophyte development” suggests the probable function of lncRNAs in flower development by modulating genes associated with gametophyte production. Several studies have also unveiled the major roles of ncRNAs in governing processes involved in the development of haploid male and female gametophytes [42–45]. Based on KEEG analysis, it was found that the cis-acting target genes of both known and novel lncRNAs were enriched in a total of 26 pathways. Among these pathways,, the “Circadian rhythm-plant” has been recognized as a core pathway in the regulation of flowering time [46]. To ensure reproductive success, precise flowering time regulation is essential. Hence, plants require an endogenous timekeeper to keep track of the daylight changes, as a prominent determinant for onset of flowering [47]. Until now, the array of circadian clock-related components has been unraveled, which can synchronize molecular and physiological processes to the exogenous day/night cycles (light signaling) [47–49]. However, the KEEG results of this study demonstrated that the part of lncRNAs probably significantly regulates the floral transition time by regulating circadian clock-associated genes within the “Circadian rhythm-plant” pathway.
To help deepen our understanding of lncRNAs function, trans-regulatory target genes of lncRNAs were also predicted, and the remarkable novel associations were deciphered between DE-lncRNAs (known and novel) and target genes involved in six flowering-related pathways including autonomous, integrator, vernalization, hormone, circadian, and photoperiodism pathways. The overall assessment demonstrated that trans-acting lncRNAs in lettuce probably have more participation in the flowering process than those acting in cis mode. In the autonomous pathway, a relationship was revealed between two novel lncRNAs (MSTRG.93452.1 and MSTRG.113070.1) and the FVE gene. The FVE/MSI4 gene has a positive effect on flowering time regulation [50]. During the autonomous pathway, FVE contributes with two histone deacetylase HDA6 and the histone demethylase FLD and forms a multiprotein complex to repress FLC expression via histone modifications in FLC locus (decrement of H3K4 trimethylation and H3 acetylation) [51, 52]. In our study, identification of the novel regulatory interaction between the FVE gene and pertinent novel lncRNAs suggests that the lncRNAs-mediated epigenetic regulation of FLC is followed by flowering initiation via potentially targeting the FVE gene. Another target gene belonging to the autonomous pathway was LD, which was predicted to be targeted by XR-002846902.1 and XR-002853203.1. The positive regulatory role of this gene in promoting the floral transition was displayed by Lee et al. [53]. Additionally, this gene has been found with the most conspicuous effect on circadian periods [54]. Besides, Aukerman et al. [55] unveiled the LD- mediated LFY modulation. LFY is known as the key transcription factor in the flower formation process during the earliest floral stage [56], and also a pivotal integrator in modulating the floral gene network [57]. Concerning the interaction between LD and LFY, we can confer the regulatory role of XR-002846902.1 and XR-002853203.1 on LFY gene, and thus the floral meristem transition via targeting LD. Three UBC2 isoforms (1–3) were the other autonomous-related genes that were predicted as the trans targets of MSTRG-45132.1 and MSTRG.78269.1. The UBC2 has been found as the positive regulator of FLC and repressor of flowering [58, 59]. In the model presented by Cao et al. [60], a heterotetramer consisting of two HUB1 (HISTONE MONOUBIQUITINATION1) and two HUB2 interacts with UBC1/2 to monoubiquitinate H2B located in the FLC chromatin. Followed by this modification, the histone H3 methyltransferase is employed to induce H3K4 and H3K36 hypermethylation, and ultimately, FLC upregulation. In the current study, our findings suggest that MSTRG-45132.1/MSTRG.78269.1 probably mediated epigenetic regulation of FLC chromatin by modulating the UBC1,2/HUB1,2. Another lncRNA/mRNA interplay-mediated flowering regulation within the autonomous pathway was found between ABH1 and XR-002851856.1. The negative role of ABH1 in flowering has been proved via modulating three major floral regulators including CO, FLC and FLM [61, 62]. Our study displayed the potential regulatory role of two previously predicted lncRNAs, XR-002845727.1 and XR-002858472.1 on VIP3. The negative role of VIP3 was initially revealed in regulating the flowering time via activating the FLC expression [63]. As a putative subunit of the RNA polymerase II-associated complex (PAF1c), VIP3 participates in FLC up-regulation by induction of methylation of histones H3K4 within FLC chromatin [64, 65]. Therefore, the activity of FLC is probably modulated via potential trans-regulation mediated by XR-002845727.1 and XR-002858472.1 on VIP3. Additionally, a collaborative-based association was unraveled between CAD2, a gene located in the autonomous pathway, and its relevant lncRNAs including XR-002857644.1, XR-002851659.1, and XR-002856650.1. The positive regulatory role of CAD2 on flowering time has been demonstrated by Ogawa et al. [66]. The CAD2 gene is involved in biosynthesis of the glutathione (GSH) [67] which is necessitated for floral meristem initiation [68, 69], and its accumulation directly affects flowering time [70]. In the integrator pathway, the trans-regulatory role of two lncRNAs, XR-002852627 and XR-002846433.1, was revealed on the LFY gene. The members of the LFY family have been known as the floral meristem identity genes [71] and function as the decisive integrators in modulating the floral gene network [57]. For example, LFY TF promotes the expression of the master floral regulator, APETALA1 (AP1), by mediating AP1 locus activation via translocating linker histone H1, and recruiting SWI/SNF chromatin remodelers locus [72]. Hence, lncRNA-mediated modulation of LFY expression by XR-002852627 and XR-002846433.1 can unveil the novel components in regulating this pioneer TF and other downstream floral regulators. The probable regulatory role of lncRNAs in the vernalization pathway was found through predicted trans-regulation of XR-002844960.1, XR-002851856.1, and XR-002852780.1 on MAF1/ FLM. In comparison with flowering-related genes which are also involved in other plant growth aspects, MAF1 has been seemingly found to act only on flowering time regulation [73]. This gene, encoding a MADS-box TF associated with FLC, functions as a repressor of flowering during vernalization [74, 75]. In fact, the ratio of two splice variants, FLM-β and δ, which are affected by temperature fluctuations (between 16 and 27 °C) determines the function of FLM in fine-tuning of flowering time [75]. The second novel collaborative-based relationship in the vernalization pathway was found between LRB2 and XR002852627.1. The positive regulatory role of LRB2 in flowering time was deciphered by Christians et al. [76]. The LRBs regulate floral induction through impacting the degradation of FRIGIDA (FRI), which regulates vernalization and timing of transition from the vegetative to reproductive phase [77]. Followed by degradation of FRI, there is an overexpression of lncRNA COOLAIR and then a reduction in the level of histone H3Lys4 trimethylation (H3K4me3) in FLC chromatin. The sum of these changes leads to promoting flowering [78]. The potential trans-regulatory role of lncRNAs in lettuce flowering was also revealed within the hormone pathway. For instance, XR-002854255.1 was predicted to regulate GA1. This gene is located in the early stage of the GA biosynthesis pathway and positively regulates flower formation through coordination and interaction with LFY [79, 80]. Thus mutations in GA1 result in failure or delay in flower induction [79]. Furthermore, a potential association was uncovered between XR-002860308.1 and RGL2, as another flowering-related target gene in the hormone pathway. The product of RGL2, as a DELLA protein and negative modulator of GA response, is vital for repressing flowering [81, 82]. This gene, like other DELLA genes, exerts its function chiefly by interacting with FLC and SPL to block floral transition [83, 84]. Interaction between ARF8 and XR-002853569.1 was another predicted lncRNA/mRNA interaction within the hormone pathway. The ARF8 gene is involved in promoting jasmonic acid production and flower maturation via repressing the Class 1 KNOX genes, as major inhibitors of floral organs’ elongation and differentiation [85–87]. In looking for a novel result, we deciphered a novel crosstalk between miR167, ARF8, and XR-002853569.1 candidates for mediating the maturation of lettuce floral organs.
Within the circadian rhythm pathway, we detected the plausible trans-regulatory role of XR-002851856.1 on LWD1. LWD1 acts on photoperiodic flowering regulation and period length through modulating the expression of multiple oscillator genes including CIRCADIAN CLOCK ASSOCIATED1 (CCA1) and PSEUDO-RESPONSE REGULATOR9 (PPR9) [88, 89]. The other novel lncRNA/mRNA interaction in the circadian rhythm pathway was predicted between ZTL, an F-box protein, and XR-002852627.1. ZTL has been revealed to negatively regulate the photoperiodic control of flowering time through reduction in the CO and FT transcript levels [90, 91]. In the photoperiodism pathway, a probable interaction was unraveled between CDF2 and XR-002852627.1. Interestingly, it was found that XR-002852627.1 is engaged in coregulating both ZTL and CDF2 within two detached pathways. In 2009, CDF2 was first reported to be involved in delaying flowering by suppressing CO transcription [92]. Then, Sun et al. [93] revealed that CDF2 could control the flowering time, seemingly independent of CO via miR172 suppression and miR156 activation during (DICER-LIKE 1) DCL1-mediated pri-miRNAs processing. Regarding CDF2 function and discovering the lncRNA- mediated CDF2 trans-regulatory, our results suggest a new interplay between XR-002852627.1, CDF2, and miR156/miR172 in modulating flowering time within the photoperiodism pathway in lettuce. The final predicted the presence of lncRNA- governed trans-regulatory relationship between MMP and XR-002850851.1. Even though the positive relevance of MMP to flowering was demonstrated by Golldack et al. [94], the actual function of this MMP protease in modulating flowering is largely unknown. Hence, unraveling this novel relationship between MMP and XR-002850851.1 can provide a better understanding of characterizing the function of this gene in the flowering process.
In a deeper investigation into the diagnosis of lncRNAs’ function, our findings unraveled the potential novel lncRNA- miRNA- mRNA interactions in modulating the lettuce flowering process. It was found that XR-002852074, MSTRG.80963.1, and MSTRG.31850.1 all three together act as eTMs for Lsa-miRN1644 aiming to regulate PHP (involved in the vernalization pathway), and CDF2 (involved in photoperiodic pathway). Both PHP and CDF2 have been identified with a negative regulatory role in flowering. The PHP, a component of the PAF1 complex, is involved in modulating the expression of H3K27ME3-enriched genes, especially the major flowering suppressor, FLC [95]. The CDF2, a member of the DOF family, has been recognized as the delayed flowering factor by repressing CO transcription [92, 96]. In another novel interplay, XR-00284767.1 was found to act as eTM for Lsa-miRN1711 to regulate DET1 (involved in photoperiodism pathway). According to findings of Kang et al. [97], DET1 was detected to function in floral repression via epigenetically inducing FLC expression, and repressing SOC1 through interacting with MSI4/FVE or preventing GIGANTEA (GI) from binding to the FT promoter, resulting in FT repression. Our results have also indicated that both XR-002859499.1 and MSTRG.126339.1 potentially function as eTMs for Lsa-miRN1704, aiming to modulate three genes participating in the autonomous pathway, including LDL2, MOS1, and PRP8. LDL2 was found to act with FLOWERING LOCUS D (FLD) to prevent FLC expression by mediating histone H3 lysine 4 (H3K4) demethylation; thus, it provokes the floral transition [98, 99]. Similar to LDL1, MOS1 was found to promote flowering. Bao et al. [100] demonstrated that MOS1 negatively regulates the expression of FLC via inhibiting SUF4, a transcriptional activator of the FLC. PRP8 has been documented as a central component of the spliceosome [101]. In the study by Marquardt et al. [102], the PRP8-dependent suppression of FLC transcription by affecting the lncRNA COOLAIR splicing was discovered. Hence, the indirect effect of XR-002859499.1 and MSTRG.126339.1 on FLC can be inferred. From our results, XR-002851210.1- Lsa-miRN1726 was another novel potential regulatory component in regulation of flowering through modulating LD (involved in autonomous pathway). It was also predicted that XR-002845460.1 could act as a decoy for Lsa-miRN4414 to control the expression of ATXR7, as a Set1- class H3K4 methylase involved in FLC activation and proper expression via full H3K4 methylation [103]. XR-002847497.1 was another lncRNA which was found to act as a potential eTM for Lsa-miRN1728 to regulate PRR3. PRR3, as a negative regulator, controls the photoperiodic flowering response within the circadian clock pathway [104]. The MSTRG.111752.1- Lsa-miR1725 interplay, which mediated the potential post-translational regulation of At2-MMP (involved in the photoperiodic pathway), and MRG1 (involved in the autonomous pathway) was also observed in our study. MRG1, a positively novel type of chromatin modulator, participates in photoperiodic regulation of flowering time [105, 106]. This gene, along with MRG2, function as the H3K4me3/H3K36me3 readers and activate the expression of FT via physically interacting with CO [105].
The construction of lncRNA-mRNA co-expression networks utilizing WGCNA could also corroborate the roles of the lncRNA-mRNA regulatory connections in the lettuce flowering process. Interestingly, relationships between co-expressed lncRNAs and leading protein-coding genes were more predominantly deciphered in the blue and magenta modules, which positively intervene the switch to flowering. These relationships and genes included FVE (in the blue module) and TAF15b (in the magenta module) via repressing FLC expression [51, 52, 107, 108], PRR9 (in the blue module) via activating the CO and repressing CYCLING DOF FACTOR1 (CDF1) [109], PGM (in the blue module) via mobilizing carbohydrate reserves [110, 111], MSI1 (in the magenta module) via affecting the floral integrator genes including, CO, FT, and SOC1 [112, 113], and also MED18 (In the magenta module) via mediating the floral meristem identity gene, AGAMOUS (AG), and FLC [114]. Besides, the key TFs involved in promoting flowering through modulating the major floral integrators, including CO and ABF4 as well as BHLH48, were detected in these modules [115–119]. On the other hand, several flowering-related genes were found to contribute to the negative regulation of flower development including ELF9 (in the blue module) via repressing SOC1 [120], RFI2 (in the blue module) via negatively regulating CO expression and photoperiodic flowering [121], TFL2 (in the magenta module) via maintaining the elevated levels of H3K9 dimethylation at FLC chromatin [122, 123]. Identifying these key modules containing the remarkable numbers of significant flowering-associated genes could screen out the novel lncRNAs in these modules that presumably contribute to the same flowering-related functions that their co-expressed mRNAs are involved in.
Conclusion
This study aimed to identify and characterize the potential flowering/bolting-associated lncRNAs in lettuce by employing RNA-seq data. The pivotal roles of lncRNAs in transition from the vegetative to reproductive phase were unraveled through GO enrichment and KEGG pathway analysis conducted on the lncRNAs cis-acting target genes, identifying of lncRNAs trans-regulatory targeting flowering-associated genes, discerning the potential novel lncRNA- miRNA- mRNA interactions in modulating the lettuce flowering process, and finally via unveiling the relationships between co-expressed lncRNAs and well-studied flowering-related genes via constructing of lncRNA-mRNA co-expression networks. The results of all applied methods together demonstrated that the function of identified lncRNAs in lettuce is mainly promoting/ repressing flowering with or without intermediaries through modulating the master floral regulators including, FLC, CO, FT, and SOC1. The findings of this study provided a novel insight into our understanding of lncRNAs’ regulatory functions within the six main flowering-associated pathways in lettuce.
Methods
Transcriptomic data
To identify the lncRNAs associated with flowering/bolting in L. sativa, two RNA-Seq data sets available in the European Nucleotide Archive (ENA, https://www.ebi.ac.uk/ena) under the BioProject accession numbers PRJNA325073 [9] and PRJNA422994 [3], were downloaded and analyzed. According to the first dataset (PRJNA325073), high throughput RNA-Seq data were used to compare the transcriptomes of seedlings from two near-isogenic lines with different bolting resistance. In the second data set (PRJNA422994), the flowering locus T (LsFT) gene was analyzed in 8 developmental stages during the transition from the vegetative to reproductive phase of the same lines. In these studies, a bolting resistant line S24 and a bolting sensitive line S39 were used for RNAs extraction and library construction using NEB Next Ultra Directional RNA Library Prep Kit for Illumina (NEB, Ispawich, MA, United States). Then, RNA-seq libraries were sequenced on an Illumina HiSeq 2000 platform to generate 100 bp pair-ended reads.
Identification of unannotated transcripts and lncRNAs
For the identification of lncRNAs, the selected data sets were analyzed on the Galaxy website (https://usegalaxy.eu; [124]) using the workflow shown in Fig. S1. In this regard, first, the quality of reads was evaluated by using FastQC (v.0.11.8; https://www.bioinformatics.babraham.ac.uk/projects/fastqc/), and then the low-quality bases and adaptors contamination were eliminated using the Trimmomatic tool (v.0.38; [125]). Pruning the bases with a quality score < Q30 and removing reads with lengths < 50 bp were selected as the most critical Trimmomatic parameters. In the following, high-quality clean reads were mapped to the lettuce reference genome (L. sativa cv Salinas V8, https://genomevolution.org/coge/GenomeInfo.pl?gid=28333) by using HISAT2 [24]. The transcripts linked to the reference genome were assembled using StringTie v.2.1.1 [25]. The assembled transcripts were merged with StringTie’s merge tools to make a combined annotation file and re-estimate quantities of transcripts.
To identify unannotated transcripts, transcriptome assemblies (gff files produced by StringTie) were compared with lettuce genome annotation file using the gffcompare program [126]. Then, the unannotated transcripts categorized in the class codes of “u” (intergenic lncRNAs), “x” (antisense lncRNAs), “i” (intronic lncRNAs), “o” (generic exonic overlap lncRNAs with reference transcripts), and “e” (single exon TransFrag overlying a reference exon) were kept as the output results. Since these recognized unannotated transcripts may contain possible coding genes, they were brought under the following multistep filtering scheme:
-
I.
The unannotated transcripts less than 200 bp and greater than 15 Kb CPM (Count per million) < 1 were removed.
-
II.
The result of the former step was entered into tRNAscan-SE 2.0 [127] and later Barrnap 0.9 (https://github.com/tseemann/barrnap) to filter out possible tRNAs and rRNAs.
-
III.
Transcripts with one significant (E-value, 1e-5) hit against the UniProt release 2021–02, Pfam release 34.0, and Rfam 14.5 databases, which encoded a preserved protein/domain were excluded.
-
IV.
The coding potential calculator (CPC2) software [26] was applied to assess the coding potential of foreseen lncRNAs.
-
V.
Finally, CREMA [28] and PLncPRO [27] were employed on the non-coding potential transcripts predicted by CPC2 to increase the accuracy of lncRNA prediction.
Recognition of differentially expressed mRNAs and lncRNAs
With the help of python script prepDE.py, the differential expression analysis was conducted on the gene read count data matrices. For this analysis, the generated matrices were uploaded onto the IDEAMEX website [128]. After that, DESeq2 [129] software was used to recognize differentially expressed genes (DEGs) and differentially expressed lncRNAs (DE-lncRNA) by screening parameters of FDR ≤ 0.01, log2 fold change (logFC) ≥ 2, and CPM = 1.
Useful annotation and improvement analysis
For acquiring a functional vision of identifying lncRNAs, a series of approaches were applied which aimed at homology search and characterization of lncRNAs, identification of cis/trans-target genes of lncRNA, and practical enrichment analysis of target genes. Since the distinction between lncRNAs across different classes can provide profound insights into the conservation of lncRNAs, the identified lncRNAs in this study were compared to the lncRNAs reached in Green Non-Coding Database (GREENC; http://greenc.sequentiabiotech.com/wiki/Main_Page; [29]), and Plant Long non-coding RNA Database (PLncDB v.2.0; http://plncdb.tobaccodb.org/; [30]), using the BLASTN tool with the criteria of e-value 1e5, identity more than 70%, and query coverage > 30%.
Afterwards, the role of genes located 100 Kbp upstream and downstream of lncRNAs as cis-regulated potential target genes were investigated through Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. Moreover, the untangled connection between lncRNA and DEGs was predicted using LncTar [130] with default parameters.
Identification of lncRNAs as miRNA endogenous target mimic
LncRNAs can act as miRNA target mimics and negatively adjust and sequester the activity of the miRNAs, owing to the attendance of partial complementarity between lncRNAs and the miRNAs. Hence, using all known lettuce miRNAs, miRNA mimic sites were predicted by psMimic software [31]. Besides, psRobot toolbox [32] was employed to recognize the target genes of the miRNAs that displayed mimicry with lncRNAs. For this analysis, the following parameters were set: penalty score threshold = 2.5, five prime (5’) boundary of essential sequence = 2, three prime (3’) boundary of essential sequence = 17, the maximal number of permitted gaps = 1, and position after which with gap/bulge permit = 17.
Plant materials and validation by real-time PCR
To confirm the expression levels of predicted lncRNAs, the leafy lettuce genotypes Qomi (early bolting) and Sefid-e-Neishabour (late bolting) were selected according to the results of previous research [33]. To obtain these samples, permission was not necessary. Seeds of genotypes were sown in plastic pots (15 cm diameter, 25 cm high) with sterilized soil and grown in a growth chamber under spring growth conditions for 3 months at Isfahan University of Technology, Isfahan, Iran, in March 2020. Water management was done according to standard practices. The formal identification of the plant material was undertaken by the herbarium of Agricultural and Natural Resources College, University of Tehran, and no voucher specimens were collected and deposited in the collection (it is not necessary as we don’t describe a novel species). We also stated that the field studies were in compliance with local legislation of Iran in the experimental greenhouse and growth chamber of Isfahan University of Technology, Isfahan, and no specific licenses were required.
For this experiment, plants were examined for bolting at 10, 20, 30, and 40 days after planting (Fig. S4) using shoot apical meristem tissues (QDS and SNDS). Sampling from two genotypes was also conducted when the lettuce plants developed into the flowering stage (QFS and SNFS). Samples from 5 different seedlings were pooled together as one biological sample. Three biological replicates from each genotype were used for RNA extraction and the Real-Time PCR (qPCR) analysis according to the previous research [11, 131, 132]. In brief, total RNAs were extracted by the DENAzist column RNA isolation kit. The first-strand cDNA was synthesized using 1 µg of total RNA per sample and RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, Co., USA), according to the manufacturer’s instructions. Using SYBR Green PCR Master Mix (BioFACT, Korea) and specific primers (Table 2), the Real-Time PCR (qPCR) reaction was performed in a final volume of 15 µl on the ABI system with three technical replicates per each biological replicate (ABI ViiA 7 Real-time PCR). The qPCR program included a single step of initial denaturation at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 20 s. PP2A1 and TIP41 [133] housekeeping genes were used as internal reference genes to normalize the expression data. Finally, the relative expression levels of lncRNAs were calculated using the 2-ΔΔCt method [134].
Table 2.
Primers used in quantitative real-time PCR to verify transcriptome sequencing data
| Primer | Sequence | Length | Tm | Product Size |
|---|---|---|---|---|
| MSTRG.45132.1_F | TGACACGAGGATCATACTTTCG | 22 | 60 | 228 |
| MSTRG.45132.1_R | TACACATGAAGCCTTGTGATCC | 22 | ||
| MSTRG.78269.1_F | TCAACATACCTCAGAAGGCTCA | 22 | 60 | 210 |
| MSTRG.78269.1_R | TTGGGTCACAATACTTTCAACG | 22 | ||
| XR_002846902.1_F | TGACAATCGTTTTCTCACCAAC | 22 | 60 | 204 |
| XR_002846902.1_R | ATCCATCGTTCGACATTTTACC | 22 | ||
| XR_002851856.1_F | CTAACTTAATGCTGCCCAGTTG | 22 | 60 | 141 |
| XR_002851856.1_R | AGCAACAGCAGAAAAATGAGAG | 22 | ||
| XR_002852627.1_F | TGCTACCGATGTCGAGTGATAC | 22 | 60 | 205 |
| XR_002852627.1_R | CTGCGTTCATCAGAAGTACCTG | 22 | ||
| XR_002854255.1_F | GAGGTTAAAGCACCAACGAATC | 22 | 60 | 171 |
| XR_002854255.1_R | ACGGTCCAAAATGTTTAAGCTC | 22 | ||
| XR_002852870.1_F | GACTCCATCCATCTCTCGATTC | 22 | 60 | 155 |
| XR_002852870.1_R | CAACAGGAGTGCCGATATGTAA | 22 | ||
| XR_002860308.1_F | CGCTGATTATTACGCTGTCATT | 22 | 59.5 | 193 |
| XR_002860308.1_R | AGTGTGTACGGATCATGCTGAC | 22 | ||
| XR_002850851.1_F | TCGTTGTTGGCTTCATTATCAC | 22 | 60 | 225 |
| XR_002850851.1_R | CGTGGTTATTGGTTTGATGTTG | 22 | ||
| LsPP2A1_F | ATTCATGGTCAATTCTACGATCTGGT | 26 | 60 | 107 |
| LsPP2A1_R | GAATAATACCCGCGATCAACATAATC | 26 | ||
| LsTIP41_F | TTTGTATGGAGATGAATTGGCTGATA | 26 | 60 | 90 |
| LsTIP41_R | CGTAAGAGAAGAAACCAACAGCTAGG | 26 |
Co-expression analysis of non-coding/coding genes
For co-expression analysis and identifying modules, methods and parameters were set similar to previous research [132]. In brief, the normalized fragments per kilobase of transcript per million fragments mapped (FPKM) values of DE-lncRNAs and DEGs were entered into WGCNA [135] R package. Pearson’s correlation between the log2 (FPKM + 1) values of all gene pairs was calculated to generate a matrix. Following this, the similarity matrix was transformed into an adjacency matrix. The soft threshold power (β) of 9 was determined based on the scale-free topology standard. Next, the topological overlap measure (TOM) and corresponding dissimilarity (1-TOM) were computed to detect the clusters of densely interconnected genes (modules) and calculate the correlations between modules and the phenotypic trait.
Supplementary Information
Acknowledgements
Not applicable.
Authors' contributions
AS, MK and NSH contributed to designing the experiment. AS and NSH collected samples and extracted RNAs. AS and MK analyzed and interpreted the data. AS, MK, KHH, and BA wrote the paper. All authors read and approved the final manuscript.
Funding
Not applicable.
Availability of data and materials
All RNA-Seq data were deposited in the NCBI SRA database under the project PRJNA325073 and PRJNA422994 (https://www.ncbi.nlm.nih.gov/bioproject/ PRJNA325073.
and https://www.ncbi.nlm.nih.gov/bioproject/ PRJNA422994).
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Judd WS, Campbell CS, Kellogg EA, Stevens PF, Cantino PD. Plant systematics. A phylogenetic approach. Syst Biol. 1999;48:826–8. [Google Scholar]
- 2.Kadereit JW. Asterales. Introduction and Conspectus. In: Flowering plants · Eudicots. Springer; 2007. pp. 1–6.
- 3.Chen Z, Han Y, Ning K, Ding Y, Zhao W, Yan S, et al. Inflorescence development and the role of LsFT in regulating bolting in lettuce (Lactuca sativa L.) Front Plant Sci. 2018;8:2248. doi: 10.3389/fpls.2017.02248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Zekkori B, Khallouki F, Bentayeb A, Fiorito S, Preziuso F, Taddeo VA, et al. A new phytochemical and anti-oxidant and anti-inflammatory activities of different lactuca sativa L. var. Crispa extracts. Nat Prod Commun. 2018;13:1139–42. [Google Scholar]
- 5.Beharav A, Hellier B. Bolting and flowering response of Lactuca georgica, a wild lettuce relative, to low temperatures. Ame J Plant Sci. 2020;11(12):2139-54.
- 6.do Amaral JC, Silva VN. Tolerance to bolting in lettuce: Cultivars and growing seasons. Idesia. 2018;36:25–33. [Google Scholar]
- 7.Han R, Truco MJ, Lavelle DO, Michelmore RW. A Composite Analysis of Flowering Time Regulation in Lettuce. Front Plant Sci. 2021;12:632708. doi: 10.3389/fpls.2021.632708. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chen C, Huang W, Hou K, Wu W. Bolting, an important process in plant development, two types in plants. J Plant Biol. 2019;62:161–9. doi: 10.1007/s12374-018-0408-9. [DOI] [Google Scholar]
- 9.Han Y, Chen Z, Lv S, Ning K, Ji X, Liu X, et al. MADS-Box genes and gibberellins regulate bolting in Lettuce (Lactuca sativa L.) Front Plant Sci. 2016;7:1889. doi: 10.3389/fpls.2016.01889. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hao J, Su HN, Zhang L, li, Liu C, jie, Han Y, Qin X, et al. Quantitative proteomic analyses reveal that energy metabolism and protein biosynthesis reinitiation are responsible for the initiation of bolting induced by high temperature in lettuce (Lactuca sativa L.) BMC Genomics. 2021;22:427. doi: 10.1186/s12864-021-07664-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ghorbani F, Abolghasemi R, Haghighi M, Etemadi N, Wang S, Karimi M, et al. Global identification of long non-coding RNAs involved in the induction of spinach flowering. BMC Genomics. 2021;22:704. doi: 10.1186/s12864-021-07989-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Madhawan A, Sharma A, Bhandawat A, Rahim MS, Kumar P, Mishra A, et al. Identification and characterization of long non-coding RNAs regulating resistant starch biosynthesis in bread wheat (Triticum aestivum L.) Genomics. 2020;112:3065–74. doi: 10.1016/j.ygeno.2020.05.014. [DOI] [PubMed] [Google Scholar]
- 13.Yan X, Ma L, Yang MF. Identification and characterization of long non-coding RNA (lncRNA) in the developing seeds of Jatropha curcas. Sci Rep. 2020;10:1–10. doi: 10.1038/s41598-020-67410-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Heo JB, Sung S. Vernalization-mediated epigenetic silencing by a long intronic noncoding RNA. Sci (80-) 2011;331:76–9. doi: 10.1126/science.1197349. [DOI] [PubMed] [Google Scholar]
- 15.Kim DH, Sung S. Vernalization-triggered intragenic chromatin Loop formation by long noncoding RNAs. Dev Cell. 2017;40:302–12.e4. doi: 10.1016/j.devcel.2016.12.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Csorba T, Questa JI, Sun Q, Dean C. Antisense COOLAIR mediates the coordinated switching of chromatin states at FLC during vernalization. Proc Natl Acad Sci U S A. 2014;111:16160–5. doi: 10.1073/pnas.1419030111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Shin JH, Chekanova JA. Arabidopsis RRP6L1 and RRP6L2 function in FLOWERING LOCUS C silencing via regulation of antisense RNA synthesis. PLoS Genet. 2014;10:e1004612. doi: 10.1371/journal.pgen.1004612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wang H-LV, Chekanova JA. In: Long noncoding RNAs in plants BT - Long non Coding RNA Biology. Rao MRS, editor. Singapore: Springer Singapore; 2017. pp. 133–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Jin Y, Ivanov M, Dittrich AN, Nelson ADL, Marquardt S. A trans-acting long non-coding RNA represses flowering in Arabidopsis. bioRxiv. 2021;:2021.11.15.468639.
- 20.Li J, Liu X, Yin Z, Hu Z, Zhang KQ. An overview on Identification and Regulatory Mechanisms of Long non-coding RNAs in Fungi. Front Microbiol. 2021;12:638617. doi: 10.3389/fmicb.2021.638617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Tu Z, Xia H, Yang L, Zhai X, Shen Y, Li H. The roles of microRNA-Long non-coding RNA-mRNA networks in the regulation of Leaf and Flower Development in Liriodendron chinense. Front Plant Sci. 2022;13:816875. doi: 10.3389/fpls.2022.816875. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Wang C-Y, Liu S-R, Zhang X-Y, Ma Y-J, Hu C-G, Zhang J-Z. Genome-wide screening and characterization of long non-coding RNAs involved in flowering development of trifoliate orange (Poncirus trifoliata L. Raf.) Sci Rep. 2017;7:43226. doi: 10.1038/srep43226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Shea DJ, Nishida N, Takada S, Itabashi E, Takahashi S, Akter A, et al. Long noncoding RNAs in Brassica rapa L. following vernalization. Sci Rep. 2019;9:9302. doi: 10.1038/s41598-019-45650-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37:907–15. doi: 10.1038/s41587-019-0201-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33:290–5. doi: 10.1038/nbt.3122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kang YJ, Yang DC, Kong L, Hou M, Meng YQ, Wei L, et al. CPC2: a fast and accurate coding potential calculator based on sequence intrinsic features. Nucleic Acids Res. 2017;45:W12–6. doi: 10.1093/nar/gkx428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Singh U, Khemka N, Rajkumar MS, Garg R, Jain M. PLncPRO for prediction of long non-coding RNAs (lncRNAs) in plants and its application for discovery of abiotic stress-responsive lncRNAs in rice and chickpea. Nucleic Acids Res. 2017;45:e183–3. doi: 10.1093/nar/gkx866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Simopoulos CMA, Weretilnyk EA, Golding GB. Prediction of plant lncRNA by ensemble machine learning classifiers. BMC Genomics. 2018;19:316. doi: 10.1186/s12864-018-4665-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Paytuví Gallart A, Hermoso Pulido A, Anzar Martínez de Lagrán I, Sanseverino W. Aiese Cigliano R. GREENC: a Wiki-based database of plant lncRNAs. Nucleic Acids Res. 2016;44:D1161–6. doi: 10.1093/nar/gkv1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Jin J, Lu P, Xu Y, Li Z, Yu S, Liu J, et al. PLncDB V2.0: a comprehensive encyclopedia of plant long noncoding RNAs. Nucleic Acids Res. 2021;49:D1489–95. doi: 10.1093/nar/gkaa910. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Wu HJ, Wang ZM, Wang M, Wang XJ. Widespread long noncoding RNAs as endogenous target mimics for microRNAs in plants. Plant Physiol. 2013;161:1875–84. doi: 10.1104/pp.113.215962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wu HJ, Ma YK, Chen T, Wang M, Wang XJ, PsRobot A web-based plant small RNA meta-analysis toolbox. Nucleic Acids Res. 2012;40:W22-8. doi: 10.1093/nar/gks554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Mousavi SH, Hassandokht MR, Choukan R, Sepahvand NA, Khosroshahli M, GENETIC VARIATION OF IRANIAN LETTUCE GENOTYPES BASED ON MORPHOLOGICAL TRAITS SEED PLANT Improv J. 2013;29–1:103–21. [Google Scholar]
- 34.Abbott A. The isolation of flowering time genes from lettuce to enable the manipulation of bolting time. 2010.
- 35.Cho L-H, Yoon J, An G. The control of flowering time by environmental factors. Plant J. 2017;90:708–19. doi: 10.1111/tpj.13461. [DOI] [PubMed] [Google Scholar]
- 36.Zhang X, Wang W, Zhu W, Dong J, Cheng Y, Yin Z, et al. Mechanisms and functions of long non-coding RNAs at multiple regulatory levels. Int J Mol Sci. 2019;20:5573. doi: 10.3390/ijms20225573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Statello L, Guo C-J, Chen L-L, Huarte M. Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol. 2021;22:96–118. doi: 10.1038/s41580-020-00315-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Chen L, Zhu Q-H, Kaufmann K. Long non-coding RNAs in plants: emerging modulators of gene activity in development and stress responses. Planta. 2020;252:92. doi: 10.1007/s00425-020-03480-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Jampala P, Garhewal A, Lodha M. Functions of long non-coding RNA in Arabidopsis thaliana. Plant Signal Behav. 2021;16:1925440. doi: 10.1080/15592324.2021.1925440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Lipinska AP, Serrano-Serrano ML, Cormier A, Peters AF, Kogame K, Cock JM, et al. Rapid turnover of life-cycle-related genes in the brown algae. Genome Biol. 2019;20:35. doi: 10.1186/s13059-019-1630-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Ashapkin VV, Kutueva LI, Aleksandrushkina NI, Vanyushin BF. Epigenetic regulation of Plant Gametophyte Development. Int J Mol Sci. 2019;20:3051. [DOI] [PMC free article] [PubMed]
- 42.Grant-Downton R, Rodriguez-Enriquez J. Emerging roles for non-coding RNAs in male Reproductive Development in Flowering plants. Biomolecules. 2012;2:608-621. [DOI] [PMC free article] [PubMed]
- 43.Liu H, Wang R, Mao B, Zhao B, Wang J. Identification of lncRNAs involved in rice ovule development and female gametophyte abortion by genome-wide screening and functional analysis. BMC Genomics. 2019;20:90. doi: 10.1186/s12864-019-5442-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Aslam M, Fakher B, Qin Y. Big role of small RNAs in female Gametophyte Development. Int J Mol Sci. 2022;23:1979. doi: 10.3390/ijms23041979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Wunderlich M, Gross-Hardt R, Schöffl F. Heat shock factor HSFB2a involved in gametophyte development of Arabidopsis thaliana and its expression is controlled by a heat-inducible long non-coding antisense RNA. Plant Mol Biol. 2014;85:541–50. doi: 10.1007/s11103-014-0202-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Creux N, Harmer S. Circadian rhythms in plants. Cold Spring Harb Perspect Biol. 2019;11:a034611. doi: 10.1101/cshperspect.a034611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Johansson M, Staiger D. Time to flower: interplay between photoperiod and the circadian clock. J Exp Bot. 2015;66:719–30. doi: 10.1093/jxb/eru441. [DOI] [PubMed] [Google Scholar]
- 48.Kim JA, Kim H-S, Choi S-H, Jang J-Y, Jeong M-J, Lee SI. The importance of the circadian clock in regulating Plant Metabolism. Int J Mol Sci. 2017;18:2680. [DOI] [PMC free article] [PubMed]
- 49.Shim JS, Kubota A, Imaizumi T. Circadian clock and photoperiodic flowering in Arabidopsis: CONSTANS is a hub for Signal Integration. Plant Physiol. 2017;173:5–15. doi: 10.1104/pp.16.01327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Jeon J, Kim J. FVE, an Arabidopsis homologue of the retinoblastoma-associated protein that regulates flowering time and cold response, binds to chromatin as a large multiprotein complex. Mol Cells. 2011;32:227–34. doi: 10.1007/s10059-011-1022-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Huang P, Huang H, Lin X, Liu P, Zhao L, Nie W-F, et al. MSI4/FVE is required for accumulation of 24-nt siRNAs and DNA methylation at a subset of target regions of RNA-directed DNA methylation. Plant J. 2021;108:347–57. doi: 10.1111/tpj.15441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Yu C-W, Chang K-Y, Wu K. Genome-wide analysis of Gene Regulatory Networks of the FVE-HDA6-FLD complex in Arabidopsis. Front Plant Sci. 2016;7:555. doi: 10.3389/fpls.2016.00555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Lee I, Aukerman MJ, Gore SL, Lohman KN, Michaels SD, Weaver LM, et al. Isolation of LUMINIDEPENDENS: a gene involved in the control of flowering time in Arabidopsis. Plant Cell. 1994;6:75–83. doi: 10.1105/tpc.6.1.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Salathia N, Davis SJ, Lynn JR, Michaels SD, Amasino RM, Millar AJ. FLOWERING LOCUS C-dependent and -independent regulation of the circadian clock by the autonomous and vernalization pathways. BMC Plant Biol. 2006;6:10. doi: 10.1186/1471-2229-6-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Aukerman MJ, Lee I, Weigel D, Amasino RM. The Arabidopsis flowering-time gene LUMINIDEPENDENS is expressed primarily in regions of cell proliferation and encodes a nuclear protein that regulates LEAFY expression. Plant J. 1999;18:195–203. doi: 10.1046/j.1365-313X.1999.00442.x. [DOI] [PubMed] [Google Scholar]
- 56.Vachon G, Tichtinsky G, Parcy F. LEAFY, le régulateur clé du développement de la fleur. Biol Aujourdhui. 2012;206:63–7. doi: 10.1051/jbio/2012006. [DOI] [PubMed] [Google Scholar]
- 57.Hu J, Jin Q, Ma Y. AfLFY, a LEAFY homolog in Argyranthemum frutescens, controls flowering time and leaf development. Sci Rep. 2020;10:1616. doi: 10.1038/s41598-020-58570-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Xu L, Ménard R, Berr A, Fuchs J, Cognat V, Meyer D, et al. The E2 ubiquitin-conjugating enzymes, AtUBC1 and AtUBC2, play redundant roles and are involved in activation of FLC expression and repression of flowering in Arabidopsis thaliana. Plant J. 2009;57:279–88. doi: 10.1111/j.1365-313X.2008.03684.x. [DOI] [PubMed] [Google Scholar]
- 59.Jue D, Sang X, Liu L, Shu B, Wang Y, Xie J, et al. The ubiquitin-conjugating enzyme Gene Family in Longan (Dimocarpus longan Lour.): genome-wide identification and gene expression during Flower induction and abiotic stress responses. Molecules. 2018;23:662. [DOI] [PMC free article] [PubMed]
- 60.Cao Y, Dai Y, Cui S, Ma L. Histone H2B monoubiquitination in the chromatin of FLOWERING LOCUS C regulates flowering Time in Arabidopsis. Plant Cell. 2008;20:2586–602. doi: 10.1105/tpc.108.062760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Kuhn JM, Breton G, Schroeder JI. mRNA metabolism of flowering-time regulators in wild-type Arabidopsis revealed by a nuclear cap binding protein mutant, abh1. Plant J. 2007;50:1049–62. doi: 10.1111/j.1365-313X.2007.03110.x. [DOI] [PubMed] [Google Scholar]
- 62.Wasilewska A, Vlad F, Sirichandra C, Redko Y, Jammes F, Valon C, et al. An update on Abscisic Acid signaling in plants and more. … Mol Plant. 2008;1:198–217. doi: 10.1093/mp/ssm022. [DOI] [PubMed] [Google Scholar]
- 63.Zhang H, Ransom C, Ludwig P, van Nocker S. Genetic analysis of early flowering mutants in Arabidopsis defines a class of Pleiotropic Developmental Regulator required for expression of the flowering-time switch flowering locus C. Genetics. 2003;164:347–58. doi: 10.1093/genetics/164.1.347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Yu X, Michaels SD. The Arabidopsis Paf1c Complex Component CDC73 participates in the modification of FLOWERING LOCUS C chromatin. Plant Physiol. 2010;153:1074–84. doi: 10.1104/pp.110.158386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.He Y. Control of the transition to flowering by chromatin modifications. Mol Plant. 2009;2:554–64. doi: 10.1093/mp/ssp005. [DOI] [PubMed] [Google Scholar]
- 66.Ogawa K, Tasaka Y, Mino M, Tanaka Y, Iwabuchi M. Association of glutathione with flowering in Arabidopsisthaliana. Plant Cell Physiol. 2001;42:524–30. doi: 10.1093/pcp/pce065. [DOI] [PubMed] [Google Scholar]
- 67.Cobbett CS, May MJ, Howden R, Rolls B. The glutathione-deficient, cadmium-sensitive mutant, cad2–1, of Arabidopsis thaliana is deficient in γ-glutamylcysteine synthetase. Plant J. 1998;16:73–8. doi: 10.1046/j.1365-313x.1998.00262.x. [DOI] [PubMed] [Google Scholar]
- 68.Bashandy T, Guilleminot J, Vernoux T, Caparros-Ruiz D, Ljung K, Meyer Y, et al. Interplay between the NADP-Linked thioredoxin and glutathione Systems in Arabidopsis Auxin Signaling. Plant Cell. 2010;22:376–91. doi: 10.1105/tpc.109.071225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Kocsy G, Tari I, Vanková R, Zechmann B, Gulyás Z, Poór P, et al. Redox control of plant growth and development. Plant Sci. 2013;211:77–91. doi: 10.1016/j.plantsci.2013.07.004. [DOI] [PubMed] [Google Scholar]
- 70.García-Quirós E, Alché J, de Karpinska D, Foyer B. Glutathione redox state plays a key role in flower development and pollen vigour. J Exp Bot. 2020;71:730–41. doi: 10.1093/jxb/erz376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Blazquez MA, Soowal LN, Lee I, Weigel D. LEAFY expression and flower initiation in Arabidopsis. Development. 1997;124:3835–44. doi: 10.1242/dev.124.19.3835. [DOI] [PubMed] [Google Scholar]
- 72.Jin R, Klasfeld S, Zhu Y, Fernandez Garcia M, Xiao J, Han S-K, et al. LEAFY is a pioneer transcription factor and licenses cell reprogramming to floral fate. Nat Commun. 2021;12:626. doi: 10.1038/s41467-020-20883-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Lutz U, Posé D, Pfeifer M, Gundlach H, Hagmann J, Wang C, et al. Modulation of ambient temperature-dependent flowering in Arabidopsis thaliana by Natural variation of FLOWERING LOCUS M. PLOS Genet. 2015;11:e1005588. doi: 10.1371/journal.pgen.1005588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Capovilla G, Symeonidi E, Wu R, Schmid M. Contribution of major FLM isoforms to temperature-dependent flowering in Arabidopsis thaliana. J Exp Bot. 2017;68:5117–27. doi: 10.1093/jxb/erx328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Li F, Hu Q, Chen F, Jiang JF. Transcriptome analysis reveals vernalization is independent of cold acclimation in Arabidopsis. BMC Genomics. 2021;22:462. doi: 10.1186/s12864-021-07763-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Christians MJ, Gingerich DJ, Hua Z, Lauer TD, Vierstra RD. The light-response BTB1 and BTB2 proteins assemble Nuclear Ubiquitin Ligases that Modify Phytochrome B and D Signaling in Arabidopsis. Plant Physiol. 2012;160:118–34. doi: 10.1104/pp.112.199109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Wiersma C, Christians M. Modification of LRB complex members in Arabidopsis thaliana. Student Summer Sch. 2015;157:1.
- 78.Hu X, Kong X, Wang C, Ma L, Zhao J, Wei J, et al. Proteasome-mediated degradation of FRIGIDA modulates flowering Time in Arabidopsis during Vernalization. Plant Cell. 2014;26:4763–81. doi: 10.1105/tpc.114.132738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Hauvermale AL, Steber CM. GA signaling is essential for the embryo-to-seedling transition during Arabidopsis seed germination, a ghost story. Plant Signal Behav. 2020;15:1705028. doi: 10.1080/15592324.2019.1705028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Wang LL, Liang HM, Pang JL, Zhu MY. [Regulation network and biological roles of LEAFY in Arabidopsis thaliana in floral development] Yi Chuan. 2004;26:137–42. [PubMed] [Google Scholar]
- 81.Galvão VC, Horrer D, Küttner F, Schmid M. Spatial control of flowering by DELLA proteins in Arabidopsis thaliana. Development. 2012;139:4072–82. doi: 10.1242/dev.080879. [DOI] [PubMed] [Google Scholar]
- 82.Guan H, Huang X, Zhu Y, Xie B, Liu H, Song S, et al. Identification of DELLA genes and key stage for GA Sensitivity in Bolting and Flowering of Flowering Chinese Cabbage. Int J Mol Sci. 2021;22:12092. [DOI] [PMC free article] [PubMed]
- 83.Li M, An F, Li W, Ma M, Feng Y, Zhang X, et al. DELLA proteins interact with FLC to repress flowering transition. J Integr Plant Biol. 2016;58:642–55. doi: 10.1111/jipb.12451. [DOI] [PubMed] [Google Scholar]
- 84.Yu S, Galvão VC, Zhang Y-C, Horrer D, Zhang T-Q, Hao Y-H, et al. Gibberellin regulates the Arabidopsis Floral transition through miR156-Targeted SQUAMOSA PROMOTER BINDING–LIKE transcription factors. Plant Cell. 2012;24:3320–32. doi: 10.1105/tpc.112.101014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Nagpal P, Ellis CM, Weber H, Ploense SE, Barkawi LS, Guilfoyle TJ, et al. Auxin response factors ARF6 and ARF8 promote jasmonic acid production and flower maturation. Development. 2005;132:4107–18. doi: 10.1242/dev.01955. [DOI] [PubMed] [Google Scholar]
- 86.Tabata R, Ikezaki M, Fujibe T, Aida M, Tian C, Ueno Y, et al. Arabidopsis AUXIN RESPONSE FACTOR6 and 8 regulate Jasmonic Acid Biosynthesis and Floral Organ Development via repression of class 1 KNOX genes. Plant Cell Physiol. 2010;51:164–75. doi: 10.1093/pcp/pcp176. [DOI] [PubMed] [Google Scholar]
- 87.Zhang G-Z, Jin S-H, Li P, Jiang X-Y, Li Y-J, Hou B-K. Ectopic expression of UGT84A2 delayed flowering by indole-3-butyric acid-mediated transcriptional repression of ARF6 and ARF8 genes in Arabidopsis. Plant Cell Rep. 2017;36:1995–2006. doi: 10.1007/s00299-017-2225-x. [DOI] [PubMed] [Google Scholar]
- 88.Wu J-F, Wang Y, Wu S-H. Two New Clock Proteins, LWD1 and LWD2, regulate Arabidopsis Photoperiodic Flowering. Plant Physiol. 2008;148:948–59. doi: 10.1104/pp.108.124917. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Wu J-F, Tsai H-L, Joanito I, Wu Y-C, Chang C-W, Li Y-H, et al. LWD–TCP complex activates the morning gene CCA1 in Arabidopsis. Nat Commun. 2016;7:13181. doi: 10.1038/ncomms13181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Somers DE, Kim W-Y, Geng R. The F-Box protein ZEITLUPE confers dosage-dependent control on the circadian clock, photomorphogenesis, and Flowering Time[W] Plant Cell. 2004;16:769–82. doi: 10.1105/tpc.016808. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Takase T, Nishiyama Y, Tanihigashi H, Ogura Y, Miyazaki Y, Yamada Y, et al. LOV KELCH PROTEIN2 and ZEITLUPE repress Arabidopsis photoperiodic flowering under non-inductive conditions, dependent on FLAVIN-BINDING KELCH REPEAT F-BOX1. Plant J. 2011;67:608–21. doi: 10.1111/j.1365-313X.2011.04618.x. [DOI] [PubMed] [Google Scholar]
- 92.Fornara F, Panigrahi KCS, Gissot L, Sauerbrunn N, Rühl M, Jarillo JA, et al. Arabidopsis DOF transcription factors act redundantly to reduce CONSTANS expression and are essential for a photoperiodic flowering response. Dev Cell. 2009;17:75–86. doi: 10.1016/j.devcel.2009.06.015. [DOI] [PubMed] [Google Scholar]
- 93.Sun Z, Guo T, Liu Y, Liu Q, Fang Y. The roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of primary MicroRNAs. PLOS Genet. 2015;11:e1005598. doi: 10.1371/journal.pgen.1005598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Golldack D, Popova OV, Dietz K-J. Mutation of the Matrix Metalloproteinase At2-MMP inhibits growth and causes late flowering and early senescence in Arabidopsis *. J Biol Chem. 2002;277:5541–7. doi: 10.1074/jbc.M106197200. [DOI] [PubMed] [Google Scholar]
- 95.Park S, Oh S, Ek-Ramos J, van Nocker S. PLANT HOMOLOGOUS TO PARAFIBROMIN is a component of the PAF1 complex and assists in regulating expression of genes within H3K27ME3-Enriched chromatin. Plant Physiol. 2010;153:821–31. doi: 10.1104/pp.110.155838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Fornara F, de Montaigu A, Sánchez-Villarreal A, Takahashi Y, Ver Loren van Themaat E, Huettel B, et al. The GI–CDF module of Arabidopsis affects freezing tolerance and growth as well as flowering. Plant J. 2015;81:695–706. doi: 10.1111/tpj.12759. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Kang M-Y, Yoo S-C, Kwon H-Y, Lee B-D, Cho J-N, Noh Y-S, et al. Negative regulatory roles of DE-ETIOLATED1 in flowering time inArabidopsis. Sci Rep. 2015;5:9728. doi: 10.1038/srep09728. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Jiang D, Yang W, He Y, Amasino RM. Arabidopsis relatives of the human lysine-specific Demethylase1 repress the expression of FWA and FLOWERING LOCUS C and thus promote the Floral transition. Plant Cell. 2007;19:2975–87. doi: 10.1105/tpc.107.052373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Shafiq S, Berr A, Shen W-H. Combinatorial functions of diverse histone methylations in Arabidopsis thaliana flowering time regulation. New Phytol. 2014;201:312–22. doi: 10.1111/nph.12493. [DOI] [PubMed] [Google Scholar]
- 100.Bao Z, Zhang N, Hua J. Endopolyploidization and flowering time are antagonistically regulated by checkpoint component MAD1 and immunity modulator MOS1. Nat Commun. 2014;5:5628. doi: 10.1038/ncomms6628. [DOI] [PubMed] [Google Scholar]
- 101.Grainger RJ, Beggs JD. Prp8 protein: at the heart of the spliceosome. RNA. 2005;11:533–57. doi: 10.1261/rna.2220705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102.Marquardt S, Raitskin O, Wu Z, Liu F, Sun Q, Dean C. Functional consequences of splicing of the antisense transcript COOLAIR on FLC transcription. Mol Cell. 2014;54:156–65. doi: 10.1016/j.molcel.2014.03.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 103.Tamada Y, Yun J-Y, Woo S, chul, Amasino RM. ARABIDOPSIS TRITHORAX-RELATED7 is required for methylation of lysine 4 of histone H3 and for transcriptional activation of FLOWERING LOCUS C. Plant Cell. 2009;21:3257–69. doi: 10.1105/tpc.109.070060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Murakami M, Yamashino T, Mizuno T. Characterization of Circadian-Associated APRR3 Pseudo-Response Regulator belonging to the APRR1/TOC1 quintet in Arabidopsis thaliana. Plant Cell Physiol. 2004;45:645–50. doi: 10.1093/pcp/pch065. [DOI] [PubMed] [Google Scholar]
- 105.Bu Z, Yu Y, Li Z, Liu Y, Jiang W, Huang Y, et al. Regulation of Arabidopsis Flowering by the histone Mark readers MRG1/2 via Interaction with CONSTANS to modulate FT expression. PLOS Genet. 2014;10:e1004617. doi: 10.1371/journal.pgen.1004617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106.Xu Y, Gan E-S, Zhou J, Wee W-Y, Zhang X, Ito T. Arabidopsis MRG domain proteins bridge two histone modifications to elevate expression of flowering genes. Nucleic Acids Res. 2014;42:10960–74. doi: 10.1093/nar/gku781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107.Streitner C, Danisman S, Wehrle F, Schöning JC, Alfano JR, Staiger D. The small glycine-rich RNA binding protein AtGRP7 promotes floral transition in Arabidopsis thaliana. Plant J. 2008;56:239–50. doi: 10.1111/j.1365-313X.2008.03591.x. [DOI] [PubMed] [Google Scholar]
- 108.Eom H, Park SJ, Kim MK, Kim H, Kang H, Lee I. TAF15b, involved in the autonomous pathway for flowering, represses transcription of FLOWERING LOCUS C. Plant J. 2018;93:79–91. doi: 10.1111/tpj.13758. [DOI] [PubMed] [Google Scholar]
- 109.Nakamichi N, Kita M, Niinuma K, Ito S, Yamashino T, Mizoguchi T, et al. Arabidopsis Clock-Associated Pseudo-Response regulators PRR9, PRR7 and PRR5 Coordinately and positively regulate flowering Time through the canonical CONSTANS-Dependent photoperiodic pathway. Plant Cell Physiol. 2007;48:822–32. doi: 10.1093/pcp/pcm056. [DOI] [PubMed] [Google Scholar]
- 110.Yu T-S, Lue W-L, Wang S-M, Chen J. Mutation of Arabidopsis Plastid Phosphoglucose Isomerase affects Leaf Starch Synthesis and Floral Initiation1. Plant Physiol. 2000;123:319–26. doi: 10.1104/pp.123.1.319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 111.Matsoukas IG, Massiah AJ, Thomas B. Starch metabolism and antiflorigenic signals modulate the juvenile-to-adult phase transition in Arabidopsis. Plant Cell Environ. 2013;36:1802–11. doi: 10.1111/pce.12088. [DOI] [PubMed] [Google Scholar]
- 112.Bouveret R, Schönrock N, Gruissem W, Hennig L. Regulation of flowering time by Arabidopsis MSI1. Development. 2006;133:1693–702. doi: 10.1242/dev.02340. [DOI] [PubMed] [Google Scholar]
- 113.Steinbach Y, Hennig L. Arabidopsis MSI1 functions in photoperiodic flowering time control. Front Plant Sci. 2014;5:77. doi: 10.3389/fpls.2014.00077. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 114.Zheng Z, Guan H, Leal F, Grey PH, Oppenheimer DG. Mediator Subunit18 controls flowering Time and Floral Organ Identity in Arabidopsis. PLoS ONE. 2013;8:e53924. doi: 10.1371/journal.pone.0053924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115.Samach A, Onouchi H, Gold Scott E, Ditta Gary S, Schwarz-Sommer Z, Yanofsky Martin F, et al. Distinct roles of CONSTANS Target genes in Reproductive Development of Arabidopsis. Science (80-). 2000;288:1613–6. [DOI] [PubMed]
- 116.Suárez-López P, Wheatley K, Robson F, Onouchi H, Valverde F, Coupland G. CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature. 2001;410:1116–20. doi: 10.1038/35074138. [DOI] [PubMed] [Google Scholar]
- 117.Li Y, Wang H, Li X, Liang G, Yu D. Two DELLA-interacting proteins bHLH48 and bHLH60 regulate flowering under long-day conditions in Arabidopsis thaliana. J Exp Bot. 2017;68:2757–67. doi: 10.1093/jxb/erx143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 118.Kim SY, Yu X, Michaels SD. Regulation of CONSTANS and FLOWERING LOCUS T expression in response to changing light quality. Plant Physiol. 2008;148:269–79. doi: 10.1104/pp.108.122606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 119.Hwang K, Susila H, Nasim Z, Jung J-Y, Ahn JH. Arabidopsis ABF3 and ABF4 transcription factors act with the NF-YC complex to regulate SOC1 expression and mediate Drought-Accelerated Flowering. Mol Plant. 2019;12:489–505. doi: 10.1016/j.molp.2019.01.002. [DOI] [PubMed] [Google Scholar]
- 120.Song H-R, Song J-D, Cho J-N, Amasino RM, Noh B, Noh Y-S. The RNA binding protein ELF9 directly reduces SUPPRESSOR OF OVEREXPRESSION OF CO1 transcript levels in Arabidopsis, possibly via nonsense-mediated mRNA decay. Plant Cell. 2009;21:1195–211. doi: 10.1105/tpc.108.064774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 121.Chen M, Ni M. RFI2, a RING-domain zinc finger protein, negatively regulates CONSTANS expression and photoperiodic flowering. Plant J. 2006;46:823–33. doi: 10.1111/j.1365-313X.2006.02740.x. [DOI] [PubMed] [Google Scholar]
- 122.Mylne Joshua S, Barrett L, Tessadori F, Mesnage S, Johnson L, Bernatavichute Yana V, et al. LHP1, the Arabidopsis homologue of HETEROCHROMATIN PROTEIN1, is required for epigenetic silencing of FLC. Proc Natl Acad Sci. 2006;103:5012–7. doi: 10.1073/pnas.0507427103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 123.Sung S, He Y, Eshoo TW, Tamada Y, Johnson L, Nakahigashi K, et al. Epigenetic maintenance of the vernalized state in Arabidopsis thaliana requires LIKE HETEROCHROMATIN PROTEIN 1. Nat Genet. 2006;38:706–10. doi: 10.1038/ng1795. [DOI] [PubMed] [Google Scholar]
- 124.Jalili V, Afgan E, Gu Q, Clements D, Blankenberg D, Goecks J, et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2020 update. Nucleic Acids Res. 2020;48:W395–402. doi: 10.1093/nar/gkaa434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 125.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–20. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 126.Pertea G, Pertea M. GFF Utilities: GffRead and GffCompare. F1000Research. 2020;9:304. [DOI] [PMC free article] [PubMed]
- 127.Lowe TM, Chan PP. tRNAscan-SE On-line: integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 2016;44:W54–7. doi: 10.1093/nar/gkw413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 128.Jiménez-Jacinto V, Sanchez-Flores A, Vega-Alvarado L. Integrative Differential Expression Analysis for Multiple EXperiments (IDEAMEX): A Web Server Tool for Integrated RNA-Seq Data Analysis. 2019;10. [DOI] [PMC free article] [PubMed]
- 129.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 130.Li J, Ma W, Zeng P, Wang J, Geng B, Yang J, et al. LncTar: a tool for predicting the RNA targets of long noncoding RNAs. Brief Bioinform. 2015;16:806–12. doi: 10.1093/bib/bbu048. [DOI] [PubMed] [Google Scholar]
- 131.Abolghasemi R, Haghighi M, Etemadi N, Wang S, Soorni A. Transcriptome architecture reveals genetic networks of bolting regulation in spinach. BMC Plant Biol. 2021;21:179. doi: 10.1186/s12870-021-02956-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 132.Khoei MA, Karimi M, Karamian R, Amini S, Soorni A. Identification of the Complex Interplay between Nematode-Related lncRNAs and their target genes in Glycine max L. Front Plant Sci. 2021;12:2772. doi: 10.3389/fpls.2021.779597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 133.Sgamma T, Pape J, Massiah A, Jackson S. Selection of reference genes for diurnal and developmental time-course real-time PCR expression analyses in lettuce. Plant Methods. 2016;12:21. doi: 10.1186/s13007-016-0121-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 134.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–8. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 135.Langfelder P, Horvath S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9:559. doi: 10.1186/1471-2105-9-559. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All RNA-Seq data were deposited in the NCBI SRA database under the project PRJNA325073 and PRJNA422994 (https://www.ncbi.nlm.nih.gov/bioproject/ PRJNA325073.
and https://www.ncbi.nlm.nih.gov/bioproject/ PRJNA422994).






