Assessing the Removal Efficiency of Murine Norovirus 1, Hepatitis A Virus, and Human Coronavirus 229E on Dish Surfaces Through General Wash Program of Household Dishwasher

Abstract

The performance of dishwashers in removing live viruses is an important informative value in practical applications. Since foodborne viruses are present in contaminated food surfaces and water environments. Insufficient washing of dishes typically makes a carrier of foodborne viruses. Dishwashers have shown excellent performance in removing bacterial pathogens, but very limited reports related to eliminate foodborne viruses on contaminated dish surfaces. Here, murine norovirus 1 (MNV-1), hepatitis A virus (HAV), and human coronavirus 229E (HCoV-229E) were experimentally inoculated on the dish surfaces (plate, rice bowl, and soup bowl). Plaque assay, 50% tissue culture infectious dose (TCID₅₀), and real-time quantitative polymerase chain reaction (RT-qPCR) were conducted to determine their removal efficiency of them through the general wash program of household dishwashers. Using titration assay, MNV-1 and HAV were reduced by 7.44 and 6.57 log10 PFU/dish, and HCoV-229E was reduced by 6.43 log10 TCID₅₀/dish through the general wash program, achieving a ≥ 99.999% reduction, respectively. Additionally, RT-qPCR results revealed that viral RNA of MNV-1 and HCoV-229E reduced 5.02 and 4.54 log10 genome copies/dish; in contrast, HAV was not detected on any dish surfaces. This study confirmed the performance of household dishwashers in removing pathogenic live viruses through the general wash program. However, residual viral RNA was not sufficiently removed. Further studies are needed to determine whether the viral RNA can be sufficiently removed using combination programs in household dishwashers.

Graphical Abstract

Introduction

The popularity of automatic dishwashers in households has increased and they are rapidly replacing manual washing, owing to their superior performance in effectively removing food residue particles in recent years (Rahman, 1985; Vivian et al., 2011). Meanwhile, longer cycles, combined wash programs, and high-operating temperatures also reduce the microbial load, thus maintaining a sufficient hygiene level on the food contact surface of the tableware (Brands et al., 2020). However, little research has been conducted on virus contaminant removal using household dishwashers.

Non-enveloped human norovirus (HuNoV) and Hepatitis A virus (HAV) are the leading causative agents of acute gastroenteritis. These viruses are transmitted through contaminated water, food, and surfaces and are known to be extremely resistant to environmental conditions (Bosch et al., 2018; WHO, 2015). In addition, a previous study has listed that coronaviruses may also be foodborne viruses (Bosch et al., 2016). Although some studies have confirmed that patients infected with coronaviruses have GI tract symptoms and that coronaviruses can infect enterocytes, to date, there is no conclusive evidence of coronaviruses transmission via food intake (Guo et al., 2021; Li et al., 2021; Xiao et al., 2020). Nevertheless, many studies have pointed to the coronavirus may transmit through contaminated environmental surfaces, food packaging (Hu et al., 2021; Thippareddi et al., 2020).

A brief report from Lucassen et al. (2021) assessed the virucidal efficacy of household dishwashers using bovine coronavirus and murine norovirus as surrogates for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and human norovirus respectively, by determining their relative genomic copies using real-time quantitative polymerase chain reaction (RT-qPCR) (Lucassen et al., 2021). However, the results obtained by PCR cannot accurately measure the amount of live virus on the post-washed dish surface through a dishwasher. Therefore, the exact golden standard, that is, the adoption of a viral titration assay for viability assessment of viral contaminants is needed to ensure if a sufficient reduction in the potential viral contamination on a dish surface through household or restaurant dishwashers.

In the current study, foodborne non-enveloped murine norovirus 1 (MNV-1, surrogate for HuNoVs), HAV, and as well as non-foodborne enveloped human coronavirus 229E (HCoV-229E), were used to compare their titer and genome copies (GC) changes on the dishes (plate, rice bowl, and soup bowl) in pre- and post-treatment through the general wash program of dishwasher, to assess the performance of removing the viral contaminants by the household dishwasher.

Materials and Methods

Cell Lines, Virus Propagation, and Viral Stock Preparation

The murine macrophage (Raw 264.7, TIB-71), HAV HM-175 strain (VR-2097) and its host Macaca mulatta kidney normal (FRhK-4, CRL-1688), as well as HCoV-229E (VR-740) and its host human lung fibroblast cells (MRC-5, CCL-171), were purchased from ATCC (Manassas, VA, US). The MNV-1 (a surrogate for human norovirus) was obtained from Dr. Virgin, Washington University, US. Cells were typically maintained in Dulbecco's Modified Eagle Medium (DMEM) (Sigma, US) including 10% FBS (Gibco Invitrogen) and 1% antibiotic/antimycotic (AA, Gibco Invitrogen) in culture flasks (SPL, Republic of Korea) at 37 °C in a 5% CO₂ incubator.

MNV-1 stock was inoculated in approximately 90% of confluent RAW 264.7 cells, maintained for 1 h in 3 mL of DMEM (1X) containing 2% FBS and 1% AA, incubated at 37 °C under 5% CO₂ condition, for attachment. After infection, fresh medium was added by replacing the used medium and CPE was observed within 48 h (Hwang et al., 2014).

The confluent FRhK-4 cells were washed thrice with PBS prior to inoculation with HAV. After attachment of HAV for 2 h in 3 mL of serum-free DMEM containing 1% AA, the medium was replaced with 10 mL of fresh serum-free DMEM. Then, incubated at 37 °C under a condition of 5% CO₂ until 5 days to observe the CPE (Song et al., 2021).

For HCoV-229E, the virus stock was prepared to inoculate onto 100% confluent MRC-5 cells, which were maintained in 1X Minimum Essential Media (MEM, Sigma, US) with 1% FBS, and 1% AA in tissue culture flask at 33 °C with 5% CO₂ until 5 days to observe the 90% cytopathic effect (CPE) (Bracci et al., 2020). To obtain a higher titer of HCoV-229E, experimental virus stock was obtained by use polyethylene glycol (PEG) 8000 precipitation from 600 mL (1 × 10⁶ TCID₅₀/mL) to 20 mL, accordingly (Kleiner et al., 2015).

For harvesting the viruses, the infected cells were freeze-thawed thrice and centrifuged at 2700×g for 10 min. The supernatant was titrated by using the virus titration assay in “Virus Titration Assay” section, which the working titer of MNV-1, HAV, and HCoV-229E was determined to be 1.0 × 10⁸, 1.2 × 10⁷ PFU/mL, and 1.3 × 10⁷ TCID₅₀/mL, respectively. After the determination of virus titers, the virus stock was divided equally into smaller portions (≥ 1 mL) and stored in a deep freezer at – 80 °C in order to maintain consistent initial titers.

Dishwasher and Experimental Procedures

A newly developed, medium-sized 90 model dishwasher, which can be used in small groups of less than 14 people was selected (SKmagic). Programs of the 90 model dishwasher included wash (general and powerful), dry, care, and other options to fulfill user requirements. In this study, 1 mL of viruses with known titers were inoculated onto the porcelaneous tableware, and then the removal efficiency of MNV-1, HAV, and HCoV-229E on the tableware was assessed through the general wash program (1 h 40 min) in the 90 model without the addition of detergent. Figure 1 illustrates the process of the experiment in which the process Control was made to compare with the programs Treatment by 90 model dishwasher.

Fig. 1.

Experimental flow chart. The left side indicates the flow of the simulated experiment, and the right side indicates the methods for confirming the results in this experiment. Among them, the calibration curves with slope and y intercept for three viruses are listed in the section of RT-qPCR assay

Briefly, two groups of dishes (plate, rice bowl, and soup bowl) were inoculated with 1 mL of each virus solution, respectively. After inoculation, wait for the viral solution dry for 1 h at room temperature. One group was considered for the process Control without wash program treatment, while viruses were recovered directly from the dish surface by using the Sani-MacroSwab kit (Sanigen, Korea) containing 10 mL of PBS and a foam swab. For a Treatment group, rice bowl and soup bowl were placed in the upper bowl basket and plates in the bottom plate basket for the general wash program (Fig. 1). Then, the residual virus on the surface of dishes was recovered by the Sani-MacroSwab kit. Subsequently, vortexing of suspension for 1–2 min and filtering the suspension through 0.2 μm syringe filter were performed consistently during the recovery process. Eventually, 100 μL of recovered MNV-1, HAV, and HCoV-229E solution were adopted for plaque and TCID₅₀ assay, and 500 μL of each recovered viral solution was used for RNA extraction and MNV-1, HAV, and HCoV-229E RT-qPCR assay, respectively. MX 100 Data Acquisition Unit (Yokogawa, Japan) was used to obtain the temperature in the internal compartment of dishwasher and data was supported by SK magic dishwasher developer.

Virus Titration Assay

The recovered viruses from the process Control and the programs Treatment through the 90 model dishwasher were determined by virus titration assay. Plaque assay for MNV-1 and HAV in RAW 264.7 cells and FRhK-4 cell were performed as described previously, with slight modification (Lee et al., 2015; Song et al., 2021). Briefly, RAW 264.7 cells were seeded into 24-well plates (approximately 2 × 10⁵ cells per well). Ten-fold serial dilutions of MNV-1 were prepared using supplemented DMEM with 2% FBS. Confluent cells were inoculated with 100 μL of diluted virus suspension, and one-third of the medium was retained to prevent the wells from drying for 1 h of virus infection at 37 °C with 5% CO₂ in incubator.

HAV was performed on confluent FRhk-4 cells in 12 well plates, with slight modification. A tenfold serial dilution of HAV suspensions was prepared in serum-free 1X DMEM, and 1 mL of the diluted HAV suspension was inoculated into each well after twice washing by PBS. After incubation at 37 °C under 5% CO₂ condition for 2 h for virus attachment, aliquots were removed from each well and washed twice with PBS.

After incubation of 1 h for MNV-1, and 2 h for HAV, each well was overlaid directly with a mixture (1:1) of 2X agarose gel (A9539-500G, Sigma, US) and 2X serum-free DMEM (0.5 mL in 24 well, and 1 mL in 12 well), and incubated at 37 °C with 5% CO₂. Plaques were visible for MNV-1 after 36–48 h, and HAV needs for 5 days. After that, 0.5 mL (for 24 well) and 1 mL (for 12 well) of 10% formalin solution (for 1L = 4 g of sodium phosphate dibasic, 6.5 g of sodium phosphate monobasic, 100 mL of formaldehyde solution, 35.0%) was added to each well at least 4 h for cell fixation at room temperature. The agarose gel was removed using tap water and subsequently stained with 0.1% crystal violet solution for 10 min. The plaques formed clearly after crystal violet was removed.

Fifty-percent tissue culture infectious dose (TCID₅₀) assay was used to titrate HCoV-229E, as described previously (Bracci et al., 2020). MRC-5 cells were seeded into 96 well plate (approximately 1 × 10⁴ cells/well). After 4–5 days of incubation at 37 °C with 5% CO₂, the cells were washed with PBS and inoculated with tenfold pre-diluted HCoV-229E in 1X MEM containing 1% FBS and 1% AA. The plates were incubated at 33 °C with 5% CO₂ for at least 5 days until CPE was observed.

The unit (mL) of recovered viruses were converted in TCID₅₀ or PFU/dish (plate, rice bowl, and soup bowl), and the value of TCID₅₀ or PFU were presented in logarithmic form.

RNA Extraction and RT-qPCR

RNA extraction was performed according to the manufacturer’s instructions (RNeasy mini kit, Qiagen, Valencia, USA). The extracted RNA was immediately analyzed and the remaining RNA was stored at − 80 °C.

Primers, probes, and amplification conditions for the MNV-1, HAV, and HCoV-229E are listed (Table 1). RT-qPCR was performed using the Takara TP800 Thermal Cycler Dice™ real-time system. The RNA sample was amplified in a total 25 µL reaction mixture, including 12.5 µL of Master Mix (2X) (QuantiTect Probe RT-PCR, QIAGEN, Germany), 0.25 µL of reverse transcription Mix (RT QuantiTect), each primer and probe at a final concentration of 500 nM and 250 nM, and with adding RNase-free water up to 25 µL, respectively. Quantification was executed using the standard quantitative genomic viral RNA from ATCC (MNV-1, VR-3255SD; HAV, VR-3257SD; HCoV-229E, VR-740DQ), in which the slope and intercept of MNV-1, HAV, and HCoV-229E were shown in Fig. 1, respectively.

Table 1.

Primers and probes utilized for the three viruses examined in this study

Viruses	Primer/probe	Oligonucleotide sequence (5′–3′)	Amplification conditionsa	References
Murine norovirus 1 (MNV-1)	MNV-1 5036	ACGCTCAGCAGTCTTTGTGA	95 °C for 15 s, 60 °C for 45 s (45 cycles)	Lee et al. (2015)
	MNV-1 5088	CTGGCCTCAGAGCCATTG
	MNV-1 5060	FAM-CGCTGCGCCATCACTCATCC-TAMRA
Hepatitis A virus (HAV)	Forward P	GGT AGG CTA CGG GTG AAA C	95 °C for 10 s, 55 °C for 20 s (45 cycles)	Jothikumar et al. (2005)
	Reverse P	AACAACTCACCAATATCCGC
	HAV Probe	FAM-CTTAGGCTAATACTTCTATGAAGAGATGC-TAMRA
Human coronavirus 229E (HCoV-229E)	N229E-1	CAGTCAAATGGGCTGATGCA	95 °C for 15 s, 55 °C for 20 s, 72 °C for 20 s (45 cycles)	van Elden et al. (2004)
	N229E-2	FAM-CCCTGACGACCACGTTGATGGTTCA-TAMRA
	N229E-P	AAAGGGCTATAAAGAGAATAAGGTATTCT

^aOne-step PCR: complementary DNA synthesis at 50 °C for 30 min (MNV-1), 15 min (HAV and HCoV-229E), and followed by annealing at 95 °C for 15 min

The unit (mL) of recovered viruses were converted in genome copies/dish (plate, rice bowl, and soup bowl), and the value of genome copies (GC) were presented in logarithmic form.

Virus Recovery Rate, Limit of Detection, and Reduction Ratio

The virus recovery rate (%) was calculated through plaque and TCID₅₀ assay as described previously following: Virus recovery rate (%) = recovered virus from the process Control/initial inoculated virus × 100 (Ahmed et al., 2020b) (Fig. 1). Moreover, the sample was prepared again if the recovery efficiency was less than 1% (ISO, 2017).

For negative results on the post-treated dishes, the limit of detection from the collected total volume was considered. In this study, limit of detection (LOD) was considered not detected or less than or equal to the LOD. The LOD was calculated as following:

$$LOD={\text{log}}_{10}[D\times (V/T)],$$

where D is the lowest value in detection (D value was considered to be “1 PFU or TCID₅₀ or 3 genome copy” in this study); V is the  viral enumeration volume (inoculated volume of virus/well in mL) or sample RNA amplicon volume (5 μL/reaction); T is the concentrated or total volume of virus collected from the dishes (Ragan et al., 2020).

The logarithmic reduction in Table 2 was determined according to follow the equation (Brands et al., 2020): Logarithmic reduction = log₁₀ (initial virus load) − log ₁₀ (remaining virus load). Moreover, the reduction ratio (%) was calculated = (recovered virus or genome copies of the process Control − recovered virus or genome copies of the Treatment − LOD value of each virus)/(recovered virus or genome copies of the process Control − LOD value of each virus) × 100 (Fig. 1). Accordingly, we determined that the commercial dishwasher meets the minimum public health and sanitation requirements when the pathogens log reduction was achieved > 5.0 log₁₀ with reduction ratio of ≥ 99.999% according to the international residential dishwasher standard (NSF, 2019).

Table 2.

Changes in virus titers on the dish surface before and after general wash program by plaque and TCID₅₀ assay

Viruses	Viral viability assay (Logarithmic PFU or TCID50/dish)						Logarithmic reduction (ratio, %)a
	Control			Treatment
	Plate	Rice bowl	Soup bowl	Plate	Rice bowl	Soup bowl
MNV-1	7.39 ± 0.08	7.29 ± 0.10	7.65 ± 0.08	ND	ND	ND	7.44 (≥ 99.999) ****
HAV	6.63 ± 0.11	6.39 ± 0.19	6.69 ± 0.09	ND	ND	ND	6.57 (≥ 99.999) ****
HCoV-229E	6.54 ± 0.07	6.29 ± 0.19	6.46 ± 0.26	ND	ND	ND	6.43 (≥ 99.999) ****

ND not detected

****p < 0.0001

^aMean value of three dish surfaces (plate, rice bowl, and soup bowl). When the reduction was > 5 log₁₀, the value of reduction ratio was presented as “ ≥ 99.999” in table

Statistical Analysis

The unpaired t test was conducted for analyzing the changes of virus titers and residual viral RNA in the Control and the Treatment (general wash program). The analyses were conducted using the GraphPad Prism (version 9.1.0) and statistically significant difference was defined with p < 0.05.

Results

Virus Recovery Rate, Limit of Detection, Temperature in General Wash Program

The process Control group was conducted to calculate the viral recovery rate of inoculated MNV-1, HAV, and HCoV-229E, respectively on the dishes. The recovery rate of MNV-1, HAV, and HCoV-229E were 28.66 ± 9.85, 43.61 ± 15.91, and 18.98 ± 8.29%, respectively (Table 2). The LOD value of the HAV and HCoV-229E were 1.0 log₁₀ PFU or TCID₅₀/dish, while MNV-1 was 2.0 log₁₀ PFU/dish; however, LOD value for RT-qPCR detection was 2.8 log₁₀ GC/dish. The temperature of over 56 °C has lasted 23.2 min, and the highest temperature of 68.6 °C was detected at the bottom basket during 1 h 40 min processing in the inner compartment of dishwasher (Fig. 2).

Fig. 2.

Internal temperature variation of general wash program during 1 h 40 min processing. The part above the dotted line is the duration of time over than 56 °C

Determining the Removal Efficiency of Virus on the Dish Surfaces Through the General Wash Program by Titration Assay

The removal efficiency was assessed by the changes in virus titers on the dish surfaces of the Control and the Treatment, i.e., logarithmic reduction and ratio were shown in Table 2. For non-enveloped MNV-1 titers change on the dish surfaces, the Control group showed the MNV-1 was > 7.0 log₁₀ PFU/dish level on the dishes, while in the Treatment group, the MNV-1 titers were not detected (ND) on any dish surfaces. In comparison with the Control group, 7.44 log₁₀ PFU/dish (≥ 99.999%) reduction was confirmed in Treatment group (p < 0.0001). Similarly, HAV was not detected (ND) on any dish surfaces and 6.57 log₁₀ PFU/dish (≥ 99.999%) reduction was achieved (p < 0.0001). For enveloped HCoV-229E, 6.43 log₁₀ TCID₅₀/dish with ≥ 99.999% of reduction was determined on each dish surface (Table 2). In addition, none of the viruses were detected in the discharged water after the general wash program (data not shown).

Assess the Residual Viral RNA on the Dish Surfaces Through the General Wash Program

The residual load of viral RNA on dish surfaces was determined by RT-qPCR (Table 3). After the general wash program, a significant reduction of 5.02, 7.18, and 4.54 log10 GC/dish in MNV-1, HAV, and HCoV-229E were observed (p < 0.0001) (Table 3), respectively. However, 5.45, 4.79, and 4.49 log₁₀ GC/dish of residual MNV-1, and 5.70, 5.42, and 5.86 log₁₀ GC/dish of residual HCoV-229E were detected on the plate, rice bowl, and soup bowl surfaces, respectively. In addition, the wastewater discharged from the general wash program showed that the viral load reached 5.86, 2.57, and 2.97 log₁₀ GC/mL in MNV-1, HAV, and HCoV-229E, respectively (data not shown).

Table 3.

Changes in viral RNA on dish surface before and after the general wash program by RT-qPCR

Virus	Viral RNA (Logarithmic genome copies/dish)						Logarithmic reduction (genome copies/dish) a
	Control			Treatment
	Plate	Rice bowl	Soup bowl	Plate	Rice bowl	Soup bowl
MNV-1	9.96 ± 0.02	9.85 ± 0.06	9.99 ± 0.03	5.45 ± 0.04	4.79 ± 0.25	4.49 ± 0.14	5.02****
HAV	6.97 ± 0.06	7.40 ± 0.09	7.19 ± 0.11	ND	ND	ND	7.18****
HCoV-229E	10.15 ± 0.10	10.26 ± 0.02	10.19 ± 0.02	5.70 ± 0.09	5.42 ± 0.09	5.86 ± 0.05	4.54****

ND not detected

^aMean value of detected on the dish surfaces

Discussion

Titration Assay in Determining the Removal Efficiency of Virus on the Dishes

In this study, we utilized a foam swab kit containing 10 mL of PBS to recover three viruses. The recovery results also showed that the recovery efficiency of the foam swab kit reached a reliable level (Table 2). This paved the way for the subsequent evaluation of the virus removal efficiency in the dishwasher. We employed the virus titration assay (plaque and TCID₅₀) to assess the viral removal efficiency of the 90 model dishwasher from the dish surfaces through the general wash program without the use of detergents. Because the titration assay is the only standard for detecting live viruses. Considering the LOD value of each assay, a significant reduction of > 5.0 log₁₀ of MNV-1, HAV, and HCoV-229E was observed through the general wash program (Table 2). The virus removal rate of the three viruses considered in this study reached ≥ 99.999%, which demonstrated that sufficient removal of viral contaminants can be achieved through the 90 model household dishwasher. Meanwhile, it determined that the 90 model dishwasher achieved the minimum public health and sanitation requirements according to the National Sanitation Foundation (NSF/ANSI 184-2019) standards (NSF, 2019).

Thermal inactivation was particularly considered to be the most effective for microbial killing (Wernersson et al., 2006). Some viruses can be inactivated at 56 °C for 20 min (Park et al., 2016). As our study showed that the temperature of over 56 °C lasted inside dishwasher for 23.2 min and the highest temperature was 68.6 °C (Fig. 2), it is speculated that the viral capsid was degraded during the dishwash process due to the temperature of the internal compartment, resulting in the loss of its infectivity. However, the resistance of non-enveloped viruses to high temperatures has been demonstrated as well (Bozkurt et al., 2014, 2015; Gibson & Schwab, 2011; Sow et al., 2011). Bozkurt et al. (2014) compare the thermal inactivation kinetics of HAV, FCV-F9 (feline calicivirus), and MNV-1 by first-order and Weibull models. The first-order model (50–72 °C) ranged from 0.21 to 19.75 min for FCV-F9, 0.25–36.28 min for MNV-1, and 0.88–56.22 min for HAV. In the meanwhile, Weibull model, the t_D=1 (time to destroy 1 log) at the same temperature ranged 0.10–13.27, 0.09–26.78, and 1.03–39.91 min (Bozkurt et al., 2014). Moreover, Sow et al. (2011) concluded that the thermal resistance of HAV was higher than MNV-1 at 85 and 90 °C and suggested that HAV would be a good candidate as a surrogate for studies involving thermal inactivation of foodborne enteric viruses.

This study used HCoV-229E strain as a SARS-CoV-2 surrogate because SARS-CoV-2 experiment is not allowed in the general biosafety level 2 (BSL 2) laboratory (Jung et al., 2023; Lee et al., 2022; Owen et al., 2021). As they have similar properties and sensitivities to the external environment, such as pH, temperature, and humidity (Jung et al., 2023; Lee et al., 2022), the removal efficiency of the 90 model dishwasher against HCoV-229E may imply the elimination of SARS-CoV-2.

Live virus was not detected in the dish or wastewater after the general wash program. It was difficult to determine whether the viruses were thermally inactivated or removed from dishes because there was another explanation may due to the effective rinsing on the surface of dishes by spray (Uhlig et al., 2017). The wastewater produced during the general wash program was measured to be about 30 L. However, we directly collected 1 mL for titration assay during analysis. As a result, a high LOD value and thus could not be detected with viruses (data not shown). In subsequent studies, virus adsorption-elution (VIRADEL) may be an effective approach to reduce the LOD value to recover the viruses from discharged wastewater of household dishwashers (Ahmed et al., 2020a; Haramoto et al., 2012).

In our study, it is critical that foodborne non-enveloped viruses MNV-1 and HAV, and enveloped virus HCoV-229E can be sufficiently removed during 1 h 40 min the general wash program. This demonstrates the excellent performance of 90 model household dishwashers in removing enveloped and non-enveloped viruses in a general wash program. Generally, cleaning of the dishes is achieved through a combination of programs, such as the combination of wash and dry or wash and care. Through general wash program, ≥ 99.999% of the non-enveloped and enveloped viruses can be sufficiently removed; thus, a combination of programs will be more effective to achieve the controllable standard.

Viral RNA Residual on the Dishes

The residual load of MNV-1, HAV, and HCoV-229E RNA on the dish surfaces was significantly reduced to 4.54 –7.18 log₁₀ GC/dish after the wash program (Table 3). According to a previous study, only water washing reduced 0.9 log₁₀ reduction GC/mL for MNV, 1.0 for MVA (vaccinia virus Ankara), and 1.6 for bovine coronavirus at the temperature of 50 °C. The cleaning process with the addition of a detergent enhanced the 3.8–4.8 log₁₀ reduction of each virus (Lucassen et al., 2021). Our data was different from that reported by Lucassen et al. (2021). This difference may be due to the experimental design, methodology application, and the different types of dishwasher machines. The 90 model is a newly developed dishwasher that included high temperature controller and high-intensity water pressure spray heads with quad wave zone rinsing. It was noteworthy that dishwashing with only water can reduce viral RNA to significant level although this study did not include detergent in washing process.

The key point of this study determined that the virus had lost its infectious viability in the general wash program even if RNA residues were present after the wash program. While HAV RNA was not detected on the dishes after the wash program, its RNA was still detected in the wastewater. We speculated that PCR assay was unable to detect the exact count of residual RNA for HAV due to consider a few factors such as high LOD value. Our results suggest that the RNA of the virus cannot be eliminated from the dish surfaces even through the wash program.

However, our experiments are only carried out on dishes, while specific data on cutlery, cups, different chopping boards from materials, and other types of tableware are still lacking. Subsequent research on obtaining a representative set of tableware is a more worthy reference for a dishwasher to remove viral and bacterial pathogens. Moreover, instead of combining programs for the reduction of viral contaminants with food residues, we used the dishwasher program separately to reduce the viral contaminants without food residues. Although, this procedure may not be the same as a domestic dishwasher. Therefore, the addition of detergent in dishwashers may be more accurate as an assessment of cleaning ability for mixtures of postprandial residues (such as oil stains) and viral contaminants. However, multiple factors such as the impact of postprandial residues and detergent on virus infection assay in vitro should be considered critically.

Overall, we conducted a lab study with high concentrations of viral contamination on household dishes and further demonstrated the removal efficiency of viruses on the dish surface through the general wash program of the 90 model itself. Though viral RNA remained on the surface of the dishes and in the wastewater, the viral viability was lost in the general wash program. Simultaneously, it cannot pose a threat to the safety of food tableware and human health because naked residual viral RNA has no infectious ability and degrades rapidly in the environment (McCall et al., 2021). The correlation between residual food contaminants and viruses; the ability of dishwashers to remove them in mixed form; the associated experimental processing method require further research in household dishwashers for considering commercial purposes.

Conclusion

After inoculating three types of viruses on dish surfaces, we determined the virus titer changes through the general wash program of the household dishwasher without adding detergent. The household dishwasher could achieve over 5.0 log₁₀ (≥ 99.999%) reduction of non-enveloped MNV-1, HAV, and enveloped HCoV-229E through the general wash program. To ensure safe commercial and domestic use, combined programs of wash and dry or wash and care are recommended. Additionally, this research allows customers to realize the value of a commercial dishwasher in food safety.

Author Contributions

ZW: Investigation, Methodology, Data curation, Writing-Original draft preparation, reviewing and editing. SJ, DY, SP, SW, YS, MK: Provided assistance throughout the study. M.I.H.: original draft reviewing and revision. CC: Conceptualization, Methodology, Supervision, Funding acquisition, Investigation, Reviewing, Editing, and revision.

Declarations

Conflict of interest

The authors declared that they have no conflict of interest.