Skip to main content
Journal of Food Science and Technology logoLink to Journal of Food Science and Technology
. 2022 Nov 19;60(1):283–291. doi: 10.1007/s13197-022-05613-y

Polysaccharides from apple pomace exhibit anti-fatigue activity through increasing glycogen content

Chunguang Li 1,✉, Xinjun Zhu 2, Jingxia Zhang 2, Tisen Xu 2, Hong Zhang 2, Zhiping Zheng 1, Ramasamy Rajesh Kumar 3
PMCID: PMC9813301  PMID: 36618038

Abstract

The polysaccharides were isolated from apple pomace by hot-water extraction, and their anti-fatigue activity was evaluated in C2C12 muscle myoblasts and male Kunming mice. The purified polysaccharides from apple pomace (PAP) have a molecular weight of 1.74 × 105 Da and were composed of mannose, rhamnose, glucose, galactose and arabinose. In C2C12 myoblasts, PAP showed no cytotoxicity in the concentrations of 0–300 μg/ml. PAP treatment increased the glycogen content, while the ATP content was not affected in C2C12 myoblasts. Further investigation found that the activity and gene expression of glycogen synthase, rather than glycogen phosphorylase, were upregulated by PAP treatment. The studies in vivo showed that PAP treatment did not affect the food intake and weight again in mice. Importantly, PAP prolonged the exhaustive swimming time, increased hepatic and skeletal muscle glycogen levels, and effectively inhibited the accumulation of blood lactic and blood urea nitrogen in mice. Taken together, the results suggested that PAP exhibit anti-fatigue activity in vitro and in vivo through increasing glycogen content.

Keywords: Polysaccharides, Apple pomace, Anti-fatigue activity, Glycogen content

Introduction

Apple (Malus domestica) is a widely cultivated food crop among the world with nutritional and medicinal values. China, the United States, and India are the three leading apple producing countries in the world. The global production of apples fruit had exceeded 85 million metric tons in 2018 (De la Peña-Armada et al. 2020), approximately 30% of which was used to process into juices and juice concentrates (Cargnin et al. 2017; Fernandes et al. 2019a). Apple pomace, which represents up to 30% of the original fruit weight (Lavelli et al. 2012; Usman et al. 2020), is the main by-product in the processing of apple juice concentrate. Millions of tons of apple pomace are produced annually, and currently, most of the apple pomace is underutilized and go to waste. In recent years, some efforts have been devoted to integrate the deep processing of apple pomace to fully utilize its potential values (Waldbauer et al. 2017; Ravn-Haren et al. 2018). Apple pomace consists of peel and residual flesh (95%), stem (1%) and seed (2–4%) material (Bhushan et al. 2008; Vendruscolo et al. 2008; Skinner et al. 2018). In order to achieve food deep processing and promote economic benefits, apple pomace has been used as substrates for some bioactive compounds, such as pectin, phenolics, flavonoids, polyphenols and so on (Sudha et al. 2016; Dranca et al. 2019).

Fatigue is a symptom that lack of energy or a feeling of tiredness or sluggishness, and often manifested as the reduction in the ability to sustain muscular work (Finsterer 2019). The depletion of energy sources (e.g., ATP and glycogen) and accumulation of ammonia in body are the main causes of fatigue (Coqueiro et al. 2019). To date, the satisfy and effective pharmacological drugs for treatment of fatigue are very limited, some efforts have focused on the traditional medicine or natural product for relieving fatigue (Peuckmann et al. 2010). Recently, studies showed that some natural products, such as soybean peptides, polysaccharides, have obvious anti-fatigue activity (Wang et al. 2010; Li et al. 2018). In a previous study, we reported that the total flavonoids from sweetpotato [Ipomoea batatas (L.) Lam] leaf exhibited significant anti-fatigue activity in mice (Li et al. 2013).

In the present study, we extracted and purified the polysaccharides from apple pomace (PAP) using hot-water extraction method, and the molecular weight and chemical composition were analyzed. The effects of PAP on the cell viability, glycogen and ATP contents were investigated in C2C12 cells. The anti-fatigue effect of PAP in mice was investigated using an exhaustive swimming exercise, and the glycogen, blood lactic (BL) and blood urea nitrogen (BUN) contents in mice were also determined.

Materials and methods

Chemicals

Apple pomace were collected from Red Fuji Apple (Shandong, China), air-dried and ground to fine powder prior to experiments. High glucose Dulbecco’s Modified Eagle’s Medium (DMEM), horse serum (HS) and fetal bovine serum (FBS) were obtained from Hyclone (Logan City, Utah, USA). Trifluoroacetic acid (TFA, ≥ 99.0%) was purchased from Macklin (Beijing, China), 1-phenyl-3-methyl-5-pyrazolone (PMP) was obtained from Sigma-Aldrich (Missouri, USA).

Extraction and purification of polysaccharides from apple pomace

PAP was extracted using hot-water extraction method reported previously with some modifications (Cheng et al. 2018; Chen et al. 2019). Briefly, dried ground apple pomace powder (1.0 kg) was boiled with ethanol to remove alcohol-soluble components. Then the fine powder was emerged in water and incubated in boil water for 2 h with shaking. The extraction solution was centrifuged at 8000 rpm for 20 min. The obtained supernatants were concentrated by vacuum-rotary evaporation to 1/10 of the original volume. Then the supernatant was mixed with ethanol (1:5, v:v) and stored at 4 °C for 16 h. The mixture was centrifuged at 10,000 rpm for 15 min, and the precipitated was redissolved in distilled water. The yield of PAP from apple pomace was calculated from Eq. (1).

Y=WPAPWAP×100% 1

where Y is the PAP yield, WPAP and WAP are the weight of PAP and apple pomace, respectively.

Molecular weight determination and monosaccchride composition analysis

The average molecular weight of PAP was determined by gel filtration method on an Agilent 1100 HPLC system according to previous reports (Zhao et al. 2020). Briefly, standard dextran of different molecular weight (12,000, 22,000, 50,000, 110,000, 200,000 and 400,000 Da) were subjected to a Sephacryl S-300 gel column (Sigma-Aldrich Co., St. Louis, USA) using distilled water as the mobile phase. The elution volume (Ve) and void volume (Vo) were recorded and a standard curve was established by plotting logM on the x-axis against Ve/Vo on the y-axis. The Ve of PAP (dissolved in distilled water) was determined under the same conditions, and the relative molecular weight was calculated based on the standard curve.

The PAP (5.0 mg) was hydrolyzed with TFA and converted to its PMP derivative using Zhao et al (2020) method. Then the derivative products were analyzed using HPLC (Agilent 1100) equipped with a C18 column (250 mm × 4.6 mm, 5 μm) with a mobile phase for elution of Na2PO4 solution (100 mM, pH = 6.5) plus acetonitrile. The monosaccharides were then identified by comparing the retention time with monosaccharides references (mannose, ribose, ribose, rhamnose, glucuronic acid, galacturonic acid, glucose, gagactose, xylose, arabinose and fucose).

Anti-fatigue activity in C2C12 myoblasts

C2C12 myoblasts (ATCC) were maintained in DMEM including10% FBS and 1% streptomycin–penicillin. C2C12 cells were seeded in a 24-well plate at a density of 3 × 105 cells/well, incubated in a humid incubator at 37 °C with 5% CO2. After reaching 80% of confluence, the C2C12 cell were then cultured in DMEM containing 2% HS for 6 days for cell differentiation. The PAP dissolved in cell culture were added to cells at final concentrations of 0, 50, 100, 200 and 300 μg/ml. The cells were then further cultured for 24 h, and the cell viability was evaluated by CCK-8 assay.

The anti-fatigue activity of PAP in C2C12 myoblasts was evaluated by measuring the glycogen and ATP contents. The differentiated C2C12 myoblasts were treated with PAP (0, 50, 100, 200 and 300 μg/ml) for 24 h at 37 °C. The cells were lysed for glycogen, ATP, and the enzymes activity of glycogen synthesis (GS) and phosphorylase (GP) determination. The glycogen contents were determined using the glycogen assay kit (Abcam) and the ATP contents were determined using an ATP assay kit (Sigma-Aldrich). The enzyme activity of GS and GP were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China).

Animals and treatments

Seven-week-old Kunming male mice (18–20 g) were purchased from Jinfeng Experimental Animal Co., Ltd (Jinan, China) and all the animal experiments were performed in compliance with the Guiding Principles for the Care and Use of Laboratory Animals approved by the Animal Ethics Committee of China. All mice were housed (6 mice/cage) for 1 week with 12 h light–dark cycles at 21–25 °C. Standard commercial mouse feed and DW were provided ad libitum.

The mice were randomly divided in four groups (n = 6) and treated daily by oral gavage once a day for 4 consecutive weeks with distilled water (control group) or 50, 100 and 200 mg of PAP per kg body weight. The PAP used were prepared in distilled water. The food uptake and body weight of mice during the experiment, exhaustive swimming time and some physiological indexes were measured.

Exhaustive swimming exercise

The in vivo anti-fatigue activity of PAP was evaluated by an exhaustive swimming test as described previously (Chen et al. 2016; Baek et al. 2019). Briefly, the mice were loaded with a tine wire (5% of body weight) to the tail and individually forced to swim in a tank (50 × 50 × 50 cm, filled with 30 cm of fresh water maintained at 25 ± 1 °C) at one hour after the last oral administration of PAP. The mice were assessed to be exhausted when they sunk into the water and could not rise to the surface of water within 7 s, and the longest swimming time was recorded.

Biochemical parameters analysis

After swimming for 90 min without a load, the mice were sacrificed and the blood, liver, and gastrocnemius muscle were collected immediately. Plasma was separated after centrifugation at 3000 rpm at 4 °C for 10 min. The liver and gastrocnemius muscle were quickly frozen in liquid nitrogen and stored at – 80 °C for analysis. The levels of BL, BUN, and glycogen were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China).

RT-qPCR analysis

After treatment with PAP for 24 h, the total RNA of C2C12 myoblasts was extracted using TRIzol reagent (Invitrogen, CA, USA), and then converted to cDNA using reverse transcriptase enzyme and random hexamers. RT-qPCR was performed in the QuantStudio™ 6 and 7 Flex Real-Time PCR System (Life Technologies) using SYBR green chemistry (Tiangen, China). The primers used for target genes are listed in Table 1. The threshold cycle (Ct) values for the target genes were normalized to the value of β-actin and the relative gene expression was calculated by using the ΔΔCt method.

Table 1.

Primers Used for RT-qPCR

Gene Primer sequences
Sequences (5′ to 3′)
GS

Forward GCGTTCCCAAGAAGTGGCTTA

Reverse GGTCCAGCTTACGCATAATCTG

GP

Forward CAAATCAGCGTTCGTGGCTTA

Reverse CCACATTGCGATCCTTGACCA

β-Actin

Forward ACACCCCAGCCATGTACG

Reverse TGGTGGTGAAGCTGTAGCC

Statistical analysis

All experiments were conducted in triplicate, and the data were presented as mean ± SD. Statistical analyses were performed by one-way analysis of variance (ANOVA) followed by Student’s t-test. p-value < 0.05 was taken to be statistically significant.

Results and discussion

Characterization of PAP

The crude PAP yield from apple pomace was determined as 12.4%, which was comparable with previous study (Fernandes et al. 2019b). The crude PAP was then separated using DEAE Sepharose FF column and two portions were obtained. As can be seen from Fig. 1a, the major component PAP (PAP-1) was eluted with distilled water and a small fraction of PAP (PAP-2) was obtained under 0.1 M NaCl elution. The major component of PAP was then further purified by Sephacryl S-300 column (Fig. 1b) and used in the following anti-fatigue studies. The molecular weight of PAP was determined by gel filtration method and the results showed that the PAP has a mean molecular weight of 1.74 × 105 Da. The monosaccharide composition of PAP was analyzed after thiolysis reaction. The result in Fig. 1c showed the PAP were composed of monosaccharides of mannose, rhamnose, glucose, galactose and arabinose with percentages of 6.1%, 12.2%, 47.8%, 8.5% and 24.4%, respectively. Recently, Fernandes et al. (2019b) reported that the polysaccharides from apple pomace with molecular weight of 1–12 kDa which were purified by C18 solid-phase extraction and dialysed using 12–14 kDa cut-off membranes. The difference in monosaccchride composition might be attributed to the extraction and purification methods.

Fig. 1.

Fig. 1

Purification and characterization of PAP. a stepwise elution curve of PAP by DEAE-52 column; b elution curve of PAP-1 by Sephacryl S-300 and c HPLC chromatogram of hydrolyzed PAP-1

Effect of PAP on C2C12 myoblasts viability

We firstly measured the cell viability under PAP treatment in C2C12 myoblasts using CCK-8 kit. Figure 2 showed that, after 24 h treatment, the PAP at concentrations up to 300 μg/ml had no significant cytotoxicity. In our study, the non-cytotoxic concentration was used in the following cell exposure experiments.

Fig. 2.

Fig. 2

Effect of PAP on the cell viability of C2C12 myoblasts. C2C12 were differentiated for 6 days and then treated with various concentrations of PAP for 24 h. The cell viability was determined by CCK-8 method, and expressed as a fold over the control (Non-treatment). n.s., not statistically significantly different

Anti-fatigue activity of PAP in C2C12 myoblasts

The primary line of murine myoblasts C2C12 cells are a feasible model of skeletal muscle, and have been used and validated for anti-fatigue evaluation in basic research and drug discovery (Burattini et al. 2004; Huang et al. 2021; Zhu et al. 2021). In the present study, the anti-fatigue activity of PAP was investigated using C2C12 cells model. ATP is the immediate energy for muscle contraction, and the glycogen serves as an energy storage for ATP production when energy is needed in muscle (Nozawa et al. 2019; Cong et al. 2014). Here the ATP and glycogen contents were determined to evaluate the anti-fatigue activity of PAP in C2C12 myoblasts. As can be seen from Fig. 3a, the ATP content was not affected after PAP treatment. Figure 3b showed the changes of glycogen contents under PAP treatment. Compared with that of the control group, the glycogen content was increased by 1.42, 1.53 and 1.62 folds by PAP at concentrations of 100, 200 and 300 μg/ml, respectively. These results showed that the PAP could increase the energy storage in terms of glycogen in C2C12 myoblasts. As two important energy forms, ATP and glycogen are derived from different glucose metabolism pathways, and catalyzed by specific enzymes in each pathway. ATP is produced from glucose catabolism processes, including glycolysis, tricarboxylic acid cycle and oxidative phosphorylation, while the glycose is generated by the branched polymerization of glucose. The difference between ATP and glycogen response to PAP may attribute to PAP have different effect on the enzymes involved in these two processes.

Fig. 3.

Fig. 3

Effect of PAP on the a glycogen and b ATP contents in C2C12 myoblasts. C2C12 were differentiated for 6 days and then treated with various concentrations of PAP for 24 h. The results are expressed as a fold over the control (Non-treatment). *P < 0.05 compared with the control group

Sine GS and GP are the two key enzymes regulating of glycogen metabolism (Díaz-Lobo et al. 2015; Baek et al. 2019), we further investigated the effect of PAP on the two enzymes activity and gene expression in C2C12 cells. As shown in Fig. 4a, compared with the control, the GS activity was increased by up to 1.2 to 1.5-fold under PAP treatment. In the GP activity assay, we found that the enzyme activity was not influenced by PAP in the concentration of 50–300 μg/ml (Fig. 4b). The effects of PAP on the gene expression of GS and GP were also determined, and the results showed that treatment with PAP resulted in an enhanced expression of GS at the PAP concentrations ≥ 100 μg/ml. The gene expression levels of GS were about 1.5, 2.2 and 2.8 folds as compared to that of control at PAP concentrations of 100, 200 and 300 μg/ml, respectively. The changes of GP gene expression were not significant under PAP treatment except at the highest concentration of 300 μg/ml. These results indicated that PAP could increase glycogen content though upregulating glycogen synthesis and GS gene expression in C2C12 cells.

Fig. 4.

Fig. 4

Effect of PAP on the enzyme activity and mRNA level of glycogen synthase (GS) and glycogen phosphorylase (GP) in C2C12 myoblasts. C2C12 were differentiated for 6 days and then treated with various concentrations of PAP for 24 h. The results expressed as a fold over the control (Non-treatment). *P < 0.05 compared with the control group, n.s., not statistically significantly different

Effects on PAP on food intake and body weight gain of mice

As can be seen from Fig. 5a, the food intake for mice was not affected by PAP treatment. We also investigated the mice’s body weight gain during the 4-weeks experimental period. The results in Fig. 5b showed that the body weight of all groups was increased gradually in the experiment, and there was no statistically significant difference between groups. So, the PAP administration did not affect ad libitum food intake and body weight gain in mice.

Fig. 5.

Fig. 5

Effects of PAP on a food intake and b weight gain of the mice during the experiment. The data are expressed as means ± SEM (n = 10)

Effect of PAP on exhaustive swimming exercise

Exercise tolerance is an important indicator in assessing anti-fatigue effects (Chen et al. 2016; Hsiao et al. 2017). In the present study, the weight-loaded forced swimming test was conducted to assess the anti-fatigue effect of PAP in mice. As shown in Fig. 6, the average exhaustive swimming time for each PAP treated group was significantly prolonged than that of control group. Compared with the control group, the exhaustive swimming time was 1.3, 1.78 and 1.9 folds under PAP administration at concentrations of 50, 100, 200 and 300 μg/ml, respectively, indicating that PAP exhibited significant anti-fatigue activity in vivo. The PAP showed comparable anti-fatigue activity with flavonoids under the same exhaustive swimming exercise test conditions (Li et al. 2013).

Fig. 6.

Fig. 6

Effect of PAP on the exhaustive swimming time of the mice treated with various concentration of PAP in mice. The data are expressed as means ± SEM (n = 6). *P < 0.05 compared with the control group (nontreatment group)

Effects of PAP on hepatic and muscle glycogen contents

The glycogen could be broken down to glucose and used for energy during prolonged exercise, and its content could reflect the degree of fatigue (Burnley et al. 2018). The in vitro study in C2C12 myoblasts showed that the PAP could increase glycogen content, so we further investigated the effect of PAP on glycogen contents in vivo. As shown in Table 2, PAP administration for 4 weeks increased the hepatic glycogen content in a concentration-dependent manner, and a significant increase was observed at PAP concentrations above 100 mg/kg. The muscle glycogen showed a greater increasing under PAP administration at concentrations above 50 mg/kg. These results showed that PAP treatment increased both hepatic and muscle glycogen, and this might contribute to its anti-fatigue activity.

Table 2.

Effect of PAP on hepatic and muscle glycogen of mice

PAP (mg/kg) Glycogen (mg/g)
Hepatic Muscle
0 9.24 ± 1.56 1.64 ± 0.86
50 10.57 ± 2.14 2.51 ± 1.07*
100 14.22 ± 2.13* 3.16 ± 1.19*
200 19.28 ± 2.14* 3.14 ± 1.22*

The data are expressed as means ± SEM (n = 6)

*P < 0.05 compared with control group (0 mg/kg of PAP treated group)

Effect of PAP on blood lactate and urea nitrogen levels

The fatigue-related biochemical parameters in mice were also measured to elucidate the anti-fatigue activity of PAP in vivo. Here we examined whether PAP could affect the accumulation of BL and BUN in mice after swimming for 90 min. Lactic is formed under anaerobic conditions through glycolysis which is the main energy source in skeletal muscles during intense exercise (Pundir et al. 2016). The accumulation of BL is an important indicator for evaluating the speed and extent of fatigue development (Lin et al. 2014; Zhao et al. 2016). BUN is the chief end product of protein metabolism and often considered as a sensitive index to evaluate the status of fatigue (Tan et al. 2012; Xu et al. 2013). As can be seen from Fig. 7a, the BL content was decreased significantly, by up to 87.1%, 74.6% and 67.9% relative to control group under PAP treatment at concentrations of 50, 100 and 200 mg/kg, respectively. PAP administration also significantly decreased BUN content at concentrations of 100 and 200 mg/kg, which was about 75.1% and 72.4% of the control group, respectively (Fig. 7b). These results showed that PAP inhibited the accumulation of BL and BUN in mice after swimming.

Fig. 7.

Fig. 7

Effects of PAP on the a blood lactate and b blood urea nitrogen of mice. The data are expressed as means ± SEM (n = 6). *P < 0.05 compared with the control group (nontreatment group)

Conclusion

In this study, the polysaccharides were isolated and purified from apple seeds. The PAP have a molecular weight of 1.74 × 105 Da and were composed mainly of mannose, rhamnose, glucose, galactose and arabinose. The in vitro studies in C2C12 myoblasts found that PAP could upregulate GS gene expression and then increase GS activity and glycogen content, while the ATP content was not affected under PAP treatment. The PAP could prolong the exhaustive swimming time, increase hepatic and muscle glycogen and decrease BL and BUN accumulation in mice. The data in this paper demonstrated that PAP exhibited significant anti-fatigue activity and thus may have a potential as anti-fatigue agent. This is the first study, to our knowledge, to investigate the anti-fatigue activity of apple polysaccharides and find that the increasing GS gene expression and glycogen content may account for the anti-fatigue activity of polysaccharides. Further studies are required to investigate the underlying mechanism by which polysaccharides upregulate the gene expression and activity of glycogen synthesis.

Abbreviations

PAP

Polysaccharides from apple pomace

GS

Glycogen synthase

GP

Glycogen phosphorylase

BL

Blood lactic

BUN

Blood urea nitrogen

Authors' contributions

CL, Conceptualization; XZ, methodology and writing; RRK, data curation; JZ, validation and writing; TX, data curation; HZ, formal analysis; ZZ, data curation.

Funding

This research was financially supported by the Social Science Planning and Research Project of Shandong Province (16CTYJ21).

Data availability

The data that support the findings of this study are available from the corresponding author, [C Li; Email: li_chunguang@163.com], upon reasonable request.

Declarations

Conflict of interest

The authors themselves have no conflict of interest at all.

Ethics approval

All the trials were performed in compliance with the Guiding Principles for the Care and Use of Laboratory Animals approved by the Animal Ethics Committee of Dezhou University (No. 11/04/2020).

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Baek M, Virgilio S, Lamb TM, Ibarra O, Andrade JM, Gonçalves RD, Dovzhenok A, Lim S, Bell-Pedersen D, Bertolini MC, Hong CI. Circadian clock regulation of the glycogen synthase (GSN) gene by WCC is critical for rhythmic glycogen metabolism in Neurospora crassa. Proc Natl Acad Sci USA. 2019;116:10435–10440. doi: 10.1073/pnas.1815360116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bhushan S, Kalia K, Sharma M, Singh B, Ahuja PS. Processing of apple pomace for bioactive molecules. Crit Rev Biotechnol. 2008;28:285–296. doi: 10.1080/07388550802368895. [DOI] [PubMed] [Google Scholar]
  3. Burattini S, Ferri P, Battistelli M, Curci R, Luchetti F, Falcieri E. C2C12 murine myoblasts as a model of skeletal muscle development: morpho-functional characterization. Eur J Histochem. 2004;48:223–233. [PubMed] [Google Scholar]
  4. Burnley M, Jones AM. Power-duration relationship: physiology, fatigue, and the limits of human performance. Eur J Sport Sci. 2018;18:1–12. doi: 10.1080/17461391.2016.1249524. [DOI] [PubMed] [Google Scholar]
  5. Cargnin ST, Gnoatto SB. Ursolic acid from apple pomace and traditional plants: a valuable triterpenoid with functional properties. Food Chem. 2017;220:477–489. doi: 10.1016/j.foodchem.2016.10.029. [DOI] [PubMed] [Google Scholar]
  6. Chen YM, Lin CL, Wei L, Hsu YJ, Chen KN, Huang CC, Kao CH. Sake protein supplementation affects exercise performance and biochemical profiles in power-exercise-trained mice. Nutrients. 2016;8:106. doi: 10.3390/nu8020106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen F, Huang G, Yang Z, Hou Y. Antioxidant activity of Momordica charantia polysaccharide and its derivatives. Int J Biol Macromol. 2019;138:673–680. doi: 10.1016/j.ijbiomac.2019.07.129. [DOI] [PubMed] [Google Scholar]
  8. Cheng H, Huang G. Extraction, characterisation and antioxidant activity of Allium sativum polysaccharide. Int J Biol Macromol. 2018;114:415–419. doi: 10.1016/j.ijbiomac.2018.03.156. [DOI] [PubMed] [Google Scholar]
  9. Cong W, Zhao T, Zhu Z, Huang B, Ma W, Wang Y, Tan Y, Chakrabarti S, Li X, Jin L, Cai L. Metallothionein prevents cardiac pathological changes in diabetes by modulating nitration and inactivation of cardiac ATP synthase. J Nutr Biochem. 2014;25:463–274. doi: 10.1016/j.jnutbio.2013.12.007. [DOI] [PubMed] [Google Scholar]
  10. Coqueiro AY, Rogero MM, Tirapegui J. Glutamine as an anti-fatigue amino acid in sports nutrition. Nutrients. 2019;11:863. doi: 10.3390/nu11040863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. De la Peña-Armada R, Villanueva-Suárez MJ, Rupérez P, Mateos-Aparicio I. High hydrostatic pressure assisted by celluclast®releases oligosaccharides from apple by-product. Foods. 2020;9:1058. doi: 10.3390/foods9081058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Díaz-Lobo M, Garcia-Amorós J, Fita I, Velasco D, Guinovart JJ, Ferrer JC. Selective photoregulation of the activity of glycogen synthase and glycogen phosphorylase, two key enzymes in glycogen metabolism. Org Biomol Chem. 2015;13:7282–7288. doi: 10.1039/C5OB00796H. [DOI] [PubMed] [Google Scholar]
  13. Dranca F, Oroian M. Optimization of pectin enzymatic extraction from malus domestica 'fălticeni' apple pomace with celluclast 1.5L. Molecules. 2019;24:2158. doi: 10.3390/molecules24112158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fernandes PAR, Le Bourvellec C, Renard C, Nunes FM, Bastos R, Coelho E, Wessel DF, Coimbra MA, Cardoso SM. Revisiting the chemistry of apple pomace polyphenols. Food Chem. 2019;294:9–18. doi: 10.1016/j.foodchem.2019.05.006. [DOI] [PubMed] [Google Scholar]
  15. Fernandes PAR, Silva AMS, Evtuguin DV, Nunes FM, Wessel DF, Cardoso SM, Coimbra MA. The hydrophobic polysaccharides of apple pomace. Carbohydr Polym. 2019;223:115132. doi: 10.1016/j.carbpol.2019.115132. [DOI] [PubMed] [Google Scholar]
  16. Finsterer J. Biomarkers of peripheral muscle fatigue during exercise. BMC Musculoskel Dis. 2019;13:218. doi: 10.1186/1471-2474-13-218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hsiao CY, Chen YM, Hsu YJ, Huang CC, Sung HC, Chen SS. Supplementation with Hualian No. 4 wild bitter gourd (Momordica charantia Linn. var. abbreviata ser.) extract increases anti-fatigue activities and enhances exercise performance in mice. J Vet Med Sci. 2017;79:1110–1119. doi: 10.1292/jvms.17-0079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Huang WY, Youk JS, Han BK, Heo W, Yun BS, Kim JS, Koo YT, Hwang KA, Yoon JA, Kim YJ. Improvement of fatigue symptoms and endurance capacity by the combined administration of Cervus elaphus L., Angelica gigas Nakai, and Astragalus membranaceus Bunge. J Med Food. 2021;24:577–585. doi: 10.1089/jmf.2020.4743. [DOI] [PubMed] [Google Scholar]
  19. Lavelli V, Kerr W. Apple pomace is a good matrix for phytochemical retention. J Agric Food Chem. 2012;60:5660–5666. doi: 10.1021/jf3010993. [DOI] [PubMed] [Google Scholar]
  20. Li C, Zhang L. In vivo anti-fatigue activity of total flavonoids from sweetpotato [Ipomoea batatas (L.) Lam.] leaf in mice. Indian J Biochem Biol. 2013;50:326–329. [PubMed] [Google Scholar]
  21. Li Y, Xin Y, Xu F, Zheng M, Xi X, Cui X, Cao H, Guo H, Han C. Maca polysaccharides: extraction optimization, structural features and anti-fatigue activities. Int J Biol Macromol. 2018;115:618–624. doi: 10.1016/j.ijbiomac.2018.04.063. [DOI] [PubMed] [Google Scholar]
  22. Lin Y, Liu HL, Fang J, Yu CH, Xiong YK, Yuan K. Anti-fatigue and vasoprotective effects of quercetin-3-O-gentiobiose on oxidative stress and vascular endothelial dysfunction induced by endurance swimming in rats. Food Chem Toxicol. 2014;68:290–296. doi: 10.1016/j.fct.2014.03.026. [DOI] [PubMed] [Google Scholar]
  23. Nozawa Y, Yamada K, Okabe Y, Ishizaki T, Kuroda M. The anti-fatigue effects of the low-molecular-weight fraction of bonito extract in mice. Biol Pharm Bull. 2019;32:468–474. doi: 10.1248/bpb.32.468. [DOI] [PubMed] [Google Scholar]
  24. Peuckmann V, Elsner F, Krumm N, Trottenberg P, Radbruch L. Pharmacological treatments for fatigue associated with palliative care. Cochrane Db Syst Rev. 2010;11:cd006788. doi: 10.1002/14651858.CD006788.pub2. [DOI] [PubMed] [Google Scholar]
  25. Pundir CS, Narwal V, Batra B. Determination of lactic acid with special emphasis on biosensing methods: a review. Biosens Bioelectron. 2016;86:777–790. doi: 10.1016/j.bios.2016.07.076. [DOI] [PubMed] [Google Scholar]
  26. Ravn-Haren G, Krath BN, Markowski J, Poulsen M, Hansen M, Kołodziejczyk K, Kosmala M, Dragsted LO. Apple pomace improves gut health in Fisher rats independent of seed content. Food Funct. 2018;9:2931–2941. doi: 10.1039/C7FO01932G. [DOI] [PubMed] [Google Scholar]
  27. Skinner RC, Gigliotti JC, Ku KM, Tou JC. A comprehensive analysis of the composition, health benefits, and safety of apple pomace. Nutr Rev. 2018;76:893–909. doi: 10.1093/nutrit/nuy033. [DOI] [PubMed] [Google Scholar]
  28. Sudha ML, Dharmesh SM, Pynam H, Bhimangouder SV, Eipson SW, Somasundaram R, Nanjarajurs SM. Antioxidant and cyto/DNA protective properties of apple pomace enriched bakery products. J Food Sci Tech. 2016;53:1909–1918. doi: 10.1007/s13197-015-2151-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tan W, Yu K, Liu Y, Ouyang M, Yan M, Luo R, Zhao X. Anti-fatigue activity of polysaccharides extract from Radix Rehmanniae Preparata. Int J Biol Macromol. 2012;50:59–62. doi: 10.1016/j.ijbiomac.2011.09.019. [DOI] [PubMed] [Google Scholar]
  30. Usman M, Ahmed S, Mehmood A, Bilal M, Patil PJ, Akram K, Farooq U. Effect of apple pomace on nutrition, rheology of dough and cookies quality. J Food Sci Technol. 2020;57:3244–3251. doi: 10.1007/s13197-020-04355-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Vendruscolo F, Albuquerque PM, Streit F, Esposito E, Ninow JL. Apple pomace: a versatile substrate for biotechnological applications. Crit Rev Biotechnol. 2008;28:1–12. doi: 10.1080/07388550801913840. [DOI] [PubMed] [Google Scholar]
  32. Waldbauer K, McKinnon R, Kopp B. Apple pomace as potential source of natural active compounds. Planta Med. 2017;83:994–1010. doi: 10.1055/s-0043-111898. [DOI] [PubMed] [Google Scholar]
  33. Wang J, Li S, Fan Y, Chen Y, Liu D, Cheng H, Gao X, Zhou Y. Anti-fatigue activity of the water-soluble polysaccharides isolated from Panax ginseng C.A. Meyer. J Ethnopharmacol. 2010;130:421–423. doi: 10.1016/j.jep.2010.05.027. [DOI] [PubMed] [Google Scholar]
  34. Xu C, Lv J, Lo YM, Cui W, Hu X, Fan M. Effects of oat β-glucan on endurance exercise and its anti-fatigue properties in trained rats. Carbohydr Polym. 2013;92:1159–1165. doi: 10.1016/j.carbpol.2012.10.023. [DOI] [PubMed] [Google Scholar]
  35. Zhao YQ, Zeng L, Yang ZS, Huang FF, Ding GF, Wang B. Anti-fatigue effect by peptide fraction from protein hydrolysate of croceine croaker (Pseudosciaena crocea) swim bladder through inhibiting the oxidative reactions including DNA damage. Mar Drugs. 2016;14:221. doi: 10.3390/md14120221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zhao S, Han Z, Yang L, Hong B, Zhu H. Extraction, characterization and antioxidant activity evaluation of polysaccharides from Smilacina japonica. Int J Biol Macromol. 2020;151:576–583. doi: 10.1016/j.ijbiomac.2020.02.015. [DOI] [PubMed] [Google Scholar]
  37. Zhu H, Xu W, Wang N, Jiang W, Cheng Y, Guo Y, Yao W, Hu B, Du P, Qian H. Anti-fatigue effect of Lepidium meyenii Walp. (Maca) on preventing mitochondria-mediated muscle damage and oxidative stress in vivo and vitro. Food Funct. 2021;12:3132–3141. doi: 10.1039/D1FO00383F. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author, [C Li; Email: li_chunguang@163.com], upon reasonable request.


Articles from Journal of Food Science and Technology are provided here courtesy of Springer

RESOURCES