Skip to main content
NCBI home page
Heliyon logoLink to Heliyon
. 2022 Dec 15;8(12):e12383. doi: 10.1016/j.heliyon.2022.e12383

Molecular characterization of extended-spectrum cephalosporin and fluoroquinolone resistance genes in Salmonella and Shigella isolated from clinical specimens in Thailand

Thayat Sriyapai a,c, Chaiwat Pulsrikarn b, Kosum Chansiri c, Pichapak Sriyapai c,d,∗
PMCID: PMC9813710  PMID: 36619450

Abstract

Antimicrobial resistance of Salmonella and Shigella has become a major clinical and public health problem. The incident of co-resistance to third generation cephalosporins and fluoroquinolone is a serious therapeutic issue in Thailand. The present study aimed to investigate the antimicrobial resistance and molecular character of clinical Shigella and Salmonella isolates. A total of 33 Salmonella and 53 Shigella cefotaxime-resistant isolates were collected from human clinical cases in Thailand during the period from 2011–2018. The antimicrobial susceptibility of Salmonella and Shigella was determined by the disk diffusion method, and extended-spectrum beta-lactamase (ESBL) production was characterized by the double-disk synergy test. Genotype characterization was performed by PCR and DNA sequencing. Thirty-two (97.0%) and fifty-two (98.1%) isolates of cefotaxime-resistant Salmonella and Shigella, respectively, were identified as ESBL producers. Shigella sonnei (4 isolates), Salmonella serovar 4,5,12:i:- (6 isolates), Salmonella serovar Agona (2 isolates) and Salmonella serovar Rissen (2 isolates) showed co-resistance to ciprofloxacin and cefotaxime or ceftriaxone. The combination of blaCTX-M-15 plus other ESBL and/or AmpC β-lactamase genes was the most dominant of the genotype patterns in ESBL-producing isolates. The plasmid harbouring the aac(6′)-Ib-cr gene and mutations of gyrA (S83F, D87Y or D87G) and parC (T57S) genes was found in 2 ESBL-producing Salmonella isolates. Three Shigella sonnei isolates harboured mutations in gyrA (S83L, D87Y or D87G), and only one Shigella sonnei phase I isolate showed mutations in both gyrA (S83L and D87G) and parC (S80I) genes. Among these clinical Shigella sonnei isolates, qnrS determinants were identified. Production of ESBLs is an important mechanism for resistance to extended-spectrum cephalosporins in Salmonella and Shigella. The emergence of a decreased susceptibility to extended-spectrum cephalosporins and fluoroquinolone in ESBL-producing isolates has important clinical and therapeutic implications.

Keywords: Antimicrobial resistance, Extended-spectrum cephalosporins, Fluoroquinolone, Salmonella, Shigella

Antimicrobial resistance; Extended-spectrum cephalosporins; Salmonella; Shigella; Quinolones.

1. Introduction

Non-typhoidal Salmonella and Shigella strains cause major diarrheal diseases in developing countries (Majowicz et al., 2010; Niyogi, 2005). High levels of multidrug resistant (MDR) non-typhoidal Salmonella and Shigella strains isolated from clinical specimens resistant to third generation cephalosporins have been detected in Asia (Ji et al., 2010; Lee et al., 2009). The production of extended-spectrum-lactamases (ESBLs) is a major resistance mechanism to extended-spectrum cephalosporins (ESCs) in Salmonella and Shigella (Pulsrikarn et al., 2017; Ji et al., 2010; Kulwichit et al., 2007). Although ESBL-producing strains of Salmonella and Shigella have been relatively rare in comparison to other enteric pathogens over the last few decades, an increasing number of these organisms are resistant to at least three different antibiotic classes (Yah, 2010).

According to a previous study, most ESBL genes are encoded by plasmids, some of which also carry genes providing resistance to other antimicrobials such as fluoroquinolones, trimethoprim-sulfamethoxazole, tetracyclines, and aminoglycosides (Woodford et al., 2009). The plasmid-mediated quinolone resistance (PMQR) genes have frequently been associated with the ESBL phenotypes conferred by the blaTEM, blaOXA and blaCTX-M genes (Doumith et al., 2012). The mechanisms of high-level fluoroquinolone resistance are chromosomal mutations in the quinolone resistance-determining regions (QRDR) with changes in either DNA gyrase (gyrA and gyrB) and/or topoisomerase IV (parC and parE) genes (Giraud et al., 2006). However, fluoroquinolone resistance isolates carried PMQR determinants associated with low-level fluoroquinolone resistance. The genes encoding PMQR are qnr genes (qnrA, qnrB, qnrC, qnrS and qnrV), efflux pump genes (qepA and oqxAB) and a variant of aminoglycoside acetyl transferase (aac-(6′)-lb-cr) (Jacoby et al., 2014; Robicsek et al., 2006a, Robicsek et al., 2006b, Robicsek et al., 2006c). Resistance to quinolones can be mediated by plasmids that produce the quinolone resistance protein (Qnr). Bacterial DNA was protected from fluoroquinolone lethal inhibition by Qnr protein through competitive bind to DNA gyrase and topoisomerase IV. The other gene is aac-(6′)-lb-cr gene is the variation of aac-(6′)-lb gene also known as genes encoding for aminoglycoside acethyltransferase, responsible for resistance to tobramycin, amikacin, and kanamycin (Robicsek et al., 2006a, Robicsek et al., 2006b, Robicsek et al., 2006c). The co-existence and dissemination of plasmids containing ESBL and PMQR genes by ESBL-producing Enterobacteriaceae is a major public health concern (Rodríguez-Martínez et al., 2011).

Previous research demonstrated the high prevalence of ESBL-producing and MDR Enterobacteriaceae in Thai patients (Kiratisin et al., 2008). Considering previous data from Thailand, the possibility of multidrug resistant Salmonella and Shigella is a public health problem (Pulsrikarn et al., 2017; Sirichote et al., 2010; Hiranrattana et al., 2005). The rising trend of third-generation cephalosporins and ciprofloxacin resistance in clinical Salmonella and Shigella isolates is concerning because these drugs are commonly used to treat community-acquired invasive bacterial infections. However, few studies have published genotype data on antimicrobial resistance to ESCs and fluoroquinolone in clinical Salmonella and Shigella isolates (Chung et al., 2015; Archambault et al., 2006). The present study aimed to investigate the antimicrobial susceptibility to ESCs and fluoroquinolone, as well as the characterization of resistance genes (ESBL, QRDR and PMQR genes) in cefotaxime-resistant Salmonella and Shigella isolates obtained from clinical specimens in Thailand.

2. Materials and methods

2.1. Shigella and Salmonella strains

Clinical isolates of 893 Salmonella and 253 Shigella from intestinal infection cases were obtained from The WHO National Salmonella and Shigella Centre in Thailand from 2011 to 2018. The WHO National Salmonella and Shigella Centre received all presumptive Shigella and Salmonella isolates from all public health laboratories in all regions of Thailand. All clinical isolates were tested for antimicrobial drug susceptibility to ESCs and quinolones. Cefotaxime-resistant clinical isolates were selected and tested in this study, which included 33 Salmonella spp. (consisting of 6 Salmonella enterica serovar Agona isolates, 25 Salmonella enterica serovar 4,5,12:i:- isolates, and 2 Salmonella enterica serovar Rissen isolates) and 53 Shigella spp. (consisting of 14 Shigella sonnei phase I isolates, 37 Shigella sonnei phase II isolates, 1 Shigella sonnei phase I, II isolate and 1 Shigella flexneri type 2a isolate). All isolates were confirmed for the included species using biochemical tests according to the method of Edwards and Ewing (1986). Salmonella isolates were serotyped according to antigenic characterization based on the White-Kaufmann-Le Minor scheme described by Popoff (2001). Shigella serotype was identified using specific antisera with slide agglutination according to the method of Ewing and Lindberg (1984).

2.2. Antimicrobial susceptibility and extended-spectrum beta-lactamase assay

Disk diffusion tests were performed according to the Clinical and Laboratory Standards Institute (CLSI) criteria (CLSI, 2018) using disks (Oxoid Limited, Hampshire, England) impregnated with ampicillin (AMP; 10 μg), cefotaxime (CTX; 30 μg), ceftriaxone (CRO; 30 μg), ceftazidime (CAZ; 30 μg), cefoxitin (FOX, 30 μg), ciprofloxacin (CIP; 5 μg), and nalidixic acid (NAL; 30 μg). The cultures were grown on Mueller-Hinton agar (Oxoid Limited, Hampshire, England), and zones of growth inhibition were measured following incubation at 37 °C for 24 h. Escherichia coli ATCC 25922 was used as a quality control and tested under the same conditions. The CLSI for “other Enterobacteriaceae” described a method for screening ESBL-producing strains using double-disk diffusion. Double-disk diffusion was performed using both cefotaxime (30 μg) and ceftazidime (30 μg) disks each alone and in combination with clavulanic acid (cefotaxime/clavulanic acid (30/10 μg) and ceftazidime/clavulanic acid (30/10 μg) (Oxoid Limited, Hampshire, England). Klebsiella pneumoniae ATCC 700603 (ESBL positive) and E. coli ATCC 25922 (ESBL negative) were used as quality control strains for ESBL screening test. The MICs for ceftazidime (256–0.016 μg/mL), ceftriaxone (256–0.016 μg/mL), cefotaxime (256–0.016 μg/mL), cefoxitin (256–0.016 μg/mL) and ciprofloxacin (32–0.002 μg/mL) were tested using the Liofilchem MIC Test Strips (Liofilchem, Roseto degli Abruzzi, Italy) following the instructions provided by the manufacturer.

2.3. PCR-based characterization of antimicrobial resistance genes

Antimicrobial resistance genes were detected using PCR and DNA sequencing. The primers and amplification conditions for each PCR reaction are listed in Table 1. Detection of the ESBL genes associated with β-lactams and cephalosporins-resistant Shigella and Salmonella was performed as previously described (Le et al., 2015; Ji et al., 2010; Hasman et al., 2005; Kojima et al., 2005; Olesen et al., 2004), and the CTX group, including the blaCTX-M-1 group and blaCTX-M-9 group primers, was confirmed as previously described (Le et al., 2015; Ji et al., 2010). Detection of mutations in the QRDR of gyrA and parC genes and screening for PMQR, including, qnrA, qnrB, qnrS1, and aac(6’)-lb-cr genes, were achieved by PCR and sequencing as previously described (Pu et al., 2009; Cattoir et al., 2007; Hu et al., 2007; Park et al., 2006; Robicsek et al., 2006c, Robicsek et al., 2006b, Robicsek et al., 2006a; Wiuff et al., 2000).

Table 1.

Primers used in this study for determination ESBL, QDRD and PMQR genes of Salmonella and Shigella.

Primer Sequence (5′ to 3′) TAnneal. (ºC) Size (bp) Ref.
ESBL and AmpC β-lactamases genes for Salmonella
blaTEM

  • F: GCGGAACCCCTATTTG

  • R: ACCAATGCTTAATCAGTGAG

 50 964 Olesen et al. (2004)
blaSHV

  • F: TTCGCCTGTGTATTATCTCCCTG

  • R: TTAGCGTTGCCAGTGYTCG

 55 854 Hasman et al. (2005)
blaCMY-2

  • F: GCACTTAGCCACCTATACGGCAG

  • R: GCTTTTCAAGAATGCGCCAGG

 55 758 Hasman et al. (2005)
blaCTX-M-1 gr.

  • F: GAATTAGAGCGGCAGTCGGG

  • R: CACAACCCAGGAAGCAGGC

 56 588 Le et al. (2015)
blaCTX-M-9 gr.

  • F: GTGCAACGGATGATGTTCGC

  • R: GAAACGTCTCATCGCCGATC

 56 475 Le et al. (2015)
ESBL and AmpC β-lactamases genes for Shigella
blaTEM

  • F: ATAAAATTCTTGAAGACGAAA

  • R: GACAGTTACCAATGCTTAATC

 45 1,076 Ji et al. (2010)
blaSHV

  • F: GCCTTTTCGGCCTTCACTCAAG

  • R: TTAGCGTTGCCAGTGCTCGATCA

 55 989 Ji et al. (2010)
blaCMY-2

  • F: ATGATGAAAAAATCGTTATGCT

  • R: TTATTGCAGCTTTTCAAGAATGCG

 60 1,122 Kojima et al. (2005)
blaCTX-M-1 gr.

  • F: GGCCCATGGTTAAAAAATCACTGC

  • R: CCGTTTCCGCTATTACAAACCGTTG

 55 891 Ji et al. (2010)
blaCTX-M-9 gr.

  • F: GTGACAAAGAGAGTGCAACGG

  • R: TGATTCTCGCCGCTGAAGCC

 55 856 Ji et al. (2010)
QRDR genes for Salmonella
gyrA

  • F: TACCGTCATAGTTATCCACGA

  • R: GTACTTTACGCCATGAACGT

 56 588 Wiuff et al. (2000)
parC

  • F: CTATGCGATGTCAGAGCTGG

  • R: TAACAGCAGCTCGGCCTATT

 56 475 Wiuff et al. (2000)
PMQR genes for Salmonella
qnrA

  • F: GGGTATGGATATTATTGATAAAG

  • R: CTAATCCGGCAGCACTATTA

 55 579 Cattoir et al. (2007)
qnrB

  • F: GGMATHGAAATTCGCCACTG

  • R: TTTGCYGYYCGCCAGTCGAA

 50 263 Cattoir et al. (2007)
qnrS

  • F: GCAAGTTCATTGAACAGGGT

  • R: TCTAAACCGTCGAGTTCGGCG

 55 427 Cattoir et al. (2007)
aac(6′)-lb-cr

  • F: TTGCGATGCTCTATGAGTGGCTA

  • R: CTCGAATGCCTGGCGTGTTT

 55 482 Park et al. (2006)
QRDR genes for Shigella
gyrA

  • F: TACACCGGTCAACATTGAGG

  • R: TTAATGATTGCCGCCGTCGG

 52 648 Hu et al. (2007)
parC

  • F: GTACGTGATCATGGACCGTG

  • R: TTCGGCTGGTCGATTAATGC

 52 531 Hu et al. (2007)
PMQR for Shigella
qnrA

  • F: ATTTCTCACGCCAGGATTTG

  • R: GATCGGCAAAGGTYAGGTCA

 55 579 Robicsek et al. (2006)
qnrB

  • F: GATCGTGAAAGCCAGAAAGG

  • R: ACGAYGCCTGGTAGTTGTCC

 53 263 Robicsek et al. (2006)
qnrS

  • F: TGGAAACCTACAATCATACA

  • R: TGCAATTTTGATACCTGATG

 46 427 Cano et al., 2009
aac(6′)-lb-cr

  • F: GCAACGCAAAAACAAAGTTAGG

  • R: GTGTTTGAACCATGTACA

 46 560 Pu et al., (2009)
Open in a new tab

TAnneal.: Annealing temperature.

Genomic DNA from a pure culture grown at 37 °C on tryptic soy agar was extracted using the Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA). To detect resistance genes, Ex Taq DNA polymerase (Takara Bio Inc., Shiga, Japan) was used. The amplification conditions for all PCR reactions were standardized as follows: pre-denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 98 °C for 10 s, annealing at optimum temperature for 1 min and DNA extension at 72 °C for 1–1.30 min, and a final extension at 72 °C for 10 min. The annealing temperatures varied for the different primers. The PCR products were analysed by gel electrophoresis using a 1% agarose gel run at 100 V for 30 min. To visualize band migration, the gel was stained with fluorescent dye and visualized under UV transillumination. A 1-kb or 100-bp ladder (Gibco BRL, Ontario, USA) was used to estimate the amplicon size. PCR amplicon product using primers specific to antimicrobial resistance genes were sequenced at the Macrogen company sequencing facility using an Applied Biosystems 3730 mXL automated DNA sequencer (Macrogen, Seoul, Korea). The DNA sequences were compared to those in the GenBank database (https://www.ncbi.nlm.nih.gov/) using the BLAST suite of sequence similarity searching programs.

3. Results

During the period of the study, 893 Salmonella and 253 Shigella stock cultures were chosen for antimicrobial drug susceptibility testing. The antimicrobial resistance patterns of clinical 53 Shigella and 33 Salmonella isolates against 7 drugs (ampicillin, ceftriaxone, cefotaxime, ceftazidime, cefoxitin, ciprofloxacin and nalidixic acid) were determined (Table 2 and Table 3). The results showed that all Shigella isolates were resistant to ampicillin, cefotaxime and ceftriaxone, followed by ceftazidime (84.9%), nalidixic acid (62.3%), ciprofloxacin (7.6%) and cefoxitin (1.9%) (Table 3). Four Shigella sonnei (7.5%) exhibited co-resistance to both ciprofloxacin and third-generation cephalosporins. Most of the Salmonella isolates (consisting of 25 isolates of Salmonella serovar 4,5,12:i:-, 6 isolates of Salmonella serovar Agona and 2 isolates of Salmonella serovar Rissen) were 100% resistant to ampicillin, cefotaxime, ceftazidime and ceftriaxone. Seven (21.2%) Salmonella isolates (consisting of 5 isolates of Salmonella serovar Agona and 2 isolates of Salmonella serovar Rissen) showed resistance to cefoxitin (Table 2). Ten (30.3%) isolates (consisting of 6 isolates of Salmonella serovar 4,5,12:i:-, 2 of isolates Salmonella serovar Agona and 2 of isolates Salmonella serovar Rissen) showed co-resistance to ciprofloxacin and cefotaxime.

Table 2.

Antimicrobial susceptibility and ESBL-producing of Shigella isolates from clinical specimens.

Antimicrobial agent (μg) Isolates (%)
R/ESBL I/ESBL S/ESBL
AMP (10) 53 (100.0)/52 (98.1) - -
FOX (30) 1 (1.9)/1 (1.9) - 52 (98.1)/51 (96.2)
CTX (30) 53 (100.0)/52 (98.1) - -
CAZ (30) 45 (84.9)/45 (84.9) 6 (11.3)/6 (11.3) 2 (3.8)/1 (1.9)
CRO (30) 53 (100.0)/52 (98.1) - -
NAL (30) 33 (62.3)/31 (58.5) 16 (30.2)/16 (30.2) 4 (7.6)/3 (5.7)
CIP (5) 4 (7.6)/4 (7.6) 40 (75.5)/38 (71.7) 9 (17.0)/8 (15.1)
Open in a new tab

S, susceptibility; I, ​intermediate; R resistant; AMP, ampicillin; CAZ, ceftazidime; CTX, cefotaxime; CRO, ceftriaxone; FOX, cefoxitin; NAL, nalidixic acid and CIP, ciprofloxacin.

Table 3.

Antimicrobial susceptibility and ESBL-producing of Salmonella isolates from clinical specimens.

Antimicrobial agent (μg) Number of isolates (%)
R/ESBL I/ESBL S/ESBL
AMP (10) 33 (100)/32 (97.0) - -
FOX (30) 7 (21.2)/7 (21.2) 5 (15.2)/5 (15.2) 21 (63.6)/20 (60.6)
CTX (30) 33 (100.0)/32 (97.0) - -
CAZ (30) 32 (100.0)/32 (100.0) - 1 (3.03)/0 (0.0)
CRO (30) 33 (100.0)/32 (97.0) - -
NAL (30) 10 (30.3)/10 (30.3) 9 (27.3)/8 (24.2) 14 (42.4)/14 (42.4)
CIP (5) 10 (30.3)/10 (30.3) 16 (48.5)/15 (45.4) 7 (21.2)/7 (21.2)
Open in a new tab

S, susceptibility; I, intermediate; R resistant; AMP, ampicillin; CAZ, ceftazidime; CTX, cefotaxime; CRO, ceftriaxone; FOX, cefoxitin; NAL, nalidixic acid and CIP, ciprofloxacin.

Fifty-two (98.1%) and thirty-two (97.0%) cefotaxime-resistant Shigella and Salmonella isolates, respectively, were positive for ESBL production. The ESBL-producing strains screened in the present study were resistant to two classes of antibiotics, including quinolones and third-generation cephalosporins (antimicrobials used to treat bacterial infections) (Table 4). The strains with the highest multidrug resistance were 2 isolates of Salmonella serovar Agona, 2 isolates of Salmonella serovar Rissen, and 1 isolate of Shigella sonnei, which were resistant to seven antimicrobial agents (AMP-FOX-CTX-CAZ-CRO-CIP-NAL). All ESBL-producing Salmonella isolates were resistant to cefotaxime and ceftriaxone in 100% of the isolates, and cross-resistance to cefoxitin in 5 (15.1%) Salmonella serovar Agona isolates and 2 (6.1%) Salmonella serovar Rissen isolates. Additionally, all ESBL-producing Shigella isolates were resistant to cefotaxime and ceftriaxone in 100% of the isolates and cross-resistance to ceftazidime and cefoxitin in 46 (86.8%) and 1 (1.9%) of the Shigella sonnei isolates, respectively.

Table 4.

Antimicrobial patterns and ESBL/non ESBL-producing of Salmonella and Shigella isolates from clinical specimens.

Strain Antimicrobial resistance pattern No. of isolates
ESBL (%) Non-ESBL (%)
Sal. serovar,
S. Agona AMP-CTX-CAZ-CRO 1 (3.0) 0 (0.0)
AMP-FOX-CTX-CAZ-CRO 3 (9.1) 0 (0.0)
AMP-FOX-CTX-CAZ-CRO-CIP-NAL 2 (6.1) 0 (0.0)
S.I. 4,5,12:i:- AMP-CTX-CRO 0 (0.0) 1 (3.0)
AMP-CTX-CAZ-CRO 18 (54.5) 0 (0.0)
AMP-CTX-CAZ-CRO-CIP-NAL 6 (18.2) 0 (0.0)
S. Rissen AMP-FOX-CTX-CAZ-CRO-CIP-NAL 2 (6.1) 0 (0.0)
Total 32 1
Shi. serotype,
Sonnei AMP-CTX-CRO 3 (5.7) 0 (0.0)
AMP-CTX-CAZ-CRO 17 (32.1) 0 (0.0)
AMP-CTX-CRO-NAL 2 (3.8) 1 (1.1)
AMP-CTX-CAZ-CRO-NAL 25 (47.2) 0 (0.0)
AMP-CTX-CAZ-CRO-CIP-NAL 3 (5.7) 0 (0.0)
AMP-FOX-CTX-CAZ-CRO-CIP-NAL 1 (1.9) 0 (0.0)
Flexneri AMP-CTX-CRO-NAL 1 (1.9) 0 (0.0)
Total 52 1
Open in a new tab

AMP, ampicillin; CAZ, ceftazidime; CTX, cefotaxime; CRO, ceftriaxone; FOX, cefoxitin; NAL, nalidixic acid and CIP, ciprofloxacin.

The present study provides the first description of the variety of the β-lactamase resistance gene patterns in Salmonella and Shigella isolates from clinical samples in Thailand (Table 5 and Table 6). The results showed that β-lactamase genes encoding CMY-2, TEM-1 and CTX-M were found in 26, 21, and 19 ESBL-producing Salmonella isolates, respectively. Based on PCR assays and sequencing, the CTX-M-1 group was more prevalent than the CTX-M-9 group. The CTX-M-1 and CTX-M-9 groups were represented by blaCTX-M-15 genes (18 isolates) and blaCTX-M-14 genes (1 isolate), respectively. In addition, 39, 34 and 22 of ESBL-producing Shigella isolates harboured β-lactamase resistance gene encoding CTX-M, TEM-1 and CMY-2, respectively. ESBL-producing Shigella isolates carrying blaCTX-M-15 genes (35 isolates) were significantly higher than those carrying blaCTX-M-14 genes (4 isolates). Thirty-two ESBL-producing Salmonella showed high MIC levels to cefotaxime (96–≥256 μg/ml), ceftazidime (32–≥256 μg/ml), ceftriaxone (≥256 μg/ml) and cefoxitin (1.5–≥256 μg/ml). Fifty-two ESBL-producing Shigella sonnei isolates exhibited high MIC levels to cefotaxime (94–≥256 μg/ml), ceftazidime (12–≥256 μg/ml), ceftriaxone (128–≥ 256 μg/ml) and cefoxitin (1.5–8 μg/ml). Three Shigella sonnei isolates showed high MIC levels ≥256 μg/ml to cefotaxime, ceftazidime and ceftriaxone.

Table 5.

MIC values to cephalosporins and ESBL genes of 32 ESBL-producing of Salmonella isolates from clinical specimens.

Strain Antimicrobial pattern No. isolate MIC (μg/ml)
 β-lactamase and ESBL gene
FOX CTX CAZ CRO
S. Agona FOX-CTX-CAZ-CRO-CIP-NAL (n = 2) 1 ≥256 128 ≥256 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 ≥256 96 ≥256 ≥256 blaTEM-1, blaCMY-2
FOX-CTX-CAZ-CRO (n = 3) 1 ≥256 96 ≥256 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 ≥256 128 96 ≥256 blaTEM-1, blaCMY-2
1 96 ≥256 128 ≥256 blaTEM-1, blaCMY-2
CTX-CAZ-CRO (n = 1) 1 4 128 ≥256 ≥256 blaTEM-1, blaCMY-2
S.I. 4,5,12:I: - CTX-CAZ-CRO-CIP-NAL (n = 6) 1 12 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
3 6 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 2 ≥256 192 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 2 ≥256 96 ≥256 blaCTX-M-15, blaTEM-1
CTX-CAZ-CRO (n = 18) 1 4 ≥256 48 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 4 ≥256 96 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
2 2 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 3 ≥256 64 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 2 ≥256 192 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 12 ≥256 32 ≥256 blaCTX-M-15, blaCMY-2
1 16 ≥256 48 ≥256 blaCTX-M-15, blaCMY-2
1 6 ≥256 32 ≥256 blaCTX-M-15, blaCMY-2
1 2 ≥256 128 ≥256 blaCTX-M-15, blaCMY-2
1 1.5 ≥256 64 ≥256 blaCTX-M-15, blaCMY-2
1 2 ≥256 64 ≥256 blaCTX-M-15, blaTEM-1
1 8 ≥256 32 ≥256 blaCTX-M-14, blaTEM-1, blaCMY-2
1 3 ≥256 64 ≥256 blaTEM-1, blaCMY-2
1 12 128 64 ≥256 blaTEM-1, blaCMY-2
1 12 ≥256 32 ≥256 blaTEM-1, blaCMY-2
1 1.5 ≥256 ≥256 ≥256 blaCMY-2
1 2 ≥256 64 ≥256 blaCMY-2
S. Rissen FOX-CTX-CAZ-CRO-CIP-NAL (n = 2) 1 192 ≥256 64 ≥256 blaCTX-M-15, blaTEM-1
1 ≥256 96 ≥256 ≥256 blaCMY-2
Open in a new tab

CAZ, ceftazidime; CTX, cefotaxime; CRO, ceftriaxone; FOX, cefoxitin, NAL, nalidixic acid and CIP, ciprofloxacin.

Table 6.

MIC values to cephalosporins and β-lactamase genes of 52 ESBL-producing Shigella isolates from clinical specimens.

Strain Antimicrobial pattern No. isolate MIC (μg/ml)
 β-lactamase and ESBL gene
FOX CTX CAZ CRO
S. sonnei phase I CTX-CAZ-CRO-CIP-NAL (n = 1) 1 6 ≥256 192 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
CTX-CAZ-CRO-NAL (n = 5) 2 2 ≥256 64 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 1.5 128 32 ≥256 blaCTX-M-15, blaTEM-1
1 3 ≥256 48 ≥256 blaCTX-M-15, blaCMY-2
1 1.5 ≥256 32 192 blaCTX-M-14, blaTEM-1
CTX-CAZ-CRO (n = 6) 2 3 ≥256 48 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 3 128 32 ≥256 blaCTX-M-15, blaTEM-1
1 2 ≥256 32 ≥256 blaTEM-1, blaCMY-2
1 2 128 32 ≥256 blaCTX-M-15, blaTEM-1
1 2 ≥256 48 ≥256 blaCTX-M-15
CTX-CRO-NAL (n = 1) 1 2 94 16 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
CTX-CRO (n = 1) 1 2 ≥256 12 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
S. sonnei phase II CTX-CAZ-CRO-CIP-NAL (n = 2) 1 6 ≥256 ≥256 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 6 ≥256 128 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
CTX-CAZ-CRO-NAL (n = 20) 5 4 ≥256 48 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 3 ≥256 48 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 6 ≥256 ≥256 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 4 ≥256 32 128 blaCTX-M-15, blaTEM-1, blaCMY-2
1 4 ≥256 ≥256 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 3 96 32 ≥256 blaCTX-M-15, blaTEM-1
1 2 ≥256 48 ≥256 blaCTX-M-15, blaTEM-1
1 2 192 32 ≥256 blaCTX-M-15, blaTEM-1
1 3 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1
1 3 ≥256 64 ≥256 blaCTX-M-15, blaCMY-2
1 3 ≥256 48 ≥256 blaTEM-1, blaCMY-2
1 4 ≥256 96 ≥256 blaTEM-1, blaCMY-2
3 3 ≥256 48 ≥256 blaCTX-M-15
1 3 ≥256 32 ≥256 blaCTX-M-14, blaTEM-1
CTX-CAZ-CRO (n = 11) 1 8 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
1 6 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1
2 3 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1
1 1.5 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1
2 3 ≥256 32 ≥256 blaCTX-M-15, blaTEM-1
1 3 ≥256 48 ≥256 blaCTX-M-15, blaCMY-2
1 3 ≥256 48 ≥256 blaCTX-M-15
1 4 ≥256 32 ≥256 blaCTX-M-14, blaTEM-1, blaCMY-2
1 3 ≥256 32 ≥256 blaCTX-M-14
CTX-CRO-NAL (n = 1) 1 3 96 24 ≥256 blaCTX-M-15, blaTEM-1
CTX-CRO (n = 2) 1 3 ≥256 24 ≥256 blaCTX-M-15, blaTEM-1
1 3 ≥256 16 ≥256 blaCTX-M-15, blaTEM-1, blaCMY-2
S. sonnei phase I,II FOX-CTX-CAZ-CRO-CIP-NAL (n = 1) 1 ≥256 ≥256 ≥256 128 blaCTX-M-15, blaCMY-2
S. flexneri type 2a CTX-CRO-NAL (n = 1) 1 6 48 1.5 ≥256 blaCTX-M-15, blaTEM-1
Open in a new tab

CAZ, ceftazidime; CTX, cefotaxime; CRO, ceftriaxone; FOX, cefoxitin, NAL, nalidixic acid and CIP, ciprofloxacin.

As shown in Table 7, different of β-lactamase gene patterns were detected in ESBL-producing ciprofloxacin-resistant Shigella and Salmonella isolates. Among the fourteen ESBL-producing cefotaxime and ciprofloxacin co-resistant isolates, 6 isolates of Salmonella serovar 4,5,12:i:- harboured blaCTX-M-15, blaTEM-1, blaCMY-2 (5 isolates) and blaCTX-M-15, blaTEM-1 (1 isolate); 2 isolate of Salmonella serovar Agona harboured the blaCTX-M-15, blaTEM-1, blaCMY-2 (1 isolate) and blaTEM-1, blaCMY-2 (1 isolate); and Shigella sonnei harboured ESBLs combined with AmpC β-lactamase genes containing blaCTX-M-15, blaTEM-1, blaCMY-2 (3 isolates) and blaCTX-M-15, blaCMY-2 (1 isolate).

Table 7.

Genotypic features of the ESBL-producing ciprofloxacin-resistant Salmonella and Shigella isolates.

ID Source Sex/Age Strain β-lactamase and ESBL gene MIC CIP
 QRDR mutation:
 PMQR gene
(μg/ml) gyrA parC
SH 968 Blood F/75 y S. Agona blaCTX-M-15, blaTEM-1, blaCMY-2 1 S83F, D87G T57S aac-(6′)-lb
SH 1902 Stool F/87 y S. Agona blaTEM-1, blaCMY-2 0.5 S83F, D87Y T57S aac-(6′)-lb
SH 713 Stool M/1 y S.I. 4,5,12:i:- blaCTX-M-15, blaTEM-1, blaCMY-2 0.064 WT WT qnrB
SH 714 Stool F/55 y S.I. 4,5,12:i:- blaCTX-M-15, blaTEM-1, blaCMY-2 0.047 WT WT qnrS, qnrB
SH 1075 Urine F/59 y S.I. 4,5,12:i:- blaCTX-M-15, blaTEM-1, blaCMY-2 0.047 WT WT aac-(6′)-lb,qnrB
SH 1123 Stool M/51 y S.I. 4,5,12:i:- blaCTX-M-15, blaTEM-1, blaCMY-2 0.75 WT WT aac-(6′)-lb
SH 1337 Rectal swab F/43 y S.I. 4,5,12:i:- blaCTX-M-15, blaTEM-1, blaCMY-2 0.047 WT WT qnrB
SH 1756 Rectal swab F/15 y S.I. 4,5,12:i:- blaCTX-M-15, blaTEM-1 1 S83F, D87G WT aac-(6′)-lb
SH 1493 Stool M/3 y S. Rissen blaCMY-2 0.38 WT WT qnrS
SH 1761 Stool F/81 y S. Rissen blaCTX-M-15, blaTEM-1 0.5 S83F T57S qnrS, qnrB
Shi 235 Rectal swab F/32 y Shi. sonnei I blaCTX-M-15, blaTEM-1, blaCMY-2 1 S83L, D87Y S80I qnrS
Shi 244 Stool M/11 y Shi. sonnei II blaCTX-M-15, blaTEM-1, blaCMY-2 0.5 S83L, D87Y WT qnrS
Shi 274 Stool M/1 y Shi. sonnei II blaCTX-M-15, blaTEM-1, blaCMY-2 0.75 S83L, D87Y WT qnrS
Shi 15 Rectal swab F/6 y Shi. sonnei I,II blaCTX-M-15, blaCMY-2 0.5 S83L, D87G WT qnrS
Open in a new tab

ESBL, extended-spectrum beta-lactamase; QRDR, quinolone-resistance determining region; PMQR, plasmid-mediated quinolone resistance; CIP, ciprofloxacin; WT, wild type; F, Phenylalanine; G, glycine; I, isoleucine; S, Serine; T, Threonine; Y, Tyrosine; M, Male; F, Female.

Ten isolates of cefotaxime and ciprofloxacin co-resistant Salmonella were ESBL producers, and we observed QRDR mutations in the gyrA (at S83F, D87G and D87Y) and parC (at T57S) genes, while point mutations in gyrA (at S83L and D87Y or D87G) and no mutation in parC were detected in three cefotaxime and ciprofloxacin co-resistant Shigella sonnei isolates. Only one Shigella sonnei phase I isolate showed a point mutation in the gyrA gene at S83L and D87Y and the parC gene at S80I. Ten cefotaxime and ciprofloxacin co-resistant Salmonella isolates showed 5 patterns of PMQR genes, including aac(6′)-lb-cr (4 isolates), qnrB and aac(6′)-lb-cr (1 isolate), qnrB and qnrS1 (2 isolates), qnrB (2 isolates), and qnrS1 (1 isolate). This finding showed that the plasmid harbouring the qnrS gene was present in all co-resistant Shigella sonnei isolated from the clinical sample.

Among the co-resistant isolates, the highest MIC level for ciprofloxacin (1 μg/ml) was observed for each isolate of Salmonella serovar Agona, Salmonella serovar 4,5,12:i:- and Shigella sonnei isolated from clinical specimens, and Salmonella harboured a mutation in gyrA (at S83F and D87G) and parC (at T57S) combined with aac(6′)-lb-cr, and Shigella sonnei harboured a mutation in gyrA (at S83L and D87Y) and parC (at S80I) combined with qnrS1.

4. Discussion

According to the WHO National Salmonella and Shigella Centre annual report, 5,401 non-typhoidal Salmonella isolates and 253 Shigella isolates from 2011 to 2018 were confirmed serotype from pure culture isolated from patients in Thailand. The overall percentage of Salmonella serovar during 2015–2018 showed that the dominant Salmonella isolates were identified as S. Enteritidis (25.8%), followed by S. Choleraesuis (16.9%), Salmonella enterica serovar 4,5,12:i:- (12.2%), S. Weltevreden (7.2%) and S. Stanley (4.8%). A high proportion of Shigella infection cases was observed in 2011 (145 isolates). However, the number of Shigella cases decreased from 72 isolates in 2012 to 21 isolates in 2013, 11 isolates in 2014, 3 isolates in 2017 and 1 isolate in 2018. Shigella sonnei (71.9%) was the most prevalent serotype found in clinical samples.

Multidrug-resistant Salmonella and Shigella may pose a risk to humans, particularly individuals resistant to fluoro (quinolone) and third-generation cephalosporins drugs. The previous research studies in Thailand have described the presence of multidrug-resistant Salmonella and Shigella from a wide range of serovars and serotypes, respectively (Whistler et al., 2018; Sirichote et al., 2010; Chompook et al., 2005). Previous data showed that Shigella sonnei was the dominant Shigella species isolated from patients in Thailand (Chompook et al., 2005; Hiranrattana et al., 2005), and Shigella sonnei phases I and II were also commonly observed serotypes (Pulsrikarn et al., 2009). In developed countries, several previous reports have shown that Shigella sonnei is more prevalent other Shigella species (Kahsay and Muthupandian, 2016; Kotloff et al., 1999). The present study showed that all Shigella sonnei isolates were resistant to ceftriaxone and cefotaxime, and that 4 isolates (7.6%) were resistant to ciprofloxacin. The above findings are in contrast with antimicrobial susceptibility studies in Thailand, which reported that Shigella sonnei strains isolated from the stool culture specimens of children were susceptible to ceftriaxone (Chompook et al., 2005; Hiranrattana et al., 2005).

The present study indicated that 33 (100%), 33 (100%) and 10 (30.3%) Salmonella isolates were resistance against ampicillin, third-generation cephalosporins (cefotaxime and ceftriaxone) and ciprofloxacin, respectively. Our results agreed with a previous study in Thailand, ESBL-producing S. Choleraesuis isolates from patients with systemic infections were 100% resistant to ampicillin and ESCs, and 14.6% were resistant to ciprofloxacin (Sriyapai et al., 2021). The most important mechanism of resistance to a broad class of beta-lactam antibiotics (ampicillin and ESCs) involves the production of beta-lactamases (particularly ESBLs), which inactivate beta-lactam antibiotics. Lee et al. (2009) found a high level of resistance to ceftriaxone and ciprofloxacin among non-typhoidal Salmonella in Southeast Asian countries. Previous studies in Thailand and Taiwan observed the highest frequencies resistance to ciprofloxacin and ceftriaxone of clinical Salmonella (Kulwichit et al., 2007; Li et al., 2005). In our study, Salmonella (10 isolates) and Shigella (4 isolates) ESBL producers isolated from humans were co-resistant to third-generation cephalosporins (including ceftriaxone, cefotaxime and ceftazidime) and ciprofloxacin. Although the findings of this study do not indicate that Salmonella and Shigella are invasive serotypes, if resistance to ESCs and fluoroquinolone is acquired, then the treatment of these infections using β-lactam and fluoroquinolones antibiotics could be severely compromised. Third-generation cephalosporins (including cefotaxime or ceftriaxone) and fluoroquinolones (ciprofloxacin) are the standard drugs for treating Salmonella and Shigella infections in humans (Williams and Berkley, 2018; Whistler et al., 2018). This antimicrobial finding highlights a serious epidemiological situation.

In the present study, β-lactamase genes encoding CTX-M were detected in 39 (73.6%) isolates of Shigella spp. and 19 (57.6%) isolates of Salmonella spp., whereas the sequencing results showed that CTX-M isolates belonging to CTX-M-15 (35 Shigella and 18 Salmonella isolates) were higher than those belonging to CTX-M-14 (4 Shigella and 1 Salmonella isolates). The present study reports the description of ESBL producers of Salmonella and Shigella isolates in Thailand, in which dominant ESBL isolates harboured blaCTX-M-15 with/without other ESBL resistance genes. This finding is similar to recently reported data from Iran (Abbasi et al., 2019; Bialvaei et al., 2017) and China (Guo and Zhao, 2021; Zhang et al., 2014) that showed the distribution of blaCTX-M genes in Salmonella and Shigella isolates.

According to various reports from around the world, CTX-M-1 is the most significant group presenting a risk to human health (Kim et al., 2016). These results showed high incidence of Salmonella and Shigella strains compete with E. coli and Klebsiella species as ESBL producers. Antimicrobial drug treatment enhances the prevalence of ESBL-producing strains by resistant strains selection (Spanu et al., 2002). Moreover, the horizontal gene transfer of antibiotic resistance genes (ARGs) of ESBL producers enhance the incidence of resistance to ESCs and other antimicrobial agents, such as aminoglycosides and fluoroquinolones (Laxminarayan et al., 2013).

In addition, ESBL-producing Salmonella and Shigella isolates were also resistant to ciprofloxacin. Two ESBL Salmonella isolates displayed QRDR mutations in the gyrA (S83F, D87G and D87Y) and parC (T57S) genes. The most commonly observed point mutations in the gyrA gene are the amino acid changes at codon serine-83 (serine to phenylalanine or tyrosine) and codon aspartic acid-87 (aspartic acid to glycine or asparagine or tyrosine), or/and mutations in parC involving changes at codon threonine-57 (threonine to serine or tyrosine), which have been found in fluoroquinolone-resistant Salmonella (Cloeckaert et al., 2001). Three ESBL-producing, co-resistant Shigella sonnei only showed mutations in gyrA (S83L, D87Y and D87G), and these QRDR mutations have been implicated as being responsible for ciprofloxacin resistance in Shigella sonnei (Folster et al., 2011). The present study is the first published report on mutations in both gyrA (S83L and D87Y) and parC (S80I) genes in a single Shigella sonnei phase I isolate from patient in Thailand.

PMQR genes were observed in ESBL-producing ciprofloxacin resistance isolates. All of the co-resistant isolates harboured at least one of the PMQR gene including the qnr genes (qnrB and/or qnrS) and/or the aac(6′)-Ib-cr gene. To our knowledge, this study is the first report of QRDR mutations and qnrS-positive plasmids in clinical Shigella sonnei isolates in Thailand, and the results also showed an improved MIC of ciprofloxacin at 0.5–1 μg/ml. Low-level quinolone resistance is mediated by PMQR determinants, and the presence of PMQR genes is of great concern because these genes can promote mutations within the QRDR (Rodríguez-Martínez et al., 2016), in which qnrS was the commonly found allele of the qnr genes in Shigella spp. (Pu et al., 2015).

In conclusion, the current study showed a high incidence of ESBL producers among Salmonella and Shigella strains isolated from clinical specimens in Thailand. ESBL-producing isolates may pose public health risks. Notably, ESBL-producing Salmonella and Shigella isolated from clinical specimens were resistant to ESCs and fluoroquinolone. The present study provides the first description diversity of blaCTX-M-15 plus other ESBL genes, as well as to identify QRDR mutations and PMQR genes in ESBL-producing Salmonella and Shigella. The marked diversity of antimicrobial resistance patterns and resistant gene patterns among the ESBL-producing isolates are associated with high MIC values.

Declarations

Author contribution statement

Thayat Sriyapai: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.

Chaiwat Pulsrikarn, Kosum Chansiri: Contributed reagents, materials, analysis tools or data.

Pichapak Sriyapai: Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.

Funding statement

This study was supported by the research fund 2016 of Srinakharinwirot University [Grant no. 082/2560].

Data availability statement

Data included in article/supp. material/referenced in article.

Declaration of interest’s statement

The authors declare no conflict of interest.

Additional information

No additional information is available for this paper.

References

  1. Abbasi E., Abtahi H., van Belkum A., Ghaznavi-Rad E. Multidrug-resistant Shigella infection in pediatric patients with diarrhea from central Iran. Infect. Drug Resist. 2019;12:1535–1544. doi: 10.2147/IDR.S203654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Archambault M., Petrov P., Hendriksen R.S., Asseva G., Bangtrakulnonth A., Hasman H., Aarestrup F.M. Molecular characterization and occurrence of extended-spectrum beta-lactamase resistance genes among Salmonella enterica serovar Corvallis from Thailand, Bulgaria, and Denmark. Microb. Drug Resist. 2006;12:192–198. doi: 10.1089/mdr.2006.12.192. [DOI] [PubMed] [Google Scholar]
  3. Bialvaei A.Z., Pourlak T., Aghamali M., Asgharzadeh M., Gholizadeh P., Kafil H.S. The Prevalence of CTX-M-15 extended-spectrum β-Lactamases among Salmonella spp. and Shigella spp. isolated from three Iranian Hospitals. Eur. J. Microbiol. Immunol (Bp). 2017;26(2):133–137. doi: 10.1556/1886.2017.00004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cattoir V., Weill F.X., Poirel L., Fabre L., Soussy C.J., Nordmann P. Prevalence of qnr genes in Salmonella in France. J. Antimicrob. Chemother. 2007;59:751–754. doi: 10.1093/jac/dkl547. [DOI] [PubMed] [Google Scholar]
  5. Chompook P., Samosornsuk S., von Seidlein L., Jitsanguansuk S., Sirima N., Sudjai S., Mangjit P., Kim D.R., Wheeler J.G., Todd J., Lee H., Ali M., Clemens J., Tapchaisri P., Chaicumpa W. Estimating the burden of shigellosis in Thailand: 36-month population-based surveillance study. Bull. World Health Organ. 2005;83:739–746. [PMC free article] [PubMed] [Google Scholar]
  6. Chung T.H., Rabaa M.A., Thanh D.P., Ruekit S., Wangchuk S., Dorji T., Tshering K.P., Nguyen T.N.T., Vinh P.V., Thanh T.H., Minh C.N.N., Turner P., Sar P., Thwaites G., Holt K.E., Thomson N.R., Bodhidatta L., Mason C.J., Baker S. Introduction and establishment of fluoroquinolone-resistant Shigella sonnei into Bhutan. Microb. Genom. 2015;1 doi: 10.1099/mgen.0.000042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Clinical and Laboratory Standards Institute . twelfth ed. Clinical and Laboratory Standards Institute; Wayne, PA: 2018. Performance standards for antimicrobial disk susceptibility tests; approved standard. M02-A13. [Google Scholar]
  8. Cloeckaert A., Chaslus-Dancla E. Mechanisms of quinolone resistance in Salmonella. Vet. Res. 2001;32:291–300. doi: 10.1051/vetres:2001105. [DOI] [PubMed] [Google Scholar]
  9. Doumith M., Dhanji H., Ellington M.J., Hawkey P., Woodford N. Characterization of plasmids encoding extended-spectrum β-lactamases and their addiction systems circulating among Escherichia coli clinical isolates in the UK. J. Antimicrob. Chemother. 2012;67(4):878–885. doi: 10.1093/jac/dkr553. [DOI] [PubMed] [Google Scholar]
  10. Edwards P.R., Ewing W.H. fourth ed. Elsevier; New York: 1986. Edwards and Ewing’s Identification of Enterobacteriaceae. [Google Scholar]
  11. Ewing W.H., Lindberg A.A. Serology of Shigella. Methods Microbiol. 1984;14:113–142. [Google Scholar]
  12. Folster J.P., Pecic G., Bowen A., Rickert R., Carattoli A., Whichard J.M. Decreased susceptibility to ciprofloxacin among Shigella isolates in the United States, 2006 to 2009. Antimicrob. Agents Chemother. 2011;55:1758–1760. doi: 10.1128/AAC.01463-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Giraud E., Baucheron S., Cloeckaert A. Resistance to fluoroquinolones in Salmonella: emerging mechanisms and resistance prevention strategies. Microb. Infect. 2006;8:1937–1944. doi: 10.1016/j.micinf.2005.12.025. [DOI] [PubMed] [Google Scholar]
  14. Guo L., Zhao Y. Global spread and molecular characterization of CTX-M-producing Salmonella Typhimurium isolates. Antibiotics (Basel) 2021;10(11):1417. doi: 10.3390/antibiotics10111417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hasman H., Mevius D., Veldman K., Olesen I., Aarestrup F.M. Beta-lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005;56:115–121. doi: 10.1093/jac/dki190. [DOI] [PubMed] [Google Scholar]
  16. Hiranrattana A., Mekmullica J., Chatsuwan T., Pancharoen C., Thisyakorn U. Childhood shigellosis at king Chulalongkorn memorial hospital, Bangkok, Thailand: a 5-year review (1996-2000) Southeast Asian J. Trop. Med. Publ. Health. 2005;36:683–685. [PubMed] [Google Scholar]
  17. Hu L.F., Li J.B., Ye Y., Li X. Mutations in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in clinical strains of fluoroquinolone-resistant Shigella in Anhui, China. J. Microbiol. 2007;45:168–170. [PubMed] [Google Scholar]
  18. Jacoby G.A., Strahilevitz J., Hooper D.C. Plasmid-mediated quinolone resistance. Microbiol. Spectr. 2014;2:475–503. doi: 10.1128/microbiolspec.PLAS-0006-2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ji W.J., Xu X.W., Dong F. Genotype and drug resistance analysis of extended-spectrum beta-lactamases-producing Shigella in pediatric patients. Chin. J. Microbiol. Immunol. 2010;30:472–476. (in Chinese) [PubMed] [Google Scholar]
  20. Kahsay A.G., Muthupandian S. A review on sero diversity and antimicrobial resistance patterns of Shigella species in Africa, Asia and South America, 2001–2014. BMC Res. Notes. 2016;9(1):422. doi: 10.1186/s13104-016-2236-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kim J.S., Yun Y.S., Kim S.J., Jeon S.E., Lee D.Y., Chung G.T., Yoo C.K., Kim J., PulseNet Korea Working Group. Rapid emergence and clonal dissemination of CTX-M-15–producing Salmonella enterica serotype Virchow, South Korea. Emerg. Infect. Dis. 2016;22:68–70. doi: 10.3201/eid2201.151220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kojima A., Ishii Y., Ishihara K., Esaki H., Asai T., Oda C., Tamura Y., Takahashi T., Yamaguchi K. Extended-spectrum-beta-lactamase-producing Escherichia coli strains isolated from farm animals from 1999 to 2002: report from the Japanese veterinary antimicrobial resistance monitoring program. Antimicrob. Agents Chemother. 2005;49:3533–3537. doi: 10.1128/AAC.49.8.3533-3537.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kotloff K.L., Winickoff J.P., Ivanoff B., Clemens J.D., Swerdlow D.L., Sansonetti P.J., Adak G.K., Levine M.M. Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull. World Health Organ. 1999;77:651–666. [PMC free article] [PubMed] [Google Scholar]
  24. Kiratisin P., Apisarnthanarak A., Laesripa C., Saifon P. Molecular characterization and epidemiology of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob. Agents Chemother. 2008;52:2818–2824. doi: 10.1128/AAC.00171-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kulwichit W., Chatsuwan T., Unhasuta C., Pulsrikarn C., Bangtrakulnonth A., Chongthaleong A. Drug-resistant nontyphoidal Salmonella bacteremia, Thailand. Emerg. Infect. Dis. 2007;13:501–502. doi: 10.3201/eid1303.061059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Laxminarayan R., Duse A., Wattal C., Zaidi A.K.M., Wertheim H.F.L., Sumpradit N., Vlieghe E., Hara G.L., Gould I.M., Goossens H., Greko C., So A.D., Bigdeli M., Tomson G., Woodhouse W., Ombaka E., Peralta A.Q., Qamar F.N., Mir F., Kariuki S., Bhutta Z.A., Coates A., Bergstrom R., Wright G.D., Brown E.D., Cars O. Antibiotic resistance: the need for global solutions. Lancet Infect. Dis. 2013;13:1057–1098. doi: 10.1016/S1473-3099(13)70318-9. [DOI] [PubMed] [Google Scholar]
  27. Le Q.P., Ueda S., Nguyen T.N.H., Dao T.V.K., Hoang T.A.V., Tran T.T.N., Hirai I., Nakayama T., Kawahara R., Do T.H., Vien Q.M., Yamamoyo Y. Characteristics of extended-spectrum β-lactamase-producing Escherichia coli in retail meats and shrimp at a local market in Vietnam. Foodb. Pathog. Dis. 2015;12:719–725. doi: 10.1089/fpd.2015.1954. [DOI] [PubMed] [Google Scholar]
  28. Lee H.Y., Su L.H., Tsai M.H., Kim S.W., Chang H.H., Jung S.I., Park K.H., Perera J., Carlos C., Tan B.H., Kumarasinghe G., So T., Chongthaleong A., Hsueh P.R., Liu J.W., Song J.H., Chiu C.H. High rate of reduced susceptibility to ciprofloxacin and ceftriaxone among nontyphoid Salmonella clinical isolates in Asia. Antimicrob. Agents Chemother. 2009;53:2696–2699. doi: 10.1128/AAC.01297-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li W.C., Huang F.Y., Liu C.P., Weng L.C., Wang N.Y., Chiu N.C., Chiang C.S. Ceftriaxone resistance of nontyphoidal Salmonella enterica isolates in Northern Taiwan attributable to production of CTX-M-14 and CMY-2 beta-lactamases. J. Clin. Microbiol. 2005;43:3237–3243. doi: 10.1128/JCM.43.7.3237-3243.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Majowicz S.E., Musto J., Scallan E., Angulo F.J., Kirk M., O'Brien S.J., Jones T.F., Fazil A., Hoekstra R.M. The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 2010;50:882–889. doi: 10.1086/650733. [DOI] [PubMed] [Google Scholar]
  31. Niyogi S.K. Shigellosis. J. Microbiol. 2005;43:133–143. [PubMed] [Google Scholar]
  32. Olesen I., Hasman H., Aarestrup F.M. Prevalence of β-lactamases among ampicillin resistant Escherichia coli and Salmonella isolated from food animals in Denmark. Microb. Drug Res. 2004;10:334–340. doi: 10.1089/mdr.2004.10.334. [DOI] [PubMed] [Google Scholar]
  33. Park C.H., Robicsek A., Jacoby G.A., Sahm D., Hooper D.C. Prevalence in the United States of aac(6´)Ib-cr enconding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother. 2006;50:3953–3955. doi: 10.1128/AAC.00915-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Popoff M.Y. WHO Collaborating Centre for Reference and Research on Salmonella. Institute Pasteur; Paris: 2001. Antigenic formulas of the Salmonella serovars 8th revision. [Google Scholar]
  35. Pu X.Y., Pan J.C., Wang H.Q., Zhang W., Huang Z.C., Gu Y.M. Characterization of fluoroquinolone-resistant Shigella flexneri in Hangzhou area of China. J. Antimicrob. Chemother. 2009;63:917–920. doi: 10.1093/jac/dkp087. [DOI] [PubMed] [Google Scholar]
  36. Pu X.Y., Pan J.C., Zhang W., Zheng W., Wang H.Q., Gu Y.M. Quinolone resistance determining region mutations and the plasmid-mediated quinolone resistance gene qnrS played important roles in decreased susceptibility to fluoroquinolones among Shigella isolates in southeast China between 1998 and 2013. Int. J. Antimicrob. Agents. 2015;45:438–439. doi: 10.1016/j.ijantimicag.2014.12.004. [DOI] [PubMed] [Google Scholar]
  37. Pulsrikarn C., Bangtrakulnonth A., Pornruangwong S., Sriyapai T., Sawanpanyalert P., Aswapokee N., Techasathit W. Shigella species and serotypes among clinical isolates in Thailand from 2001 to 2005. J. Med. Assoc. Thai. 2009;92:S76–S81. [PubMed] [Google Scholar]
  38. Pulsrikarn C., Sriyapai P., Chaichana P., Nyamniyom A., Sriyapai T. Antimicrobial resistance and molecular characterization of Salmonella enterica serovar Kedougou isolates from clinical specimens and environmental samples in Thailand, 2006-2009. Southeast Asian J. Trop. Med. Publ. Health. 2017;48:1006–1016. [Google Scholar]
  39. Robicsek A., Strahilevitz J., Sahm D.F., Jacoby G.A., Hooper D.C. Qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 2006;50:2872–2874. doi: 10.1128/AAC.01647-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Robicsek A., Jacoby G.A., Hooper D.C. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect. Dis. 2006;6:629–640. doi: 10.1016/S1473-3099(06)70599-0. [DOI] [PubMed] [Google Scholar]
  41. Robicsek A., Strahilevitz J., Jacoby G.A., Macielag M., Abbanat D., Park C.H., Bush K., Hooper D.C. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 2006;12(1):583–588. doi: 10.1038/nm1347. [DOI] [PubMed] [Google Scholar]
  42. Rodríguez-Martínez J.M., Cano M.E., Velasco C., Martínez-Martínez L., Pascual A. Plasmid-mediated quinolone resistance: an update. J. Infect. Chemother. 2011;17:149–182. doi: 10.1007/s10156-010-0120-2. [DOI] [PubMed] [Google Scholar]
  43. Rodríguez-Martínez J.M., Machuca J., Cano M.E., Calvo J., Martínez-Martínez L., Pascual A. Plasmid-mediated quinolone resistance: two decades on. Drug Resist. Updates. 2016;29:13–29. doi: 10.1016/j.drup.2016.09.001. [DOI] [PubMed] [Google Scholar]
  44. Sirichote P., Bangtrakulnonth A., Tianmanee K., Unahalekhaka A., Oulai A., Chittaphithakchai P., Kheowrod W., Hendriksen R.S. Serotypes and antimicrobial resistance of Salmonella enterica ssp. in central Thailand, 2001-2006. Southeast. Asian. J. Trop. Med. Public Health. 2010;41:1405–1415. [PubMed] [Google Scholar]
  45. Spanu T., Luzzaro F., Perilli M., Amicosante G., Toniolo A., Fadda G., Italian ESBL Study Group Occurrence of extended-spectrum beta-lactamases in members of the family Enterobacteriaceae in Italy: implications for resistance to beta-lactams and other antimicrobial drugs. Antimicrob. Agents Chemother. 2002;46:196–202. doi: 10.1128/AAC.46.1.196-202.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sriyapai P., Pulsrikarn C., Chansiri K., Nyamniyom A., Sriyapai T. Molecular characterization of cephalosporin and fluoroquinolone resistant Salmonella Choleraesuis isolated from patients with systemic salmonellosis in Thailand. Antibiotics. 2021;10(7):844. doi: 10.3390/antibiotics10070844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Whistler, T., Sapchookul, P., McCormick, D. W., Sangwichian, O., Jorakate, P., Makprasert, S., Jatapai, A., Naorat, S., Surin, U., Koosakunwat, S., Supcharassaeng, S., Piralam, B., Mikoleit, M., Baggett, H.C., Rhodes, J., 2 0 1 8. Epidemiology and antimicrobial resistance of invasive non-typhoidal Salmonellosis in rural Thailand from 2006-2014. PLoS Neglected Trop. Dis. 12(8), e0006718. [DOI] [PMC free article] [PubMed]
  48. Williams P.C.M., Berkley J.A. Guidelines for the treatment of dysentery (shigellosis): a systematic review of the evidence. Paediatr. Int. Child Health. 2018;38:S50–S65. doi: 10.1080/20469047.2017.1409454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wiuff C., Madsen M., Baggesen D.L., Aarestrup F.M. Quinolone resistance among Salmonella enterica from cattle, broilers, and swine in Denmark. Microb. Drug Resist. 2000;6:11–17. doi: 10.1089/mdr.2000.6.11. [DOI] [PubMed] [Google Scholar]
  50. Woodford N., Carattoli A., Karisik E., Underwood A., Ellington M.J., Livermore D.M. Complete nucleotide sequences of plasmids pEK204, pEK499, and pEK516, encoding CTX-M enzymes in three major Escherichia coli lineages from the United Kingdom, all belonging to the international O25: H4-ST131 clone. Antimicrob. Agents Chemother. 2009;53:4472–4482. doi: 10.1128/AAC.00688-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yah C.S. Plasmid-encoded multidrug resistance: a case study of Salmonella and Shigella from enteric diarrhea sources among humans. Biol. Res. 2010;43:141–148. [PubMed] [Google Scholar]
  52. Zhang C.L., Liu Q.Z., Wang J., Chu X., Shen L.M., Guo Y.Y. Epidemic and virulence characteristic of Shigella spp. with extended-spectrum cephalosporin resistance in Xiaoshan District, Hangzhou, China. BMC Infect. Dis. 2014;14:260. doi: 10.1186/1471-2334-14-260. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data included in article/supp. material/referenced in article.

Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES