Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2022 Nov 28;101:skac391. doi: 10.1093/jas/skac391

Effects of bamboo leaf extract on energy metabolism, antioxidant capacity, and biogenesis of small intestine mitochondria in broilers

Zechen Xie 1, Ge Yu 2, Yang Yun 3, Xin Zhang 4, Mingming Shen 5, Minghui Jia 6, Anqi Li 7, Hao Zhang 8, Tian Wang 9, Jingfei Zhang 10, Lili Zhang 11,✉
PMCID: PMC9833010  PMID: 36440554

Abstract

The present study was carried out to investigate the effects of bamboo leaf extract (BLE) on energy metabolism, antioxidant capacity, and biogenesis of broilers’ small intestine mitochondria. A total of 384 one-day-old male Arbor Acres broiler chicks were randomly divided into four groups with six replicates each for 42 d. The control group was fed a basal diet, whereas the BLE1, BLE2, and BLE3 groups consumed basal diets with 1.0, 2.0, and 4.0 g/kg of BLE, respectively. Some markers of mitochondrial energy metabolism including isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, and malate dehydrogenase and some markers of redox system including total superoxide dismutase, malondialdehyde, and glutathione were measured by commercial colorimetric kits. Mitochondrial and cellular antioxidant genes, mitochondrial biogenesis-related genes, and mitochondrial DNA copy number were measured by quantitative real-time-polymerase chain reaction (qRT-PCR). Data were analyzed using the SPSS 19.0, and differences were considered as significant at P < 0.05. BLE supplementation linearly increased jejunal mitochondrial isocitrate dehydrogenase (P < 0.05) and total superoxide dismutase (P < 0.05) activity. The ileal manganese superoxide dismutase mRNA expression was linearly affected by increased dietary BLE supplementation (P < 0.05). Increasing BLE supplementation linearly increased jejunal sirtuin 1 (P < 0.05) and nuclear respiratory factor 1 (P < 0.05) mRNA expression. Linear (P < 0.05) and quadratic (P < 0.05) responses of the ileal nuclear respiratory factor 2 mRNA expression occurred with increased dietary BLE levels. In conclusion, BLE supplementation was beneficial to the energy metabolism, antioxidant capacity, and biogenesis of small intestine mitochondria in broilers. The dose of 4.0 g/kg BLE demonstrated the best effects.

Keywords: antioxidant genes, Arbor Acres broiler, biogenesis-related genes, isocitrate dehydrogenase, total superoxide dismutase

Bamboo leaf extract supplementation can improve the energy metabolism, antioxidant capacity, and biogenesis of small intestine mitochondria in broilers.

Introduction

In the past few years, the poultry industry has developed rapidly, and poultry meat has been widely consumed (Mishra and Jha, 2019). An intensive rearing system has been chosen by producers due to the demand for broilers meat over the past few years, but this system directly exposes broilers to multiple stress factors, including oxidative stress (Yu et al., 2021). Small intestinal mucosal injury, which damages poultry health, is associated with oxidative stress and subsequent mitochondrial dysfunction (Jiang et al., 2019; Zhang et al., 2021). The mitochondria possess crucial functions such as energy metabolism, antioxidant capacity, and biogenesis (Brand and Nicholls, 2011; Delbarba et al., 2016). Reactive oxygen species (ROS) are primarily derived from mitochondria (Ojano-Dirain et al., 2007), and excessive ROS lead to mitochondrial dysfunction (Zhang et al., 2021). Dietary supplementation with phytogenic feed additives is an effective approach to reducing mitochondrial dysfunction in poultry and livestock (Jia et al., 2020; Zhang et al., 2020, 2021). It is necessary to improve small intestine mitochondrial energy metabolism, antioxidant capacity, and biogenesis through nutritional factors because this will benefit broilers’ health.

Bamboo (Bambusoideae) is widely distributed as abundant natural resource in China, and bamboo leaves have been used in folk medicine and as a food additive for a long time (Koide et al., 2011; Li et al., 2021). Bamboo leaves include various active components, such as flavonoids, polyphenols, and polysaccharides (Hu et al., 2000). Bamboo leaf extract (BLE) exhibited antioxidant capacity related to its free-radical-scavenging characteristics in vitro experiments (Hu et al., 2000; Mao et al., 2013). Our previous studies have revealed that BLE supplementation could improve antioxidant capacity and cholesterol metabolism in broilers (Shen et al., 2019a, 2019b). Aside from its antioxidant capacity, BLE has other biological effects, such as anti-inflammatory (Koide et al., 2011) and antibacterial benefits (Tanaka et al., 2014). Some researches have proven that BLE has other positive effects as well. For example, BLE ameliorated diabetic nephropathy in rats (Ying et al., 2017). Liu et al. (2015) found that BLE can be used to treat spatial memory impairment in rats with senile dementia.

Few researches have been conducted to explore the effects of BLE supplementation on small intestine mitochondrial functions in broilers. The objective of this study was to investigate BLE’s effects on energy metabolism, antioxidant capacity, and biogenesis of small intestine mitochondria in broilers. Our hypothesis was that BLE, as a phytogenic feed additive, was beneficial to the energy metabolism, antioxidant capacity, and biogenesis of small intestine mitochondria in broilers.

Materials and Methods

Ethics statement

All experimental procedures were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University (GB14925-2010, NJAU-CAST-2011-093).

Experimental design, birds, and management

Zhejiang XinHuang Biotechnology Co., Ltd. (Zhejiang, China) provided the BLE, and each gram of BLE contained 70.00 mg of flavonoids and 50.42 mg of polyphenols. We purchased a total of 384 one-day-old male Arbor Acres broiler chicks from a local commercial hatchery (Hewei Company, Anhui Province, China) and randomly divided them into four groups with six replicates containing 16 birds each. These broilers belong to a previous study (Shen et al., 2019b). Chickens were fed basal diets for 42 d in two phases (1–21 days and 22–42 days; Table 1) according to NRC (1994) recommendations for nutrition requirements. The control (CTR) group was fed with a basal diet, and the three experimental groups of BLE1, BLE2, and BLE3 were fed the basal diet supplemented with 1.0, 2.0, and 4.0 g of BLE per kg of feed for 42 d, respectively. During the experimental period, the chicks had free access to feed and water. All the birds were kept in three-layer-wired cages (120 cm × 60 cm × 50 cm), and each replicate divided into two cages. We kept the temperature between 32 °C and 35 °C for the first 5 d before decreasing it to 22 °C and holding it steady during the experiment.

Table 1.

Composition and nutrient level of basal diets

Item Starter phase (1–21 d) Grower phase (22–42 d)
Ingredient (%)
Corn 57.02 61.36
Soybean 31.3 28.3
Corn gluten meal 3.7 1.7
Soya oil 3 4
Dicalcium phosphate 2 1.6
Limestone 1.2 1.3
L-Lysine 0.33 0.31
DL-Methionine 0.15 0.13
Sodium chloride 0.3 0.3
Premix1 1 1
Nutrient levels2
ME (MJ/kg) 12.57 12.91
CP (%) 21.42 19.23
Lys (%) 1.20 1.10
Met (%) 0.50 0.44
Calcium (%) 1 0.93
Available phosphorus (%) 0.46 0.39
Open in a new tab

1Premix provided per kilogram of diet: VA 10,000 IU, VD3 3,000 IU, VE 30 IU, VK3 1.3 mg, thiamine 2.2 mg, riboflavin 8 mg, niacin 40 mg, choline chloride 600 mg, calcium pantothenate 10 mg, pyridoxine 4 mg, biotin 0.04 mg, folic acid 1 mg, VB12 0.013 mg, zinc 65 mg, iron 80 mg, copper 8 mg, manganese 110 mg, iodine 1.1 mg, selenium 0.3 mg.

2Calculated value.

Sample collection

On day 42, two birds (a total of 12 birds per treatment) whose body weight was closer to the mean body weight of each replicate were selected and slaughtered by exsanguination after feed deprivation for 12 h. Their jejunum and ileum samples were opened longitudinally and flushed the rest of digesta with ice-cold phosphate buffer treatment to collect mucosa. The jejunal and ileal mucosa were collected by direct scraping using a sterile glass microscope slide at 4 °C, which was then immediately frozen in liquid nitrogen, and stored at −80 °C for further measurement (Cheng et al., 2020).

Preparation of jejunal and ileal mucosa mitochondria

Jejunal and ileal mucosa mitochondria were extracted by using commercial kits (kit number: ICDHM-1-Y; KGDH-1-Y; MDHm-1-Y; Suzhou Comin Biotechnology Co., Ltd., Suzhou, China). Briefly, about 0.1 g intestinal mucosa samples were cut off and added with ice-cold isolation buffer, then homogenized on ice using glass homogenizers. Afterward, the above homogenate was centrifuged at 600 × g for 5 min at 4 °C. The supernatant was collected and centrifuged at 11,000 × g for 10 min at 4 °C. Thereafter, the obtained pellet was added with ice-cold isolation buffer and disrupted by sonication (ice bath, power 20%, sonication for 3 s, 10 s interval, repeat 30 times) using a sonicator (Sonics & Materials, Inc., Newtown, CT). All the processes were in accordance with the guidelines of manufacturer’s instructions. Mitochondrial suspension was stored at −80 °C for the subsequent analysis.

Measurement of mitochondrial tricarboxylic acid cycle enzyme activity

The jejunal and ileal mitochondria were isolated and measured for isocitrate dehydrogenase (ICDH) activity, ­α-ketoglutarate dehydrogenase (α-KGDH) activity, and malate dehydrogenase (MDH) activity using commercial kits (ICDH, ICDHM-1-Y; α-KGDH, KGDH-1-Y; MDH, MDHm-1-Y; Suzhou Comin Biotechnology Co., Ltd., Suzhou, China) according to the manufacturer’s instructions.

Measurement of mitochondrial antioxidant enzyme activity and metabolite content

The extracted mitochondria were used to measure the total superoxide dismutase (T-SOD, kit number: A001-2-2) activity as well as the malondialdehyde (MDA, kit number: A003-1-1) and glutathione (GSH, kit number: A006-2-1) concentrations were quantified using commercial kits purchased from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China), according to the manufacturer’s instructions.

qRT-PCR and mitochondrial DNA copy number analysis

RNA isolater (Vazyme, Nanjing, China) was used to extract total RNA from the jejunum and ileum. At 260 nm (A260) and 280 nm (A280), and Nanodrop-ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA) was used to measure the RNA concentration. According to the manufacturer’s instructions, a reverse transcription of the total RNA was completed by the HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China). The quantitative real-time-polymerase chain reaction (qRT-PCR) was completed by using the ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China) in a fluorescence quantitative PCR instrument (Applied Biosystems, Foster City, CA). The 10-µl reaction system included 5 µl of 2 × ChamQ SYBR qPCR Master Mix, 0.2 µl each of forward and reverse primers and dye, 1 µl of complementary DNA template, and 3.4 µl of DEPC water. The PCR reaction procedure was as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The primer sequences used in this experiment are shown in Table 2. β-actin was used as an internal reference gene to calculate relative mRNA expression. We used the 2−ΔΔCt method (Livak and Schmittgen, 2001) to calculate the relative expression of the target gene mRNA.

Table 2.

Primer sequences used for real-time PCR

Gene name1 Primers sequence2 (5ʹ–3ʹ) Gene bank number Product size
β-actin F: AATGGCTCCGGTATGTGCAA NM_205518.2 112
R: GGCCCATACCAACCATCACA
Nrf2 F: TGTGTACTCATCGCGGTTCC NM_001396902.1 132
R: AATGGAGCTTTAGGGTGGCC
Mn-SOD F: GTTACAGCTCAGGTGTCGCT NM_204211.2 115
R: CTCCTTTAGGCTCCCCTCCT
PRKAA1 F: CTGTCTCGCCCTCATCC NM_001039603.2 141
R: CCGTATCCCCAAATGCCACT
SIRT1 F: CCTTGCTGTAGACTTCC NM_001004767.2 143
R: TGTGGCAGAGAGATGGC
SIRT3 F: TGGCAGAGCTCATTCGGAAG NM_001199493.2 117
R: TACTATAGAGGCCGCTCCCC
PGC-1α F: GACGTATCGCCTTCTTGCTC AB170013.1 157
R: CTCGATCGGGAATATGGAGA
NRF1 F: GTGTCCCTCATCCAGGTTGG NM_001030646.2 115
R: CTCCATCAGCCACTGCAGAA
NRF2 F: GAGCCCATGGCCTTTCCTAT NM_001007858.1 212
R: CACAGAGGCCCTGACTCAAA
TFAM F: CGCCTATTTCCGCTTCCTGA NM_204100.2 135
R: TCGTAAACCTGCTTCTGCGA
FOXO1 F: TGCCCCTGTTAACAGTTGCA NM_204328.2 117
R: TCCATGTCACAGTCCAACCG
mTOR F: GTGGCGATCCTATGGCATGA XM_040689168.1 128
R: CCACGCTCCATCATTGCATG
GCG F: GTGGAGGGCTGATAAAACACAAT DQ185929.1 205
R: TCCAACTCCTTGACCTCTATCC
D-loop F: ACCCCTGCCTGTAATGTACTTC X52392.1 183
R: CACGGACTAAAGAGGGGAAGAT
Open in a new tab

1 β-actin, beta-actin; Nrf2, nuclear factor erythroid 2-related factor 2; Mn-SOD, manganese superoxide dismutase; PRKAA1, protein kinase AMP-activated catalytic subunit alpha 1; SIRT1, sirtuin 1; SIRT3, sirtuin 3; PGC-1α, PPARG coactivator 1 alpha; NRF1, nuclear respiratory factor 1; NRF2, nuclear respiratory factor 2; TFAM, mitochondrial transcription factor A; FOXO1, forkhead box O1; mTOR, mechanistic target of rapamycin; GCG, preproglucagon gene; D-loop, displacement loop region.

2F: forward primer; R: reverse primer.

The mitochondrial DNA (mtDNA) copy number was measured by using the preproglucagon gene as the internal ­reference gene and the mitochondrial displacement loop region as the mitochondrial target gene. The primer sequences are listed in Table 2. Total DNA was extracted from the jejunal and ileal mucosal samples with a MiniBEST Universal Genomic DNA Extraction Kit (TaKaRa, Beijing, China). The amplification conditions for the real-time PCR were as described above. We used the 2−ΔΔCt method (Zhang et al., 2021) to calculate the relative mtDNA copy number.

Statistical analysis

The data was preliminarily sorted by Excel 2016 (Microsoft, Redmond, WA). The one-way analysis of variance (ANOVA) feature of the Statistical Product and Service Solutions software (SPSS, ver.19.0 for Windows, SPSS, Inc., Chicago, IL, USA) was used for significant comparison when the variance was homogeneous, and Duncan’s multiple range test was used to determine different treatments. When the variance was not homogeneous, we used the Welch test for significance comparison and the Games–Howell multiple range test for determining different treatments. An orthogonal polynomial contrast test for linear and quadratic effects was used to assess BLE supplementation’s effects at various doses. Differences were considered as statistically significant at P < 0.05.

Results

Mitochondrial tricarboxylic acid cycle enzyme activity

As shown in Table 3 and Supplementary Table 1, the BLE3 group’s jejunal ICDH activity was significantly higher than that of the other groups (P < 0.05). Additionally, the BLE dose and the jejunal ICDH activity had a linear relationship. With increased BLE supplementation, the jejunal and ileal α-KGDH and MDH activity demonstrated no differences among the groups (P > 0.05). Moreover, there was a quadratic effect between the MDH activity of the ileal mitochondria and the BLE dose.

Table 3.

Effect of dietary BLE on the activities of the mitochondrial TCA cycle enzyme of jejunum and ileum in broilers

Item Diet treatment3 P-value
CTR BLE1 BLE2 BLE3 SEM1 Linear2 Quadratic2
Jejunal mitochondria
ICDH (nmol/min/mg prot) 2.43b 4.01b 4.59b 7.78a 0.556 <0.001 0.760
α-KGDH (nmol/min/mg prot) 2.88 6.19 2.17 5.08 1.049 0.805 0.886
MDH (nmol/min/mg prot) 60.86 115.21 74.88 116.14 22.507 0.466 0.904
Ileal mitochondria
ICDH (nmol/min/mg prot) 5.82 5.47 6.93 5.80 0.447 0.894 0.522
α-KGDH (nmol/min/mg prot) 2.02 2.30 2.45 3.89 0.400 0.096 0.629
MDH (nmol/min/mg prot) 324.85 273.95 264.40 378.71 18.540 0.169 0.035
Open in a new tab

1Standard error of the means (n = 6).

2Orthogonal polynomials were used to evaluate linear and quadratic responses to the levels of BLE treatment.

3CTR: basal diet; BLE1, BLE2, and BLE3 group, basal diet adding 1.0, 2.0, and 4.0 g/kg BLE, respectively.

a–bMeans within the same row with no common superscript differ significantly (P < 0.05).

ICDH, isocitrate dehydrogenase; α-KGDH, α-ketoglutarate dehydrogenase; MDH, malate dehydrogenase.

Mitochondrial redox system

Compared with the CTR group, the jejunal T-SOD activity in the BLE1 and BLE3 groups was significantly higher (P < 0.05; Table 4 and Supplementary Table 2), and a linear increase was observed as the BLE dose increased. The ileal T-SOD activity was not affected by BLE supplementation (P > 0.05), and the jejunal and ileal MDA and GSH concentrations also were unaffected by BLE supplementation (P > 0.05).

Table 4.

Effect of dietary BLE on the mitochondrial redox system of jejunum and ileum in broilers

Item Diet treatment3 P-value
CTR BLE1 BLE2 BLE3 SEM1 Linear2 Quadratic2
Jejunal mitochondria
T-SOD (U/mg prot) 105.27b 142.33a 125.34ab 145.76a 5.836 0.036 0.413
MDA (nmol/mg prot) 0.95 1.07 0.55 0.90 0.125 0.715 0.693
GSH (μmol/g prot) 12.38 14.53 15.30 14.26 0.719 0.447 0.228
Ileal mitochondria
T-SOD (U/mg prot) 105.80 115.65 118.98 122.59 4.380 0.219 0.591
MDA (nmol/mg prot) 1.24 0.85 0.83 0.74 0.106 0.149 0.387
GSH (μmol/g prot) 20.83 23.05 20.37 16.80 1.390 0.206 0.476
Open in a new tab

1Standard error of the means (n = 6).

2Orthogonal polynomials were used to evaluate linear and quadratic responses to the levels of BLE treatment.

3CTR: basal diet; BLE1, BLE2, and BLE3 group, basal diet adding 1.0, 2.0, and 4.0 g/kg BLE, respectively.

a–bMeans within the same row with no common superscript differ significantly (P < 0.05).

T-SOD, total superoxide dismutase; MDA, malondialdehyde; GSH, glutathione.

The mRNA expression of mitochondrial and cellular antioxidant genes

The ileal manganese superoxide dismutase (Mn-SOD) mRNA expression increased with BLE supplementation (Table 5 and Supplementary Table 3). Moreover, the BLE3 group showed the greatest ileal Mn-SOD mRNA expression among the groups (P < 0.05), and it demonstrated a linear relationship between BLE dose and Mn-SOD mRNA expression. The jejunal nuclear factor erythroid 2-related factor 2, and Mn-SOD mRNA expression as well as the ileal nuclear factor erythroid 2-related factor 2 mRNA expression demonstrated no significant differences among the groups (P > 0.05).

Table 5.

Effect of dietary BLE on the expression of mitochondrial and cellular antioxidant genes of jejunum and ileum in broilers

Item Diet treatment3 P-value
CTR BLE1 BLE2 BLE3 SEM1 Linear2 Quadratic2
Jejunum
Nrf2 1.00 0.85 0.89 1.24 0.067 0.118 0.108
Mn-SOD 1.00 0.91 0.82 1.33 0.079 0.094 0.073
Ileum
Nrf2 1.00 1.27 1.26 1.27 0.096 0.442 0.470
Mn-SOD 1.00b 1.12b 1.05b 1.80a 0.091 <0.001 0.072
Open in a new tab

1Standard error of the means (n = 6).

2Orthogonal polynomials were used to evaluate linear and quadratic responses to the levels of BLE treatment.

3CTR: basal diet; BLE1, BLE2, and BLE3 group, basal diet adding 1.0, 2.0, and 4.0 g/kg BLE, respectively.

a–bMeans within the same row with no common superscript differ significantly (P < 0.05).

Nrf2, nuclear factor erythroid 2-related factor 2; Mn-SOD, manganese superoxide dismutase.

The mRNA expression of mitochondrial biogenesis-related genes

As presented in Table 6 and Supplementary Table 4, the jejunal sirtuin 1 (SIRT1) mRNA expression in the BLE3 group was significantly higher than that in the CTR group (P < 0.05). Compared with the CTR group, the experimental groups’ jejunal nuclear respiratory factor 1 (NRF1) mRNA expressions were significantly higher (P < 0.05), except for that of the BLE1 group. Furthermore, there was a linear increase in jejunal SIRT1, sirtuin 3, NRF1, and nuclear respiratory factor 2 (NRF2) mRNA expression as BLE dose increased. The highest ileal NRF2 mRNA expression among all groups was observed in the BLE3 group (P < 0.05), and linear and quadratic relationships were observed between BLE level and NRF2 mRNA expression.

Table 6.

Effect of dietary BLE on the expression of mitochondrial biogenesis-related genes of jejunum and ileum in broilers

Item Diet treatment3 P-value
CTR BLE1 BLE2 BLE3 SEM1 Linear2 Quadratic2
Jejunum
PRKAA1 1.00 1.15 1.05 1.02 0.062 0.867 0.567
SIRT1 1.00b 1.16b 1.15b 1.58a 0.072 0.003 0.502
SIRT3 1.00 1.11 1.14 1.43 0.060 0.009 0.674
PGC-1α 1.00 1.47 1.37 2.03 0.187 0.072 0.942
NRF1 1.00c 1.36bc 1.56ab 1.81a 0.086 <0.001 0.240
NRF2 1.00 1.22 1.16 1.55 0.091 0.040 0.788
TFAM 1.00 1.07 1.18 1.22 0.050 0.112 0.617
FOXO1 1.00 1.04 0.91 1.24 0.050 0.086 0.133
mTOR 1.00 1.22 1.21 1.22 0.039 0.087 0.114
Ileum
PRKAA1 1.00 1.11 1.01 0.65 0.097 0.145 0.347
SIRT1 1.00 1.25 1.42 1.40 0.097 0.169 0.333
SIRT3 1.00 1.33 1.31 1.32 0.080 0.268 0.279
PGC-1α 1.00 2.58 1.95 1.43 0.357 0.996 0.201
NRF1 1.00 0.93 1.06 1.15 0.064 0.298 0.738
NRF2 1.00b 1.13b 1.06b 5.09a 0.419 <0.001 0.002
TFAM 1.00 0.89 1.16 1.06 0.054 0.449 0.678
FOXO1 1.00 1.33 1.14 1.48 0.087 0.091 0.992
mTOR 1.00 0.96 1.02 0.94 0.049 0.749 0.818
Open in a new tab

1Standard error of the means (n = 6).

2Orthogonal polynomials were used to evaluate linear and quadratic responses to the levels of BLE treatment.

3CTR: basal diet; BLE1, BLE2, and BLE3 group, basal diet adding 1.0, 2.0, and 4.0 g/kg BLE, respectively.

a–cMeans within the same row with no common superscript differ significantly (P < 0.05).

PRKAA1, protein kinase AMP-activated catalytic subunit alpha 1; SIRT1, sirtuin 1; SIRT3, sirtuin 3; PGC-1α, PPARG coactivator 1 alpha; NRF1, nuclear respiratory factor 1; NRF2, nuclear respiratory factor 2; TFAM, mitochondrial transcription factor A; FOXO1, forkhead box O1; mTOR, mechanistic target of rapamycin.

mtDNA copy number

As shown in Figure 1 and Supplementary Table 5, no significant differences in jejunal and ileal mtDNA copy numbers were observed among the groups (P > 0.05). Additionally, the quadratic response of the jejunal mtDNA copy number occurred with increasing BLE concentration.

Figure 1.

Figure 1.

Open in a new tab

Effect of dietary BLE on the mtDNA copy number of jejunum (A) and ileum (B) in broilers. Data were expressed as mean with their standard errors represented by vertical bars, (n = 6). Orthogonal polynomials were used to evaluate linear and quadratic responses to the levels of BLE treatment. mtDNA: mitochondrial DNA; CTR: basal diet; BLE1, BLE2, and BLE3 group, basal diet adding 1.0, 2.0, and 4.0 g/kg BLE, respectively.

Discussion

We investigated the effects of BLE on growth performance in broilers in a previous study and revealed that dietary BLE supplementation improved average daily feed intake during broilers’ starter and grower phases and also enhanced average daily gain and feed-to-gain ratio during broilers’ grower and overall phases (Shen et al., 2019b). Similarly, BLE has shown the ability to inhibit weight loss in diabetic rats (Zhang et al., 2017), whereas further research on effects of BLE supplementation on growth performance of broilers needed to be investigated because of the intricacy nutrient composition of BLE.

This study revealed that BLE supplementation linearly promoted jejunal mitochondrial ICDH activity, and a dose of 4.0 g/kg BLE supplementation presented a notable increase. ICDH, which is related to the production of NADH (Stoddard et al., 1998), is a crucial enzyme in the mitochondrial tricarboxylic acid (TCA) cycle (Bubber et al., 2011). The TCA cycle conveys NADH to the electron transport chain to prepare for synthesizing adenosine triphosphate (Fernie et al., 2004). Therefore, the TCA cycle enzyme activity can be considered as an indicator of mitochondrial energy metabolism. In addition, previous study has demonstrated that TCA cycle enzyme activity is related to energy metabolism (Vitorica et al., 1981), so the beneficial effect of BLE on small intestine mitochondrial energy metabolism may be partly attributed to increasing TCA cycle enzyme activity. It has been demonstrated that vitexin, which is a flavonoid belonging to BLE (Yang et al., 2017), can improve kidney mitochondria’s ICDH activity in cadmium-induced rats (Umar Ijaz et al., 2021). The increase of TCA cycle enzyme activity may be attributed to reducing TCA cycle enzyme oxidation by flavonoids in BLE (Umar Ijaz et al., 2021). Hence, we speculated that flavonoids in BLE might play an important role in improving TCA cycle enzyme activity.

According to our findings, BLE supplementation linearly boosted jejunal mitochondrial SOD activity, and all BLE supplementation doses—except a BLE dose of 2.0 g/kg—showed beneficial effects. Moreover, 4.0 g/kg BLE supplementation resulted in significantly higher ileal Mn-SOD mRNA expression than that of the CTR group. Energy metabolism is associated with the transportation of electrons (Fernie et al., 2004), and premature leakage of electrons onto oxygen forms ROS, including hydrogen peroxide and superoxide, which cause mitochondrial oxidative damage (Trifunovic and Larsson, 2008; Treberg et al., 2018). The body has an antioxidant system, which includes SOD and GSH, to alleviate oxidative damage (Matés et al., 1999; Yun et al., 2021). Previous studies have shown that mitochondrial SOD includes copper/zinc superoxide dismutase located in the intermembrane space and Mn-SOD located in the matrix and on the inner membrane (Okado-Matsumoto and Fridovich, 2001). SOD has a significant impact on turning highly reactive superoxide anion into less reactive hydrogen peroxide which can be further decomposed into water and oxygen by other antioxidant enzymes (Matés et al., 1999). Therefore, BLE treatment appeared to promote small intestine mitochondria’s antioxidant capacity by increasing antioxidant enzyme activity and antioxidant genes’ mRNA expression. Additionally, BLE has been reported to enhance broilers’ breast meat and liver SOD activity (Shen et al., 2019a, 2019b), and it can improve diabetic rats’ renal tissue SOD activity (Ying et al., 2017). Yu et al. (2022) demonstrated that BLE can increase SOD activity of jejunum and liver and jejunal Mn-SOD mRNA expression in sucking piglets. Niu et al. (2017) reported that fermented Ginkgobiloba leaves, which are rich in flavonoids that are similar to BLE components (Yang et al., 2017; Horbowicz et al., 2021), could heighten the SOD activity of broilers’ breast and thigh muscle.

The present findings revealed that BLE supplementation linearly increased jejunal SIRT1 mRNA expression and linearly and quadratically increased ileal NRF2 mRNA expression, and a dose of 4.0 g/kg exhibited an optimal effect. Diets supplemented with BLE at 2.0 and 4.0 g/kg resulted in significantly higher jejunal NRF1 mRNA expression than that of the CTR group. Mitochondrial biogenesis is the process producing new mitochondria, and mitochondrial turnover is linked to mitochondrial quality (Davinelli et al., 2020). SIRT1, which can act as an upstream effector of PPARG coactivator 1 alpha, promotes mitochondrial biogenesis (Niu et al., 2020). Both NRF1 and NRF2 are downstream effectors of PPARG coactivator 1 alpha, and they regulate the expression of mitochondrial transcription factor A which is responsible for mtDNA replication and transcription and subsequent mitochondrial biogenesis (Virbasius and Scarpulla, 1994; Wu et al., 1999; Laubenthal et al., 2016). Taken together, these results suggested that BLE has the potential to augment mitochondrial biogenesis in the small intestine by increasing mitochondrial biogenesis-related mRNA expression. Jiang et al. (2021) demonstrated that genistein from flavonoids increased hepatic SIRT1 mRNA expression in broilers. Sharma et al. (2015) reported that quercetin, a flavonoid, could enhance cerebral NRF2 mRNA expression in aluminium-induced rats. Flavonoids probably mediate the expression of genes related to mitochondrial biogenesis via the heme oxygenase/carbon monoxide system (Kicinska and Jarmuszkiewicz, 2020). Furthermore, resveratrol is a natural polyphenol that can increase NRF1 mRNA expression in broilers’ breast muscle (Zhang et al., 2018). This effect is associated with mimicking the beneficial effects of caloric restriction (Davinelli et al., 2020). Hence, we presumed that BLE’s favorable effects on mitochondrial biogenesis-related genes might be due to the extract’s inclusion of flavonoids and polyphenols.

In conclusion, the present results indicated that BLE supplementation is beneficial to the energy metabolism, antioxidant capacity, and biogenesis of small intestine mitochondria in broilers. Specifically, diets supplemented with 4.0 g/kg of BLE exhibited the best effects. Our findings lightened a new direction to enhance small intestine mitochondrial efficiency in broilers and provided a theoretical basis for the application of BLE in broiler production. Further studies would be necessary to observe the metabolic efficiency of small intestine mitochondria in broilers supplemented with BLE under a heat stress model.

Supplementary Material

skac391_suppl_Supplementary_Material
Click here for additional data file. (18KB, docx)

Acknowledgments

This research was financially supported by the National Natural Science Foundation of China (31601973) and the College student innovation and entrepreneurship training program in Nanjing Agriculture University (S20190014).

Glossary

Abbreviations

ROS

reactive oxygen species

BLE

bamboo leaf extract

CTR

control

ICDH

isocitrate dehydrogenase

α-KGDH

α-ketoglutarate dehydrogenase

MDH

malate dehydrogenase

T-SOD

total superoxide dismutase

MDA

malondialdehyde

GSH

glutathione; mtDNA, mitochondrial DNA

TCA

tricarboxylic acid

Contributor Information

Zechen Xie, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Ge Yu, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Yang Yun, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Xin Zhang, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Mingming Shen, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Minghui Jia, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Anqi Li, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Hao Zhang, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Tian Wang, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Jingfei Zhang, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Lili Zhang, College of Animal Science and Technology, Nanjing Agriculture University, Nanjing, Jiangsu 210095, P. R. China.

Conflict of Interest Statement

All authors declare no potential conflict of interest.

Literature Cited

  1. Brand, M. D., and Nicholls D. G.. . 2011. Assessing mitochondrial dysfunction in cells. Biochem. J. 435:297–312. doi: 10.1042/BJ20110162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bubber, P., Hartounian V., Gibson G. E., and Blass J. P.. . 2011. Abnormalities in the tricarboxylic acid (TCA) cycle in the brains of schizophrenia patients. Eur. Neuropsychopharmacol. 21:254–260. doi: 10.1016/j.euroneuro.2010.10.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cheng, Y., Chen Y., Li J., Qu H., Zhao Y., Wen C., and Zhou Y.. . 2020. Dietary beta-sitosterol regulates serum lipid level and improves immune function, antioxidant status, and intestinal morphology in broilers. Poult. Sci. 99:1400–1408. doi: 10.1016/j.psj.2019.10.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Davinelli, S., De Stefani D., De Vivo I., and Scapagnini G.. . 2020. Polyphenols as caloric restriction mimetics regulating mitochondrial biogenesis and mitophagy. Trends Endocrinol. Metab. 31:536–550. doi: 10.1016/j.tem.2020.02.011 [DOI] [PubMed] [Google Scholar]
  5. Delbarba, A., Abate G., Prandelli C., Marziano M., Buizza L., Arce Varas N., Novelli A., Cuetos F., Martinez C., Lanni C., . et al. 2016. Mitochondrial alterations in peripheral mononuclear blood cells from Alzheimer’s disease and mild cognitive impairment patients. Oxid. Med. Cell. Longev. 2016:5923938. doi: 10.1155/2016/5923938 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Fernie, A. R., Carrari F., and Sweetlove L. J.. . 2004. Respiratory metabolism: glycolysis, the TCA cycle and mitochondrial electron transport. Curr. Opin Plant Biol. 7:254–261. doi: 10.1016/j.pbi.2004.03.007 [DOI] [PubMed] [Google Scholar]
  7. Horbowicz, M., Wiczkowski W., Góraj-Koniarska J., Miyamoto K., Ueda J., and Saniewski M.. . 2021. Effect of methyl jasmonate on the terpene trilactones, flavonoids, and phenolic acids in Ginkgo biloba l. leaves: relevance to leaf senescence. Molecules. 26:4682. doi: 10.3390/molecules26154682 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hu, C., Zhang Y., and Kitts D. D.. . 2000. Evaluation of antioxidant and prooxidant activities of bamboo Phyllostachys nigra var. Henonis leaf extract in vitro. J. Agric. Food Chem. 48:3170–3176. doi: 10.1021/jf0001637 [DOI] [PubMed] [Google Scholar]
  9. Jia, P., Ji S., Zhang H., Chen Y., and Wang T.. . 2020. Piceatannol ameliorates hepatic oxidative damage and mitochondrial dysfunction of weaned piglets challenged with diquat. Animals. 10:1239. doi: 10.3390/ani10071239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Jiang, J., Qi L., Lv Z., Jin S., Wei X., and Shi F.. . 2019. Dietary stevioside supplementation alleviates lipopolysaccharide-induced intestinal mucosal damage through anti-inflammatory and antioxidant effects in broiler chickens. Antioxidants. 8:575. doi: 10.3390/antiox8120575 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Jiang, Z., Yang Z., Zhang H., Yao Y., and Ma H.. . 2021. Genistein activated adenosine 5’-monophosphate-activated protein kinase-sirtuin1/peroxisome proliferator-activated receptor γ coactivator-1α pathway potentially through adiponectin and estrogen receptor β signaling to suppress fat deposition in broiler chickens. Poult. Sci. 100:246–255. doi: 10.1016/j.psj.2020.10.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kicinska, A., and Jarmuszkiewicz W.. . 2020. Flavonoids and mitochondria: activation of cytoprotective pathways? Molecules. 25:3060. doi: 10.3390/molecules25133060 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Koide, C. L. K., Collier A. C., Berry M. J., and Panee J.. . 2011. The effect of bamboo extract on hepatic biotransforming enzymes--findings from an obese-diabetic mouse model. J. Ethnopharmacol. 133:37–45. doi: 10.1016/j.jep.2010.08.062 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Laubenthal, L., Hoelker M., Frahm J., Dänicke S., Gerlach K., Südekum K. H., Sauerwein H., and Häussler S.. . 2016. Mitochondrial DNA copy number and biogenesis in different tissues of early- and late-lactating dairy cows. J. Dairy Sci. 99:1571–1583. doi: 10.3168/jds.2015-9847 [DOI] [PubMed] [Google Scholar]
  15. Li, Y., Fang L., Xue F., Mao S., Xiong B., Ma Z., and Jiang L.. . 2021. Effects of bamboo leaf extract on the production performance, rumen fermentation parameters, and rumen bacterial communities of heat-stressed dairy cows. Anim. Biosci. 34:1784–1793. doi: 10.5713/ab.20.0527 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Liu, J., Zhu M., Feng C., Ding H., Zhan Y., Zhao Z., and Ding Y.. . 2015. Bamboo leaf extract improves spatial learning ability in a rat model with senile dementia. J. Zhejiang Univ. Sci. B. 16:593–601. doi: 10.1631/jzus.B1400249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Livak, K. J., and Schmittgen T. D.. . 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  18. Mao, J., Yin J., Ge Q., Jiang Z., and Gong J.. . 2013. In vitro antioxidant activities of polysaccharides extracted from Moso ­Bamboo-Leaf. Int. J. Biol. Macromol. 55:1–5. doi: 10.1016/j.ijbiomac.2012.12.027 [DOI] [PubMed] [Google Scholar]
  19. Matés, J. M., Pérez-Gómez C., and Núñez de Castro I.. . 1999. Antioxidant enzymes and human diseases. Clin. Biochem. 32:595–603. doi: 10.1016/s0009-9120(99)00075-2 [DOI] [PubMed] [Google Scholar]
  20. Mishra, B., and Jha R.. . 2019. Oxidative stress in the poultry gut: potential challenges and interventions. Front. Vet. Sci. 6:60. doi: 10.3389/fvets.2019.00060 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. National Research Council. 1994. Nutrient requirements of poultry. 9th rev. ed.Washington, DC: National Academic Press. [Google Scholar]
  22. Niu, Y., Zhou W., Nie Z., Shin K. T., and Cui X.. . 2020. Melatonin enhances mitochondrial biogenesis and protects against rotenone-induced mitochondrial deficiency in early porcine embryos. J. Pineal Res. 68:e12627. doi: 10.1111/jpi.12627 [DOI] [PubMed] [Google Scholar]
  23. Niu, Y., Wan X., Zhang X., Zhao L., He J., Zhang J., Zhang L., and Wang T.. . 2017. Effect of supplemental fermented Ginkgo biloba leaves at different levels on growth performance, meat quality, and antioxidant status of breast and thigh muscles in broiler chickens. Poult. Sci. 96:869–877. doi: 10.3382/ps/pew313 [DOI] [PubMed] [Google Scholar]
  24. Ojano-Dirain, C., Tinsley N. B., Wing T., Cooper M., and Bottje W. G.. . 2007. Membrane potential and H2O2 production in duodenal mitochondria from broiler chickens (Gallus gallus domesticus) with low and high feed efficiency. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 147:934–941. doi: 10.1016/j.cbpa.2007.02.029 [DOI] [PubMed] [Google Scholar]
  25. Okado-Matsumoto, A., and Fridovich I.. . 2001. Subcellular distribution of superoxide dismutases (SOD) in rat liver: Cu,Zn-SOD in mitochondria. J. Biol. Chem. 276:38388–38393. doi: 10.1074/jbc.M105395200 [DOI] [PubMed] [Google Scholar]
  26. Sharma, D. R., Sunkaria A., Wani W. Y., Sharma R. K., Verma D., Priyanka K., Bal A., and Gill K. D.. . 2015. Quercetin protects against aluminium induced oxidative stress and promotes mitochondrial biogenesis via activation of the PGC-1alpha signaling pathway. Neurotoxicology. 51:116–137. doi: 10.1016/j.neuro.2015.10.002 [DOI] [PubMed] [Google Scholar]
  27. Shen, M., Xie Z., Jia M., Li A., Han H., Wang T., and Zhang L.. . 2019a. Effect of bamboo leaf extract on antioxidant status and cholesterol metabolism in broiler chickens. Animals. 9:699. doi: 10.3390/ani9090699 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Shen, M., Zhang L., Chen Y., Zhang Y., Han H., Niu Y., He J., Zhang Y., Cheng Y., and Wang T.. . 2019b. Effects of bamboo leaf extract on growth performance, meat quality, and meat oxidative stability in broiler chickens. Poult. Sci. 98:6787–6796. doi: 10.3382/ps/pez404 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Stoddard, B. L., Cohen B. E., Brubaker M., Mesecar A. D., and D. E.Koshland, Jr. 1998. Millisecond Laue structures of an enzyme-product complex using photocaged substrate analogs. Nat. Struct. Biol. 5:891–897. doi: 10.1038/2331 [DOI] [PubMed] [Google Scholar]
  30. Tanaka, A., Zhu Q., Tan H., Horiba H., Ohnuki K., Mori Y., Yamauchi R., Ishikawa H., Iwamoto A., Kawahara H., . et al. 2014. Biological activities and phytochemical profiles of extracts from different parts of bamboo (Phyllostachys pubescens). Molecules. 19:8238–8260. doi: 10.3390/molecules19068238 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Treberg, J. R., Braun K., Zacharias P., and Kroeker K.. . 2018. Multidimensional mitochondrial energetics: application to the study of electron leak and hydrogen peroxide metabolism. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 224:121–128. doi: 10.1016/j.cbpb.2017.12.013 [DOI] [PubMed] [Google Scholar]
  32. Trifunovic, A., and Larsson N. G.. . 2008. Mitochondrial dysfunction as a cause of ageing. J. Intern. Med. 263:167–178. doi: 10.1111/j.1365-2796.2007.01905.x [DOI] [PubMed] [Google Scholar]
  33. Umar Ijaz, M., Batool M., Batool A., Al-Ghanimd K. A., Zafar S., Ashraf A., Al-Misned F., Ahmed Z., Shahzadi S., Samad A., . et al. 2021. Protective effects of vitexin on cadmium-induced renal toxicity in rats. Saudi J. Biol. Sci. 28:5860–5864. doi: 10.1016/j.sjbs.2021.06.040 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Virbasius, J. V., and Scarpulla R. C.. . 1994. Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis. Proc. Natl. Acad. Sci. USA. 91:1309–1313. doi: 10.1073/pnas.91.4.1309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Vitorica, J., Cano J., Satrústegui J., and Machado A.. . 1981. Comparison between developmental and senescent changes in enzyme activities linked to energy metabolism in rat heart. Mech. Ageing Dev. 16:105–116. doi: 10.1016/0047-6374(81)90087-7 [DOI] [PubMed] [Google Scholar]
  36. Wu, Z., Puigserver P., Andersson U., Zhang C., Adelmant G., Mootha V., Troy A., Cinti S., Lowell B., Scarpulla R. C., . et al. 1999. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell. 98:115–124. doi: 10.1016/S0092-8674(00)80611-X [DOI] [PubMed] [Google Scholar]
  37. Yang, J. H., Choi M. H., Yang S. H., Cho S. S., Park S. J., Shin H. J., and Ki S. H.. . 2017. Potent anti-inflammatory and antiadipogenic properties of bamboo (Sasa coreana Nakai) leaves extract and its major constituent flavonoids. J. Agric. Food Chem. 65:6665–6673. doi: 10.1021/acs.jafc.7b02203 [DOI] [PubMed] [Google Scholar]
  38. Ying, C., Mao Y., Chen L., Wang S., Ling H., Li W., and Zhou X.. . 2017. Bamboo leaf extract ameliorates diabetic nephropathy through activating the AKT signaling pathway in rats. Int. J. Biol. Macromol. 105:1587–1594. doi: 10.1016/j.ijbiomac.2017.03.124 [DOI] [PubMed] [Google Scholar]
  39. Yu, C., Zhang J., Li Q., Xiang X., Yang Z., and Wang T.. . 2021. Effects of trans-anethole supplementation on serum lipid metabolism parameters, carcass characteristics, meat quality, fatty acid, and amino acid profiles of breast muscle in broiler chickens. Poult. Sci. 100:101484. doi: 10.1016/j.psj.2021.101484 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yu, G., Ji S., Yun Y., Cheng K., Zhang H., Jia P., Wang T., and Zhang L.. . 2022. Effects of bamboo leaf extract intervention on the growth performance, antioxidant capacity, and hepatic apoptosis in suckling piglets. J. Anim. Sci. 100:skac201. doi: 10.1093/jas/skac201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yun, Y., Ji S., Yu G., Jia P., Niu Y., Zhang H., Zhang X., Wang T., and Zhang L.. . 2021. Effects of Bacillus subtilis on jejunal integrity, redox status, and microbial composition of intrauterine growth restriction suckling piglets. J. Anim. Sci. 99:skab255. doi: 10.1093/jas/skab255 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhang, C., Yang L., Zhao X., Chen X., Wang L., and Geng Z.. . 2018. Effect of dietary resveratrol supplementation on meat quality, muscle antioxidative capacity and mitochondrial biogenesis of broilers. J. Sci. Food Agric. 98:1216–1221. doi: 10.1002/jsfa.8576 [DOI] [PubMed] [Google Scholar]
  43. Zhang, H., Chen Y., Li Y., Jia P., Ji S., Chen Y., and Wang T.. . 2020. Protective effects of pterostilbene against hepatic damage, redox imbalance, mitochondrial dysfunction, and endoplasmic reticulum stress in weanling piglets. J. Anim. Sci. 98:skaa328. doi: 10.1093/jas/skaa328 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhang, J., Yang Y., Han H., Zhang L., and Wang T.. . 2021. Bisdemethoxycurcumin protects small intestine from lipopolysaccharide-induced mitochondrial dysfunction via activating ­mitochondrial antioxidant systems and mitochondrial biogenesis in broiler chickens. Oxid. Med. Cell. Longev. 2021:9927864. doi: 10.1155/2021/9927864 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Zhang, L., Mao Y., Pan J., Wang S., Chen L., and Xiang J.. . 2017. Bamboo leaf extract ameliorates cardiac fibrosis possibly via alleviating inflammation, oxidative stress and apoptosis. Biomed. Pharmacother. 95:808–817. doi: 10.1016/j.biopha.2017.08.138 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

skac391_suppl_Supplementary_Material
Click here for additional data file. (18KB, docx)

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES