Abstract
Background
Papillary thyroid cancer (PTC) is the most common type of thyroid cancer which its precise etiology remains unknown. However, environmental and genetic factors contribute to the etiology of PTC. Axis inhibition protein 1 (Axin1) is a scaffold protein that exerts its role as a tumor suppressor. In addition, Cathepsin B (Ctsb) is a cysteine protease with higher expression in several types of tumors. Therefore, the aim of this study was to investigate the possible association of AXIN1 rs12921862 C/A and rs1805105 G/A and CTSB rs12898 G/A polymorphisms with PTC susceptibility.
Materials & Methods
In total, 156 PTC patients and 158 sex‐, age‐, and BMI‐matched control subjects were enrolled in the study. AXIN1 rs12921862 C/A and rs1805105 G/A and CTSB rs12898 G/A polymorphisms were genotyped using the PCR–RFLP method.
Results
There was a relationship between AXIN1 rs12921862 C/A polymorphism and an increased risk of PTC in all genetic models except the overdominant model. The AXIN1 rs1805105 G/A polymorphism was associated with an increased PTC risk only in codominant and overdominant models. The frequency of AXIN1 A rs12921862 A rs1805105 haplotype was higher in the PTC group and also this haplotype was associated with an increased risk of PTC. Moreover, the AXIN1 rs12921862 C/A polymorphism was not associated with PTC clinical and pathological findings, but AXIN1 rs1805105 G/A polymorphism was associated with almost three folds of larger tumor size (≥1 cm). There was no association between CTSB rs12898 G/A polymorphism and PTC and its findings.
Conclusion
The AXIN1 rs12921862 C/A and rs1805105 G/A polymorphisms were associated with PTC. AXIN1 rs1805105 G/A polymorphism was associated with higher tumor size.
Keywords: AXIN1, CTSB, papillary thyroid cancer, polymorphism, tumor size
Papillary thyroid cancer (PTC) is the most common type of thyroid cancer which genetic and environmental factors play key roles in its pathogenesis. Axin1 is a scaffold protein which plays a tumor suppressor role. Cathepsin B is a cysteine protease enzyme with higher expression in tumors. Regarding the role of Axin1 and Cathepsin B on tumorigenesis, the aim of this study was to evaluate the effect of Axin1 and Cathepsin B polymorphisms on PTC. The AXIN1 rs12921862 and rs1805105 polymorphisms was associated with increased risk of PTC. The AXIN1 rs1805105 polymorphism was associated with larger tumor size (≥1 cm). There was no association between CTSB rs12898 polymorphism and PTC.
1. INTRODUCTION
Thyroid cancer is the most common tumor in the endocrine system, accounting for about 1% of all cancer cases to date. 1 Different types of thyroid cancer have been known, such as follicular thyroid cancer (FTC), anaplastic thyroid cancer (ATC), and medullary thyroid cancer (MTC). The most prevalent form of thyroid cancer is papillary thyroid cancer (PTC), accounting for almost 80% of all cases. 2 , 3 PTC is a well‐differentiated thyroid carcinoma initiated from follicular cells that present a good prognosis when adequately treated. About 95% of patients who suffer from PTC can be cured by surgery and accessory therapies and have a 10‐year survival. 4 On the other hand, some patients show aggressive tumor behavior and suffer from recurrence and death even after regular treatment. Lymph node metastasis (LNM) is a crucial factor that aggravates the risk of recurrence and mortality in patients suffering from PTC. 5 It seems that the PTC is more frequent in females compared to males by three times. 6
Despite numerous studies, the precise etiology of PTC remains unknown. Environmental factors, such as radiation exposure, hormonal factors, family history, and genetic factors contribute to the etiology of PTC. 7 Several evidences of family studies revealed the role of genetic factors in the etiology of PTC. In addition, genetic factors appear to be more pivotal in the origin of papillary carcinoma than follicular carcinomas. Furthermore, there is evidence that shows some ethnicities may be more susceptible to the effects of ionizing radiation. A wide range of genetic alterations, including chromosomal rearrangements and point mutations, have been implicated in the development of PTC. Chromosomal rearrangements are likely to link to radiation exposure, whereas the origin of point mutation remains unknown. 8 Studies have confirmed that mutations in some genes, such as microRNA let‐7a‐2, mammalian target of rapamycin (mTOR) and RAC(Rho family)‐alpha serine/threonine‐protein kinase(AKT1), Mouse double minute 2 homolog(MDM2), Forkhead box protein O1 (FOXO1), Fas receptor genes are likely to associate with the risk of PTC. 10 , 11
Recently, several evidences imply the effect of the Wnt (Wingless/Integrated) signaling pathway in the etiology of PTC. Normal thyroid cells could express several proteins, including Frizzled receptors (Fzd), Disheveled (Dvl), and Wnt proteins. Moreover, TSH‐dependent overexpression of Wnt1 and Glycogen synthase kinase‐3 beta(GSK3β) inhibition in relation to thyroid cell proliferation has been shown. 12 In addition, genetic variations in some proteins involved in the Wnt pathway, such as APC, β‐catenin, and Axin, have been indicated in some types of thyroid carcinomas. 12 , 13 In a study performed by Kurihara et al, 14 AXIN1 mutations was observed in 81.8% of anaplastic thyroid cancers (ATCs) patients, resulting in amino acid substitution. The different mutations found in the AXIN1 gene affect the domains for interaction with Adenomatous polyposis coli (APC), β‐catenin, and Dvl, and the G‐protein regulatory domain, and thus influence the role of Axin1 as a negative regulator of β‐catenin in PTC. 14
Axis inhibition protein 1 (Axin1) is a multi‐domain scaffold protein that affects the β‐catenin levels and localization when the Wnt pathway activates. This protein contributes to the promotion and improvement of several complications, such as Caudal duplication anomalies, atrial septal defect, non‐small‐cell lung cancer (NSCLC), breast cancer, gastrointestinal cancer, and colorectal cancer. 15 AXIN1 gene lies on chromosome 16p13.3 (65‐kb), and also its protein product plays a critical role in the embryonic development. 16 The interaction of Axin1 protein with several proteins acts as a leading negative regulator in the Wnt signaling pathway. In recent years, in silico analysis suggested that overexpression of the CDH16 gene, whose expression act as a biomarker for thyroid cancer, negatively regulates the AXIN1 expression in thyroid tissue. 17 There are several genetic variants in the AXIN1 gene which their effects on cancer have been reported. 18
Cathepsin B (CTSB) is a cysteine protease enzyme whose role in the degradation of lysosomal proteins has been well known. CTSB is a tumor biomarker because it promotes tumor progression, and also its expression is elevated in many types of tumors. Indeed, evidence showed higher expression of CTSB in several types of solid tumors. Overexpression of CTSB has been seen in PTC cells, associated with lymph node metastasis and advanced N stage. 19 The CTSB gene is located on chromosome 8(8p23.1). There are several genetic polymorphisms in the CTSB gene whose effects on several cancers have been studied. 20 , 21
Given the effects of AXIN1 and CTSB in tumorigenesis and lack of published study on the effects of their polymorphisms on thyroid cancer; therefore, for the first time, this study was conducted to investigate the association between AXIN1 rs12921862 C/A and rs1805105 G/A and CTSB rs12898 G/A polymorphisms and the risk of PTC in Iranian population.
2. MATERIALS AND METHODS
2.1. Study group
A case–control study was conducted on 156 PTC patients and 158 sex‐, age‐, and BMI‐ matched controls who were referred to the outpatient endocrinology clinic of the Zahedan (southeast of Iran).
The detection of PTC was evaluated by the pathological findings of ultrasonography‐guided fine needle aspiration biopsy or resected specimens according to the revised American Thyroid Association Management guidelines. 22 Two pathologists were employed to confirm all samples. The exclusion criteria for the study included the patients having the history of thyroid disease or thyroid surgery, those who has had neck irradiation, iodinated contrast material exposure within the last 6 months, and other types of cancer.
The control group had no previous history of cancer, endocrine disorders, diabetes mellitus, renal or hepatic dysfunction, significant neurological or psychological illness.
All cases and controls were selected between January 2017 and February 2019. The study protocol was approved by the ethical committee of Zahedan University of Medical Sciences, and also the participants signed a written informed consent form.
2.2. DNA extraction
Of the 500 μl whole K2 EDTA‐treated peripheral blood, the human genomic DNA was isolated through the salting‐out method and kept at −20°C in nuclease‐free distilled water. Gel electrophoresis using 1% agarose gel and NanoDrop spectrophotometer were used to measure the quality and quantity of the extracted DNA, respectively.
2.3. Genotyping
Genotyping of AXIN1 rs12921862 C/A, rs1805105 G/A, and CTSB rs12898 G/A variants was done by restriction fragment length polymorphism‐polymerase chain reaction (RFLP–PCR) method as previously described (Table 1). 18 , 20 For all polymorphisms, the reaction tubes containing 9 μl of 2X master mix, 1 μl each primer (10 μM), 6 μl deionized water and, 100 ng DNA template were added to a 20μl PCR reaction tube. PCR protocol was performed in VeritiTM 96‐well Thermal Cycler ABI instrument with a pre‐denaturation step at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 40 s, annealing at a particular temperature based on Table 1, for 35 s, extension at 72°C for the 30 s, and the final extension at 72°C for 5 min. In the next step, 3.5 μl of PCR product of AXIN1 rs12921862 C/A, rs1805105 G/A and, CTSB rs12898 G/A polymorphisms was incubated by 10 IU of ScrF1(ER1421, Thermo Fisher Scientific), FokI (FD2144, Thermo Fisher Scientific) and, Hind III(FD0504, Thermo Fisher Scientific) restriction enzymes at 37°C overnight. The digested fragments were electrophoresed on 3% agarose gel stained with safe stain.
TABLE 1.
The primer sequences and PCR‐RFLP conditions for genotyping of AXIN1 and CTSB polymorphisms
| Polymorphism | Primer sequence (5′–3′) | Annealing Temperature (°C) | Restriction Enzyme | Fragments (bp) |
|---|---|---|---|---|
| AXIN1 rs12921862 |
F‐CTCACGCCAGTGCCTCTACT R‐ATGCCATCCATGTGGAAACT |
55 | ScrFI |
C allele:216 A allele:110 + 106 |
| AXIN1 rs1805105 |
F‐CTGGATACCTGCCGACCTTA R‐ACCTTTCCCTGGCTTGTTCT |
54 | FokI |
C allele:245 T allele:186 + 59 |
| CTSB rs12898 |
F‐GAGGATTCAGCTCATAAAACAAG R‐CAAACCAGTGGCATACAAATTCA |
56 | Hind III |
A allele: 160 G allele: 139 + 21 |
2.4. Statistical analysis
Statistical analysis was performed using SPSS version 23 (IBM SPSS Statistics for Windows, Version 23.0). The clinical and demographic specifications were evaluated using Fisher exact test or an independent Student's t‐test.
Differences between the genotypic and allelic distribution of the study groups, and clinical features of PTC were calculated using SNPStats (http://bioinfo.iconcologia.net/snpstats/start.htm) in various genetic models by obtaining the odds ratio (OR) and their CI of 95% (95% CI). Also Linkage disequilibrium was estimated using SNPStats. Hardy Weinberg equilibrium was calculated with Chi‐square test.
3. RESULTS
The demographic and clinical findings of PTC and control groups are presented in Table 2.
TABLE 2.
Demographic and clinical characteristics of papillary thyroid carcinoma patients and controls
| PTC (n = 156) | Control (n = 158) | p‐value | |
|---|---|---|---|
| Age | 36.1 ± 12.1 | 33.8 ± 10.4 | 0.80 |
| Sex | |||
| Male | 29 (18.6) | 28 (18) | |
| Female | 127 (81.4) | 106 (82) | 0.77 |
| Location | |||
| Right lobe | 69 (44.2) | ||
| Left lobe | 70 (44.9) | ||
| Both lobes | 17 (10.9) | ||
| Tumor size | |||
| <1 cm | 30 (19.2) | ||
| ≥1 cm | 111 (71.2) | ||
| Unknown | 15 (9.6) | ||
| TNM stage | |||
| I | 88 (56.4) | ||
| II | 18 (11.5) | ||
| III | 16 (10.3) | ||
| IV | 16 (10.3) | ||
| Unknown | 18 (11.5) | ||
| N stage | |||
| N0 | 91 (58.3) | ||
| N1 | 46 (29.5) | ||
| Unknown | 19 (12.2) | ||
| M stage | |||
| M0 | 132 (84.6) | ||
| M1 | 5 (3.8) | ||
| Unknown | 19 (12.2) | ||
| Vascular invasion | |||
| Positive | 20 (12.8) | ||
| Negative | 118 (75.6) | ||
| Unknown | 18 (11.5) | ||
| Capsular invasion | |||
| Positive | 22 (14.1) | ||
| Negative | 116 (74.4) | ||
| Unknown | 18 (11.5) | ||
| Extrathyroidal expansion | |||
| Positive | 17 (10.9) | ||
| Negative | 120 (76.9) | ||
| Unknown | 19 (12.2) |
Note: The quantitative variables are presented as mean ± SD and are analyzed by Student t‐Test.
The qualitative variables are analyzed by Fisher exact Test.
The p‐value < 0.05 was considered to be statistically significant.
3.1. AXIN1 and CTSB polymorphisms and PTC susceptibility
The results of agarose gel electrophoresis for AXIN1 rs1805105 (Figure 1A), AXIN1 rs12921862 (Figure 1B) and CTSB rs12898 (Figure 1C) polymorphisms using the PCR–RFLP method are shown in Figure 1.
FIGURE 1.
Agarose gel electrophoresis images of polymerase chain reaction restriction fragments length polymorphism (PCR–RFLP) for (A) AXIN1 rs1805105, (B) AXIN1 rs12921862, and (C) CTSB rs12898 polymorphisms.
The AXIN1 rs12921862, rs1805105, and CTSB rs12898 polymorphisms were not deviated from the Hardy–Weinberg equilibrium (p = 1, p = 0.45 and p = 0.09, respectively). The AXIN1 rs12921862 CA and AA genotypes were more frequent in PTC group, and could increase the PTC risk in codominant model (OR = 2.77, 95% CI = 1.21–6.36 and OR = 4.69, CI = 2.07–10.61, p = 2e‐04, respectively). Moreover, rs12921862 C/A variant was associated with 3.72, 2.08‐, 1.97, and 2.06fold increased PTC risk in dominant (OR = 3.72, CI = 1.69–8.19, p = 5e‐04), recessive (OR = 2.08, CI = 1.34–3.24, p = 0.001), log‐additive (OR = 1.97, CI = 1.40–2.76, p = 1e‐04) and allelic (OR = 2.06, CI = 1.46–2.89, p = 5e‐04) models, respectively (Table 3). The frequency of rs1805105 GA genotype was higher in PTC patients and also rs1805105 G/A polymorphism was associated with 1.73 and 1.78‐fold increased PTC risk only in codominant (OR = 1.73, CI = 1.07–2.77, p = 0.03) and overdominant (OR = 1.78, CI = 1.11–2.84, p = 0.016) models (Table 3). The analysis of the association between AXIN1 polymorphisms and PTC after adjustment for age, sex and BMI, confirmed the above findings.
TABLE 3.
Allelic and genotypic frequency of AXIN1 polymorphisms in PTC patients and control group
| Control (N = 169) | PTC (N = 156) | p‐value | OR (95% CI) | |
|---|---|---|---|---|
| rs12921862 | ||||
| CC, n (%) | 100 (59) | 64 (41) | 1 | |
| CA, n (%) | 60 (36) | 65 (42) | ||
| AA, n (%) | 9 (5) | 27 (17) | ||
| Codominant | 2e‐04 | 2.77 (1.21–6.36) | ||
| 4.69 (2.07–10.61) | ||||
| Dominant (CA + AA vs. CC) | 5e‐04 | 3.72 (1.69–8.19) | ||
| Recessive (AA vs. CA + CC) | 0.001 | 2.08 (1.34–3.24) | ||
| Overdominant (CC + AA vs. CA) | 0.250 | 0.77 (0.49–1.21) | ||
| Log‐additive (AA vs. CA vs. CC) | 1e‐04 | 1.97 (1.40–2.76) | ||
| Allele | ||||
| C, n (%) | 260 (77) | 193 (62) | 1 | |
| A, n (%) | 78 (23) | 119 (38) | 5e‐04 | 2.06 (1.46–2.89) |
| rs1805105 | ||||
| GG, n (%) | 119 (70) | 94 (60) | ||
| GA, n (%) | 44 (26) | 60 (43) | ||
| AA, n (%) | 6 (4) | 2 (2) | ||
| Codominant | 0.030 | 1.73 (1.07–2.77) | ||
| 0.42 (0.08–2.14) | ||||
| Dominant (GA + AA vs. GG) | 0.054 | 1.57 (0.99–2.49) | ||
| Recessive (AA vs. GG + GA) | 0.180 | 0.35 (0.07–1.77) | ||
| Overdominant (GG + AA vs. GA) | 0.016 | 1.78 (1.11–2.84) | ||
| Log‐additive (AA vs. GA vs. GG) | 0.181 | 1.32 (0.88–2.00) | ||
| Allele | ||||
| G, n (%) | 282 (83) | 248 (77) | — | |
| A, n (%) | 56 (17) | 64 (23) | 0.225 | 1.30 (0.87–1.93) |
Note: Logistic regression analysis was used to calculate the independent effect of each polymorphism on PTC risk after adjusting for age, sex, and BMI.
Bold values are statistically significant (p < 0.05).
Haplotype evaluation of AXIN1 rs12921862 C/A and rs1805105 G/A polymorphisms indicated, higher A rs12921862 C/A T rs1805105 haplotype in PTC group (Table 4) and this haplotype was associated with 12.34‐ fold incresead risk of PTC (OR = 12.34, CI = 2.98–51.14, p = 6e‐04). The linkage disequilibrium was weak between AXIN1 rs12921862, rs1805105 polymorphisms (D′ = 0.09, r = ‐0.03).
TABLE 4.
Haplotypes frequency of AXIN1 rs12921862 and rs1805105 polymorphisms in PTC patients and controls
| rs12921862/rs1805105 | Case | Control | p‐value | OR (95% CI) |
|---|---|---|---|---|
| CG | 0.512 | 0.614 | — | 1 |
| AG | 0.284 | 0.220 | 0.084 | 1.42 (0.95–2.11) |
| CA | 0.107 | 0.155 | 0.42 | 0.79 (0.45–1.40) |
| AA | 0.097 | 0.011 | 6e‐04 | 12.34 (2.98–51.14) |
Note: Logistic regression analysis was used to calculate the independent effect of each haplotype onPTC risk.
Bold values are statistically significant (p < 0.05).
The frequency of CTSB rs12898 G/A genotype did not differ between PTC and control subjects, and also this variant was not associated with PTC in any genetic model (Table 5). After adjustment for age, sex and BMI the findings were confirmed.
TABLE 5.
Allelic and genotypic frequency of CTSB rs12898 G/A polymorphisms in PTC patients and control group
| Control (N = 169) | PTC (N = 127) | p‐value | OR (95% CI) | |
|---|---|---|---|---|
| rs12898 | ||||
| GG, n (%) | 76 (45) | 64 (41) | 1 | |
| GA, n (%) | 67 (40) | 62 (40) | ||
| AA, n (%) | 26 (15) | 30 (19) | ||
| Codominant | 0.611 | 1.10 (0.68–1.77) | ||
| 1.37 (0.74–2.55) | ||||
| Dominant (GA + AA vs. GG) | 0.472 | 1.17 (0.76–1.82) | ||
| Recessive (AA vs. GA + GG) | 0.360 | 1.31 (0.74–2.33) | ||
| Overdominant (GG + AA vs. GA) | 0.992 | 1.00 (0.64–1.57) | ||
| Log‐additive (AA vs. GA vs. GG) | 0.341 | 1.16 (0.86–1.56) | ||
| Allele | ||||
| G n (%) | 219 (65) | 190 (61) | 1 | |
| A, n (%) | 119 (35) | 122 (39) | 0.329 | 1.18 (0.86–1.62) |
Note: Logistic regression analysis was used to calculate the independent effect of each polymorphism onPE risk after adjusting for age, sex, and BMI.
p < 0.05 was considered statistically significant.
3.2. AXIN1 and CTSB polymorphisms and PTC findings
There was no significant association between AXIN1 rs12921862 C/A polymorphism and clinical findings of PTC (Table 6).
TABLE 6.
Association of AXIN1 rs12921862 polymorphism with clinical characteristics of papillary thyroid carcinoma
| Characteristics | CC | CA | AA | p‐value/OR (95% CI) | |||||
|---|---|---|---|---|---|---|---|---|---|
| Codominant1 | Codominant2 | Dominant | Recessive | Overdominant | Log‐additive | ||||
| Age, years | |||||||||
| <40 | 43 (42) | 40 (39) | 19 (19) | 0.67 | 0.69 | 0.55 | 0.39 | 0.96 | |
| ≥40 | 21 (39) | 25 (46) | 8 (15) | 1.28 (0.62–2.64) | 0.86 (0.32–2.29) | 1.15 (0.58–2.25) | 0.76 (0.31–1.87) | 1.34 (0.69–2.60) | 0.99 (0.63–1.56) |
| Sex | |||||||||
| Female | 53 (42) | 54 (43) | 20 (16) | 0.58 | 0.71 | 0.30 | 0.65 | 0.42 | |
| Male | 11 (38) | 11 (38) | 7 (24) | 0.98 (0.44–2.44) | 1.68 (0.57–5.00) | 1.18 (0.51–2.70) | 1.70 (0.64–4.54) | 0.83 (0.36–1.89) | 1.25 (0.73–2.17) |
| Tumor size | |||||||||
| <1 cm | 11 (37) | 13 (43) | 6 (20) | 0.84 | 0.57 | 0.72 | 0.78 | 0.57 | |
| ≥1 cm | 47 (42) | 45 (41) | 19 (17) | 0.81 (0.33–1.99) | 0.74 (0.24–2.29) | 0.79 (0.34–1.81) | 0.83 (0.30–2.30) | 0.89 (0.39–2.02) | 0.85 (0.49–1.47) |
| N stage | |||||||||
| N0 | 37 (41) | 38 (42) | 16 (17) | 0.99 | 0.94 | 0.98 | 0.96 | 0.95 | |
| N1 | 19 (41) | 19 (41) | 8 (18) | 0.97 (0.45–2.13) | 0.97 (0.35–2.68) | 0.97 (0.47–2.00) | 0.99 (0.39–2.51) | 0.98 (0.48–2.02) | 0.98 (0.60–1.60) |
| TNM stage | |||||||||
| I–II | 43 (41) | 47 (44) | 16 (15) | 0.52 | 0.75 | 0.38 | 0.31 | 0.80 | |
| III–IV | 14 (44) | 11 (34) | 7 (22) | 0.72 (0.29–1.75) | 1.34 (0.46–3.93) | 0.88 (0.39–1.95) | 1.57 (0.58–4.25) | 0.66 (0.29–1.50) | 1.07 (0.62–1.85) |
| Extrathyroidal expansion | |||||||||
| Negative | 48 (40) | 49 (40.8) | 23 (19.2) | 0.55 | 0.31 | 0.44 | 0.66 | 0.28 | |
| Positive | 9 (52.9) | 6 (35.3) | 2 (11.8) | 0.65 (0.22–1.98) | 0.46 (0.09–2.32) | 0.59 (0.21–1.64) | 0.56 (0.12–2.63) | 0.79 (0.27–2.28) | 0.67 (0.32–1.40) |
| Vascular invasion | |||||||||
| Negative | 49 (41.5) | 48 (40.7) | 21 (17.8) | 0.75 | 0.89 | 0.46 | 0.63 | 0.63 | |
| Positive | 8 (40) | 7 (35) | 5 (25) | 0.89 (0.30–2.66) | 1.46 (0.43–4.98) | 1.07 (0.41–2.80) | 1.54 (0.50–4.70) | 0.79 (0.29–2.11) | 1.17 (0.62–2.20) |
| Capsular invasion | |||||||||
| Negative | 52 (44.8) | 46 (39.7) | 18 (15.5) | 0.48 | 0.25 | 0.42 | 0.61 | 0.24 | |
| Positive | 7 (31.8) | 10 (45.5) | 5 (22.7) | 1.61 (0.57–4.59) | 2.06 (0.58–7.32) | 1.74 (0.66–4.59) | 1.60 (0.52–4.89) | 1.27 (0.51–3.18) | 1.45 (0.79–2.69) |
Note: Logistic regression analysis was used for statistical analysis.
p <0.05 was considered statistically significant.
The frequency of AXIN1 rs1805105 C/A polymorphism was higher in females and PTC patients with extrathyroidal expansion, but was not statistically significant (Table 7). However, this polymorphism was associated with higher tumor size (≥1 cm) in codominant (OR = 2.92, CI = 1.10–7.72, p = 0.043), dominant (OR = 3.05, CI = 1.16–8.04, p = 0.016), overdominant (OR = 2.83, CI = 1.07–7.48, p = 0.025) and log additive (OR = 3.03, CI = 1.17–7.84, p = 0.013).
TABLE 7.
Association of AXIN1 rs1805105 polymorphism with clinical characteristics of papillary thyroid carcinoma.
| Characteristics | GG | GA | AA | p‐value/OR (95% CI) | |||||
|---|---|---|---|---|---|---|---|---|---|
| Codominant1 | Codominant2 | Dominant | Recessive | Overdominant | Log‐additive | ||||
| Age, years | |||||||||
| <40 | 59 (57.8) | 40 (39.2) | 3 (2.9) | 0.25 | 0.53 | 0.11 | 0.79 | 0.36 | |
| ≥40 | 34 (63) | 20 (37) | 0 (0) | 0.87 (0.44–1.72) | — | 0.81 (0.41–1.59) | — | 0.91 (0.46–1.80) | 0.75 (0.40–1.41) |
| Sex | |||||||||
| Female | 73 (57.5) | 52 (40.9) | 2 (1.6) | 0.36 | 0.25 | 0.54 | 0.17 | 0.37 | |
| Male | 20 (69) | 8 (27.6) | 1 (3.5) | 0.56 (0.23–1.37) | 1.82 (0.16–21.17) | 0.61 (0.26–1.44) | 2.23 (0.20–25.49) | 0.55 (0.23–1.34) | 0.70 (0.31–1.56) |
| Tumor size | |||||||||
| <1 cm | 24 (80) | 6 (20) | 0 (0) | 0.043 | 0.016 | 0.33 | 0.025 | 0.013 | |
| ≥1 cm | 63 (56.8) | 46 (41.4) | 2 (1.8) | 2.92 (1.10–7.72) | — | 3.05 (1.16–8.04) | — | 2.83 (1.07–7.48) | 3.03 (1.17–7.84) |
| N stage | |||||||||
| N0 | 51 (56) | 38 (41.8) | 2 (2.2) | 0.43 | 0.77 | 0.2 | 0.96 | 0.61 | |
| N1 | 27 (58.7) | 19 (41.3) | 0 (0) | 0.94 (0.46–1.94) | — | 0.90 (0.44–1.84) | — | 0.98 (0.48–2.02) | 0.84 (0.42–1.66) |
| TNM stage | |||||||||
| I–II | 65 (61.3) | 40 (37.7) | 1 (0.9) | 0.68 | 0.90 | 0.41 | 0.73 | 0.92 | |
| III–IV | 20 (62.5) | 11 (34.4) | 1 (3.1) | 0.89 (0.39–2.06) | 3.25 (0.19–54.35) | 0.95 (0.42–2.15) | 3.39 (0.21–55.74) | 0.86 (0.38–1.98) | 1.04 (0.49–2.22) |
| Extrathyroidal expansion | |||||||||
| Negative | 77 (64.2) | 42 (35) | 1 (0.8) | 0.34 | 0.38 | 0.19 | 0.62 | 0.24 | |
| Positive | 9 (52.9) | 7 (41.2) | 1 (5.9) | 1.43 (0.50–4.10) | 8.56 (0.49–148.88) | 1.59 (0.57–4.43) | 7.44 (0.44–124.85) | 1.30 (0.46–3.66) | 1.77 (0.70–4.48) |
| Vascular invasion | |||||||||
| Negative | 75 (63.6) | 42 (35.6) | 1 (0.8) | 0.49 | 0.76 | 0.23 | 0.96 | 0.54 | |
| Positive | 12 (60) | 7 (35) | 1 (5) | 1.04 (0.38–2.85) | 6.25 (0.37–106.77) | 1.16 (0.44–3.07) | 6.16 (0.37–102.69) | 0.97 (0.36–2.63) | 1.32 (0.54–3.22) |
| Capsular invasion | |||||||||
| Negative | 71 (61.2) | 43 (37.1) | 2 (1.7) | 0.70 | 0.83 | 0.40 | 0.95 | 0.73 | |
| Positive | 14 (63.6) | 8 (36.4) | 0 (0) | 0.94 (0.37–2.43) | — | 0.90 (0.35–2.3) | — | 0.97 (0.38–2.50) | 0.85 (0.35–2.10) |
Note: Logistic regression analysis was used for statistical analysis.
Bold values are statistically significant (p < 0.05).
No relationship was found between CTSB rs12898 G/A polymorphism and clinical findings of PTC (Table 8).
TABLE 8.
Association of CTSB rs12898 G/A polymorphism with clinical characteristics of papillary thyroid carcinoma.
| Characteristics | GG | GA | AA | p‐value/OR (95% CI) | |||||
|---|---|---|---|---|---|---|---|---|---|
| Codominant1 | Codominant2 | Dominant | Recessive | Overdominant | Log‐additive | ||||
| Age, years | |||||||||
| <40 | 41 (40.2) | 41 (40.2) | 20 (19.6) | 0.96 | 0.77 | 0.87 | 0.87 | 0.78 | |
| ≥40 | 23 (42.6) | 21 (38.9) | 10 (18.5) | 0.91 (0.44–1.90) | 0.89 (0.36–2.23) | 0.91 (0.46–1.77) | 0.93 (0.40–2.16) | 0.95 (0.48–1.86) | 0.94 (0.60–1.46) |
| Sex | |||||||||
| Female | 51 (402.) | 52 (40.9) | 24 (18.9) | 0.81 | 0.65 | 0.83 | 0.52 | 0.85 | |
| Male | 13 (44.8) | 10 (34.5) | 6 (20.7) | 0.75 (0.30–1.88) | 0.98 (0.33–2.89) | 0.83 (0.37–1.86) | 1.12 (0.41–3.05) | 0.76 (0.33–1.76) | 0.95 (0.55–1.64) |
| Tumor size | |||||||||
| <1 cm | 11 (36.7) | 15 (50) | 4 (13.3) | 0.43 | 0.64 | 0.35 | 0.23 | 0.86 | |
| ≥1 cm | 46 (41.4) | 42 (37.8) | 23 (20.7) | 0.67 (0.28–1.62) | 1.38 (0.39–4.79) | 0.82 (0.36–1.88) | 1.70 (0.54–5.3) | 0.61 (0.27–1.37) | 1.05 (0.61–1.81) |
| N stage | |||||||||
| N0 | 36 (39.6) | 39 (42.9) | 16 (17.6) | 0.99 | 0.96 | 0.98 | 0.94 | 0.99 | |
| N1 | 18 (39.1) | 20 (43.5) | 8 (17.4) | 1.03 (0.47–2.24) | 1.00 (0.36–2.77) | 1.02 (0.49–2.10) | 0.99 (0.39–2.51) | 1.03 (0.50–2.10) | 1.00 (0.61–1.64) |
| TNM stage | |||||||||
| I–II | 47 (44.3) | 42 (39.6) | 17 (16) | 0.47 | 0.95 | 0.26 | 0.39 | 0.53 | |
| III–IV | 14 (43.8) | 10 (31.2) | 8 (25) | 0.80 (0.32–1.99) | 1.58 (0.56–4.43) | 1.02 (0.46–2.27) | 1.75 (0.67–4.53) | 0.69 (0.30–1.61) | 0.84 (0.42–1.66) |
| Extrathyroidal expansion | |||||||||
| Negative | 51 (42.5) | 45 (37.5) | 24 (20) | 0.95 | 0.92 | 0.82 | 0.77 | 0.96 | |
| Positive | 7 (41.2) | 7 (41.2) | 3 (17.6) | 1.13 (0.37–3.48) | 0.91 (0.22–3.83) | 1.06 (0.38–2.96) | 0.86 (0.23–3.22) | 1.17 (0.41–3.28) | 0.98 (0.50–1.93) |
| Vascular invasion | |||||||||
| Negative | 50 (42.4) | 45 (38.1) | 23 (19.5) | 0.86 | 0.84 | 0.58 | 0.79 | 0.67 | |
| Positive | 8 (40) | 7 (35) | 5 (25) | 0.97 (0.33–2.90) | 1.36 (0.40–4.61) | 0.10 (0.42–2.90) | 1.38 (0.45–4.18) | 0.87 (0.32–2.35) | 1.14 (0.62–2.12) |
| Capsular invasion | |||||||||
| Negative | 49 (42.2) | 44 (37.9) | 23 (19.8) | 0.71 | 0.91 | 0.48 | 0.51 | 0.78 | |
| Positive | 9 (40.9) | 10 (45.5) | 3 (13.6) | 1.24 (0.46–3.32) | 0.71 (0.18–2.87) | 1.06 (0.42–2.67) | 0.64 (0.17–2.34) | 1.36 (0.54–3.42) | 0.92 (0.49–1.70) |
Note: Logistic regression analysis was used for statistical analysis.
p < 0.05 was considered statistically significant.
4. DISCUSSION
PTC is a disorder resulting from the malignancy in thyroid parenchymal cells. This cancer is the most prevalent kind of thyroid cancer, accounting for 80% of all thyroid cancer patients. 6 PTC is more frequent in the third to fifth decades of life, and the mean age of this cancer is 40 years. Its frequency enhances with age, and is more in women compared with men, in ratios of 2:1 to 4:1. 23 Despite numerous studies, the exact etiology of this disease is not clear. However, various environmental and genetic factors are known as disease risk factors. Evidence showed that the family history of PTC could consider as an essential factor in PTC predisposition. Therefore, numerous studies attempted to evaluate the association between various genetic variants and PTC. 7 , 24
Axis inhibition protein 1 (Axin1) is a scaffold protein with several domains in the β‐catenin destruction complex. It exerts its action via the Wnt/β‐catenin signaling pathway and acts as a negative regulator of this pathway, and can induce apoptosis. 15 , 25 Wnt signaling is controlled by the degradation of the Axin1‐mediated β‐catenin destruction complex. AXIN and APC proteins act in the assembly of the β‐catenin destruction complex. The AXIN–APC and AXIN–β‐catenin interactions can contribute to the initiation of β‐catenin phosphorylation and degradation. AXIN1 serves as the main regulator in embryonic development and controls cell proliferation, polarity, and differentiation as well as homeostasis in adult tissue. Therefore, this protein acts as a tumor suppressor, and its defect has been shown to play a central role in carcinogenesis. Lower expression of AXIN1 has been reported in several cancerous cells like hepatocellular carcinoma. 26 Evidence showed the effect of several genetic variants, including catenin (cadherin‐associated protein), beta 1, AXIN1, and APC, and chromosomal abnormalities in the molecular pathogenesis of Anaplastic thyroid cancer. 23 Considering the role of AXIN1 protein in tumorigenesis, several studies evaluated the possible roles of genetic variants of the AXIN1 gene in several cancers.
In the presents study, we assessed the effects of AXIN1 rs12921862 C/A, rs1805105 G/A and, CTSB rs12898 G/A polymorphisms on PTC onset and its clinical findings. This research showed the association between AXIN1 rs12921862 C/A polymorphism and an increased risk of PTC in all genetic models, except the overdominant model. The frequency of AXIN1 rs1805105 GA genotype was higher in PTC patients, and also rs1805105 G/A polymorphism was associated an increased PTC risk only in codominant and overdominant models. The frequency of AXIN1 A rs12921862 A rs1805105 haplotype was higher in PTC group and was associated with an increased risk of the PTC. Moreover, the AXIN1 rs12921862 C/A polymorphism was not associated with PTC findings, but AXIN1 rs1805105 G/A polymorphism was associated with almost three folds of larger tumor size (≥1 cm).
Although no published report is published on the relation between AXIN1 polymorphisms and PTC, there are several studies on the association between these variants and various cancers.
In their study, Li et al demonstrated that the AXIN1 rs12921862, rs1805105, and rs370681 polymorphisms were associated with a higher risk of bladder cancer. 18 Zhang et al indicated the effects of rs12921862 AC and the rs1805105 GA genotypes on epithelial ovarian cancer (EOC) susceptibility. In addition, they showed that EOC patients with rs12921862 CC genotype improved by the Kaplan–Meier survival curves for the overall survival. 27 In a meta‐analysis performed on eight studies on the association between AXIN2 rs2240308 polymorphism and overall cancer risk (2015), Gong et al showed decreased cancer risk in the homozygous, heterozygous, dominant, and allelic (T vs. C) models. 28 Similar to the finding of the present study, Pu et al showed an increased risk of cell renal cell carcinoma (ccRCC) in individuals carrying rs1805105 GA/GG genotypes and rs12921862 AA genotype. Indeed, the presence of the rs1805105 GA genotype is associated with a 1.92‐fold higher risk of developing clinical stage III and IV cancer. 29
There was a relationship between AXIN1 rs9921222 polymorphism and colorectal cancer in the Rosales‐Reynoso study. Despite our results, they showed no association between rs1805105 G/A polymorphism and colorectal cancer. In addition, there was a relationship between advanced Tumor‐Node‐Metastasis (TNM) stages with rs9921222 and rs1805105 G/A polymorphisms and tumor location with rs9921222 variant. 30 No association between rs1805105 G/A and rs214252 polymorphisms and non‐small cell lung cancer risk was reported by Xu et al. 31 Similarly, Wang et al found no relationship between several AXIN1 polymorphisms and Breast Cancer. 32
In addition, in the current study, no relationship was found between the CTSB rs12898 G/A variant and PTC in all genetic models. Also, the CTSB rs12898 G/A was not associated with clinical findings of PTC.
Cathepsin B (Ctsp) is a cysteine protease enzyme involved in protein degradation and processing. 12 Since Ctsb improves tumor progression and its expression is higher in many tumors, it is considered as a cancer biomarker. Evidence revealed that overexpression of CTSB could initiate cell invasion and metastasis in several cancers. 13 Despite the results of the present study, Cui et al indicated the relationship between CTSB rs12898 G/A polymorphism and Primary Hepatic Cancer (PHC). They showed a higher risk of PHC in the GA and AA genotypes compared to the AA genotype, and the increased risk of PHC in dominant, recessive and allelic models. 20 In Stiblar‐Martincic et al's study, a leucine to valine substitution (L26V) polymorphism in the Cathepsin B was indicated in relation to risk of prostate adenocarcinoma. They showed that the VV genotype of this variant be related to higher prostate adenocarcinoma, and less differentiated cancer. 21 Chen et al showed no association between CTSB rs12338, 13,332 and rs8898 variants and oral cancer. 33 In another study, Chen et al found a significant effect of rs13332 but not 13,332 and rs8898 polymorphisms and hepatocellular carcinoma. Indeed, they showed higher tumor size development in patients carrying the rs12338 variant. 34 Ma et al study revealed the relationship between rs9009, rs6731, and rs17814426 polymorphisms and lower risk of gastric cancer. 35
The present study, for the first time, studied the effects of AXIN1 and CTSB polymorphisms on PTC and its clinical findings; however, it suffers from several limitations, first, the low sample size, especially in subgroup analysis which could be significant in a higher sample size. Second, the results would have been more valuable if the study had been performed on cancerous tissue and healthy lateral tissue.
In conclusion, our findings suggested that the AXIN1 rs12921862 C/A polymorphism was associated with an increased risk of PTC in all genetic models, except the overdominant model. The AXIN1 rs1805105 G/A polymorphism was associated with an increased PTC risk only in codominant and overdominant models. The AXIN1 A rs12921862 A rs1805105 haplotype was associated with an incresead risk of PTC. The AXIN1 rs1805105 G/A polymorphism was associated with almost three folds of larger tumor size (≥1 cm). The CTSB rs12898 G/A variant showed no effect on PTC and its clinical findings.
CONFLICT OF INTEREST
All the authors declare no conflict of interest to disclose.
ACKNOWLEDGMENTS
The authors like to express their sincere gratitude to the research department, Zahedan University of Medical Sciences for their assistance (project No. 9192) and individuals who contributed to this study.
Saljooghi S, Heidari Z, Saravani M, Rezaei M, Salimi S. Association of AXIN1 rs12921862 C/A and rs1805105 G/A and CTSB rs12898 G/A polymorphisms with papillary thyroid carcinoma: A case–control study. J Clin Lab Anal. 2023;37:e24804. doi: 10.1002/jcla.24804
DATA AVAILABILITY STATEMENT
The data are available from the corresponding author on reasonable request.
REFERENCES
- 1. Bertol BC, de Araújo JNG, de Carvalho KTC, et al. Polymorphisms at the IL17A and IL17RA genes are associated with prognosis of papillary thyroid carcinoma. Arch Med Res. 2021;53(2):163‐169. [DOI] [PubMed] [Google Scholar]
- 2. Jazdzewski K, Murray EL, Franssila K, Jarzab B, Schoenberg DR, de la Chapelle A. Common SNP in pre‐miR‐146a decreases mature miR expression and predisposes to papillary thyroid carcinoma. Proc Natl Acad Sci. 2008;105(20):7269‐7274. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Xing JC, Tufano RP, Murugan AK, et al. Single nucleotide polymorphism rs17849071 G/T in the PIK3CA gene is inversely associated with follicular thyroid cancer and PIK3CA amplification. PloS One. 2012;7(11):e49192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Grant CS. Recurrence of papillary thyroid cancer after optimized surgery. Gland Surg. 2015;4(1):52‐62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Hsiao P‐J, Lu M‐Y, Chiang F‐Y, Shin S‐J, Tai Y‐D, Juo S‐HH. Vascular endothelial growth factor gene polymorphisms in thyroid cancer. J Endocrinol. 2007;195(2):265‐270. [DOI] [PubMed] [Google Scholar]
- 6. Gu Y, Yu Y, Ai L, et al. Association of the ATM gene polymorphisms with papillary thyroid cancer. Endocrine. 2014;45(3):454‐461. [DOI] [PubMed] [Google Scholar]
- 7. Farid NR, Shi Y, Zou M. Molecular basis of thyroid cancer. Endocr Rev. 1994;15(2):202‐232. [DOI] [PubMed] [Google Scholar]
- 8. DeLellis RA. Pathology and genetics of thyroid carcinoma. J Surg Oncol. 2006;94(8):662‐669. [DOI] [PubMed] [Google Scholar]
- 9. Heidari Z, Mohammadpour‐Gharehbagh A, Eskandari M, Harati‐Sadegh M, Salimi S. Genetic polymorphisms of miRNA let7a‐2 and pri‐mir‐34b/c are associated with an increased risk of papillary thyroid carcinoma and clinical/pathological features. J Cell Biochem. 2018. doi: 10.1002/jcb.28152 [DOI] [PubMed] [Google Scholar]
- 10. Maruei‐Milan R, Heidari Z, Salimi S. Role of MDM2 309T>G (rs2279744) and I/D (rs3730485) polymorphisms and haplotypes in risk of papillary thyroid carcinoma, tumor stage, tumor size, and early onset of tumor: a case control study. J Cell Physiol. 2019;234(8):12934‐12940. [DOI] [PubMed] [Google Scholar]
- 11. Maruei‐Milan R, Saravani M, Heidari Z, Asadi‐Tarani M, Salimi S. Effects of the MTOR and AKT1 genes polymorphisms on papillary thyroid cancer development. IUBMB Life. 2020;72(12):2601‐2610. [DOI] [PubMed] [Google Scholar]
- 12. Sastre‐Perona A, Santisteban P. Role of the wnt pathway in thyroid cancer. Front Endocrinol (Lausanne). 2012;3:31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Polakis P. The many ways of Wnt in cancer. Curr Opin Genet Dev. 2007;17(1):45‐51. [DOI] [PubMed] [Google Scholar]
- 14. Kurihara T, Ikeda S, Ishizaki Y, et al. Immunohistochemical and sequencing analyses of the Wnt signaling components in Japanese anaplastic thyroid cancers. Thyroid. 2004;14(12):1020‐1029. [DOI] [PubMed] [Google Scholar]
- 15. Sue Ng S, Mahmoudi T, Li VSW, et al. MAP3K1 functionally interacts with Axin1 in the canonical Wnt signalling pathway. Biol Chem. 2010;391(2–3):171‐180. [DOI] [PubMed] [Google Scholar]
- 16. Zhou B, Tang T, Chen P, et al. The variations in the AXIN1 gene and susceptibility to cryptorchidism. J Pediatr Urol. 2015;11(3):132.e1‐5. [DOI] [PubMed] [Google Scholar]
- 17. Li P, Wu Q, Sun Y, et al. Downregulation of CDH16 in papillary thyroid cancer and its potential molecular mechanism analysed by qRT‐PCR, TCGA and in silico analysis. Cancer Manage Res. 2019;11:10719‐10729. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Li Q, Zhang P, Wang Y, et al. Association between AXIN1 gene polymorphisms and bladder cancer in Chinese Han population. Dis Markers. 2019;2019:3949343‐3949348. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Kim E‐K, Song M‐J, Jang HH, Chung YS. Clinicopathologic analysis of cathepsin B as a prognostic marker of thyroid cancer. Int J Mol Sci. 2020;21(24):9537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Cui M, Chen Q, He C, et al. A single nucleotide polymorphism CTSB rs12898 is associated with primary hepatic cancer in a Chinese population. Int J Clin Exp Pathol. 2019;12(8):3063‐3069. [PMC free article] [PubMed] [Google Scholar]
- 21. Stiblar‐Martincic D, Hajdinjak T. Polymorphism L26V in the cathepsin B gene may be associated with a risk of prostate cancer and differentiation. J Int Med Res. 2009;37(5):1604‐1610. [DOI] [PubMed] [Google Scholar]
- 22. American Thyroid Association Guidelines Taskforce on Thyroid N, Differentiated Thyroid C , Cooper DS, Doherty GM, Haugen BR, Kloos RT, et al. Revised American Thyroid Association management guidelines for patients with thyroid nodules and differentiated thyroid cancer. Thyroid. 2009;19(11):1167‐1214. [DOI] [PubMed] [Google Scholar]
- 23. Smallridge RC, Marlow LA, Copland JA. Anaplastic thyroid cancer: molecular pathogenesis and emerging therapies. Endocr Relat Cancer. 2009;16(1):17‐44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Abdullah MI, Junit SM, Ng KL, Jayapalan JJ, Karikalan B, Hashim OH. Papillary thyroid cancer: genetic alterations and molecular biomarker investigations. Int J Med Sci. 2019;16(3):450‐460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Chimge N‐O, Little GH, Baniwal SK, et al. RUNX1 prevents oestrogen‐mediated AXIN1 suppression and β‐catenin activation in ER‐positive breast cancer. Nat Commun. 2016;7(1):1‐12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Li VS, Ng SS, Boersema PJ, et al. Wnt signaling through inhibition of beta‐catenin degradation in an intact Axin1 complex. Cell. 2012;149(6):1245‐1256. [DOI] [PubMed] [Google Scholar]
- 27. Zhang Y, Wang Y, Huang X, et al. Association between AXIN1 gene polymorphisms and epithelial ovarian cancer in Chinese population. Biomark Med. 2019;13(6):445‐455. [DOI] [PubMed] [Google Scholar]
- 28. Gong J, Jiang Y, Hao N, Zhu B, Li Y. Quantitative assessment of the association between AXIN2 rs2240308 polymorphism and cancer risk. Sci Rep. 2015;5:10111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Pu Y, Mi X, Chen P, et al. Genetic association of polymorphisms in AXIN1 gene with clear cell renal cell carcinoma in a Chinese population. Biomark Med. 2017;11(11):947‐955. [DOI] [PubMed] [Google Scholar]
- 30. Rosales‐Reynoso MA, Saucedo‐Sarinana AM, Contreras‐Diaz KB, et al. Genetic polymorphisms in APC, DVL2, and AXIN1 are associated with susceptibility, advanced TNM stage or tumor location in colorectal cancer. Tohoku J Exp Med. 2019;249(3):173‐183. [DOI] [PubMed] [Google Scholar]
- 31. Xu Y, Li H, Weng L, et al. Single nucleotide polymorphisms within the Wnt pathway predict the risk of bone metastasis in patients with non‐small cell lung cancer. Aging (Albany NY). 2020;12(10):9311‐9327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Wang X, Goode EL, Fredericksen ZS, et al. Association of genetic variation in genes implicated in the beta‐catenin destruction complex with risk of breast cancer. Cancer Epidemiol Biomarkers Prev. 2008;17(8):2101‐2108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Chen MK, Su SC, Lin CW, Tsai CM, Yang SF, Weng CJ. Cathepsin B SNPs elevate the pathological development of oral cancer and raise the susceptibility to carcinogen‐mediated oral cancer. Hum Genet. 2012;131(12):1861‐1868. [DOI] [PubMed] [Google Scholar]
- 34. Chen TP, Yang SF, Lin CW, Lee HL, Tsai CM, Weng CJ. A4383C and C76G SNP in cathepsin B is respectively associated with the high risk and tumor size of hepatocarcinoma. Tumour Biol. 2014;35(11):11193‐11198. [DOI] [PubMed] [Google Scholar]
- 35. Ma X, Wang Y, Fan H, et al. Genetic polymorphisms of cathepsin B are associated with gastric cancer risk and prognosis in a Chinese population. Cancer Biomark. 2021;32(2):189‐198. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data are available from the corresponding author on reasonable request.