Skip to main content
Communications Biology logoLink to Communications Biology
. 2023 Jan 12;6:30. doi: 10.1038/s42003-022-04380-y

Maternal intermittent fasting in mice disrupts the intestinal barrier leading to metabolic disorder in adult offspring

Yuan Liang 1,#, Wenzhen Yin 1,2,#, Chao Luo 1,#, Lijun Sun 1, Tiange Feng 1, Yunhua Zhang 1, Yue Yin 3,, Weizhen Zhang 1,4,
PMCID: PMC9834385  PMID: 36631606

Abstract

Maternal nutrition plays a critical role in energy metabolism of offspring. We aim to elucidate the effect of long-term intermittent fasting (IF) before pregnancy on health outcomes of offspring. Here we show long-term IF before pregnancy disrupts intestinal homeostasis of offspring with subsequent disorder of glucose and lipid metabolism. This occurs through the reduction in beneficial microbiota such as Lactobacillus_intestinalis. Our observations further support the concept that intestinal microbiota in offspring is vulnerable to maternal nutrition, and its homeostasis is critical for the integrity of intestinal barrier and metabolic homeostasis.

Subject terms: Metabolism, Fat metabolism


Long-term intermediate fasting before pregnancy in mice disrupts intestinal homeostasis of offspring with subsequent glucose and lipid metabolism disorder, mediated by a reduction in beneficial microbiota such as Lactobacillus intestinalis.

Introduction

Over the past two decades, intermittent fasting, not just simple calorie restriction, has emerged as an effective intervention for weight management and metabolic benefits1,2. Major IF strategies include alternate-day fasting (ADF), time-restricted feeding (TRF), alternate-day modified fasting (ADMF), 5:2 diet regimens, Ramadan fasting and other religious fasting3. In addition to large-scale human intervention studies, animal studies also confirm the metabolic benefits of intermittent fasting46. Mechanism underlying the metabolic benefits of intermittent fasting regimens remains largely unknown but may involve the gut microbiome, biological rhythm and lifestyle behaviors1.

Despite the extensive studies focusing on the metabolic benefits of intermittent fasting, its effects on offspring health remain largely undefined. The intrauterine environment plays an important role in determining the health outcomes of the unborn fetus7. Poor environment due to maternal overnutrition or malnutrition during pregnancy may hamper fetal growth, development and health outcomes by permanently programming the fetus8,9. This concept is supported by several large epidemiological studies10,11. Maternal Ramadan exposure is associated with poorer health outcomes in offspring, including lower birth weight, increased incidence of type 2 diabetes and cardiovascular disease12,13. In animal studies, maternal low-protein diet or uterine artery ligation have been demonstrated to cause fetal intrauterine growth restriction, and higher risk of hyperglycemia, obesity, hypertriglyceridemia, and hypertension in adult offspring14,15. All these findings suggest that maternal malnutrition may increase the risk of metabolic disorders in offspring although its underlying mechanism remains unknown.

Intestine, the main organ for nutrient digestion and absorption, is susceptible to the maternal nutritional environment during intrauterine development16,17. Previous studies have shown that maternal nutritional restrictions during early to midgestation hinder intestinal development of offspring1820. On the other hand, diet also plays an important role in host-gut microbiota interactions. Maternal microbiota is the most important microbiota source in the process of neonatal microbiota colonization21,22. Growing evidence shows that maternal nutritional status influences the microbiome composition and intestinal development of offspring23, which may persist beyond birth and extend into adulthood24,25. Whether maternal intermittent fasting alters offspring intestinal homeostasis is currently unclear.

Here, we reported that long-term maternal IF before pregnancy disrupts the intestinal barrier of offspring by suppressing the beneficial microbiota such as Lactobacillus_intestinalis, leading to subsequent dysfunction in glucose and lipid metabolism.

Results

Metabolic benefits of intermittent fasting on dam

There was moderate reduction in body weight and food intake in M-IF mice relevant to M-AL animals (Fig. S1a). Glucose tolerance was significantly improved in M-IF mice (Fig. S1b). Insulin tolerance and liver weight remained largely unaltered (Fig. S1c, d). Fat mass of perirenal white adipose tissue (rWAT), parametrial white adipose tissue (pWAT) and subcutaneous white adipose tissue (sWAT) were slightly reduced (Fig. S1e). These results suggest a metabolic benefit of intermittent fasting on dam.

Maternal intermittent fasting deteriorates metabolism and intestinal barrier in offspring

We next examined the metabolic consequence in O-IF offspring fed NCD. Food intake remained largely unaltered (Fig. S2a). Growth rate measured by change in body weight was slightly reduced without statistical significance (Fig. S2a). Significant impairment in glucose tolerance (P = 0.0212) (Fig. S2b) was observed in O-IF offspring, whereas insulin sensitivity remained unaltered (Fig. S2c). Liver weight(P = 0.0373), hepatic triglyceride content (P = 0.0072), steatosis evidenced by Oil red O and H&E staining were elevated (Fig. S2d). Adipocyte size of eWAT was increased (Fig. S2e). Thus, maternal intermittent fasting deteriorates glucose and lipid metabolism in offspring.

Relevant to O-AL fed NCD, villus height was significantly decreased, whereas villus surface area increased in O-IF NCD mice (Fig. S3a). The stubby intestinal villus in O-IF offspring suggests an alteration in intestinal epithelial structure. We then examined gene relevant to tight junction. Claudin-1(Cldn-1) mRNA showed a slight reduction. Circulating lipopolysaccharides (LPS) showed no significant increase (Fig. S3b). Levels of TNF-a, IL-6 and IL-10 were slightly increased (Fig. S3c).

We next examined the effect of maternal intermittent fasting on offspring mice fed high fat diet (HFD). Relevant to ad libitum, intermittent fasting induced a profound alteration in intestinal barrier in offspring fed HFD. Villus height (P = 0.0003) was significantly decreased, whereas villus surface area (P = 0.003) and crypt depth (P < 0.0001) increased (Fig. 1a). The stubby intestinal villus in O-IF offspring suggests an alteration in intestinal epithelial structure. We then examined the intercellular tight junction, which is critical for intestinal barrier. Among the three major genes relevant to tight junction, cldn-1 showed a significant reduction at mRNA (P = 0.0417) (Fig. 1b) and protein (P = 0.0112) (Fig. 1c) levels. The decrement in CLDN-1 was associated with substantial increase in circulating LPS (Fig. 1d), indicating disruption of intestinal barrier. In addition, mRNA levels of intestinal Tnf-a (P < 0.0001), Ccl2 (P = 0.0056) and Il-6 (P = 0.0002) increased significantly (Fig. 1e). Level of proliferating cell nuclear antigen (PCNA) in intestinal epithelium was significantly reduced (P = 0.0127) (Fig. 1f), whereas apoptosis was markedly increased as evidenced by TUNEL staining (P = 0.008) (Fig. 1g).

Fig. 1. Maternal intermittent fasting disrupts intestinal barrier in offspring.

Fig. 1

Four-week-old female mice were fed ad libitum (M-AL group) or alternate-day intermittent fasting (M-IF group) for 12 weeks, and resumed ad libitum after mating. Six-week-old offspring of M-AL group and M-IF group were fed high fat diet (HFD) for 12 weeks. Results were expressed as mean ± SEM. *P < 0.05 vs O-AL. a Intestinal histomorphology: H&E staining of the small intestine and quantitative results of villus height, villus surface area, and crypt depth. b mRNA levels of tight junction related genes (Cldn1,Ocln and Tjp1). These genes were determined by real-time quantitative PCR and normalized to the geometric mean value of reference genes (Hprt, Rpl32 and Tbp). N = 7 and 6 for O-AL and O-IF respectively. c Protein levels of CLDN-1 in intestine. CLDN-1 was detected by Western blotting and immunohistochemical staining. The relative expression level was quantified using Image J software and normalized to β-actin. N = 3. d Plasma levels of LPS. N = 5. e mRNA levels of inflammation related genes (Tnf-a, Ccl2, Il-6, Il-17a, Tgf-b1 and Il-10), which were determined by real-time quantitative PCR and normalized to the geometric mean value of reference genes (Hprt, Rpl32 and Tbp). N = 9 and 7 for O-AL and O-IF respectively. f Levels of PCNA in intestine. The relative expression level of PCNA was quantified using Image J software. N = 3. g TUNEL staining of intestine.

Maternal intermittent fasting disrupts offspring intestinal microbiota characterized with a significant reduction in Lactobacillus_intestinalis

The intestinal mucosal barrier interacts with intestinal microbiota to maintain intestinal homeostasis. To investigate whether maternal intermittent fasting alters the intestinal microbiota of offspring, we performed 16 S rRNA sequencing to analyze the bacterial community structure in specimen of intestinal contents. The alpha diversity was significantly decreased in O-IF mice fed either NCD or HFD as indicated by Shannon index (Fig. 2a). Shown in Fig. 2b are the species with high relative abundance and their proportion at the species level in each group. Notably, relative abundance of Lactobacillus_intestinalis was decreased in O-IF mice fed either NCD or HFD (Fig. 2c). Compared to the O-AL NCD group, relative abundance of Lactobacillus_intestinalis was significantly decreased in O-AL mice fed HFD (P = 0.0126). To analyze the statistical differences in microbial communities between the O-AL and O-IF offspring, we compared OTUs with the LEfSe analysis. Species with relative abundance of taxons >104 in LDA score were shown in Fig. 2d, including g_Streptococcus, f_Streptococcaceae, g_Candidatus Arthromitus, f_unidentified Clostridiales, s_Lactobacillus_intestinalis, f_Lachnospiraceae and s_Streptococcus danieliae for the O-AL offspring and g_Methylocystis for the O-IF animals. Cladograms (Fig. 2e) generated from the LEfSe analysis showed the most differentially abundant taxons enriched in O-IF offspring fed either NCD or HFD relative to O-AL offspring. Similarly, the O-AL offspring showed a greater abundance in the family Lactobacillus. All these results suggest a significant disruption in gut microbial community structure for the O-IF offspring fed either NCD or HFD. Among these bacteria, Lactobacillus_intestinalis is the dominant phylotypes contributed to the reduction of intestinal microbiota in O-IF offspring at the species level.

Fig. 2. Maternal intermittent fasting disrupts offspring intestinal microbiota.

Fig. 2

Six-week-old offspring of M-AL group and M-IF group were fed normal chow diet (NCD) or high fat diet (HFD) for 12 weeks. Intestinal microbiota was analyzed as described in the method section. N = 9 for O-AL NCD, 8 for O-IF NCD, 8 for O-AL HFD, and 10 for O-IF HFD. a Alpha-diversity-shannon diversity index of O-AL NCD, O-IF NCD, O-AL HFD and O-IF HFD, pairwise significance determined by Wilcoxon test. b The relative abundances of species in fecal samples. c Relative abundance of Lactobacillus_intestinalis. d The most differentially abundant taxons identified by LEfSe analysis with LDA score > 4. e Cladogram of significant changes at all taxonomic levels. The radiating circle represents the classification hierarchy from class to family. The size of node represents the abundance of taxa.

Lactobacillus_intestinalis restores the intestinal barrier dysfunction in offspring of maternal intermittent fasting mice

Next, we investigated whether restoration of Lactobacillus_intestinalis (L. intestinalis) can rescue the phenotypes of intestinal barrier dysfunction in O-IF offspring fed HFD. Experimental design was shown in Fig. 3a. Administration of L. intestinalis restored the alteration in the intestinal villus evidenced by the increase of villus height (P = 0.0002) and concurrent decrease of villus surface area (P = 0.0087) in O-IF offspring (Fig. 3b). Intestinal crypt depth remained largely unaltered (Fig. 3b). Further, treatment with L. intestinalis reversed the reduction in CLDN-1 (P = 0.0273) (Fig. 3c). Also reversed were the increases of plasma LPS (P = 0.038) (Fig. 3d) and Tnf-a (P = 0.005) (Fig. 3e). Other cytokines (Fig. 3e) showed only a marginal attenuation. Thus, L. intestinalis restores the intestinal barrier dysfunction in offspring of maternal intermittent fasting mice.

Fig. 3. Lactobacillus_intestinalis restores the intestinal barrier dysfunction in offspring of maternal intermittent fasting mice.

Fig. 3

a Experimental design. Six-week-old offspring of M-AL group and M-IF group were fed HFD for 2 weeks. PBS or Lactobacillus_intestinalis suspended in PBS at a dose of 2 × 108 CFU was administered by oral gavage once a day for 10 weeks. b Intestinal histomorphology. H&E staining of the small intestine and quantitative results of villus height, villus surface area, and crypt depth. c Immunoreactivity of CLDN-1. d Plasma levels of LPS. N = 4. e mRNA levels of inflammation related genes (Tnf-a, Ccl2, Il-6 and Tgf-b1), which were determined by real-time quantitative PCR and normalized to the geometric mean value of reference genes (Hprt, Rpl32 and Tbp). Results were expressed as mean ± SEM. *P < 0.05 vs. O-AL PBS. #P < 0.05 vs. O-IF PBS. N = 4 for O-AL PBS, 3 for O-AL L. intestinalis, 5 for O-IF PBS, and 3 for O-IF L. intestinalis.

Lactobacillus_intestinalis improves the disorder of glucose and lipid metabolism in offspring of maternal intermittent fasting mice

We next examined the metabolic consequence of intestinal barrier dysfunction in O-IF offspring fed HFD. Significant impairment in glucose tolerance (Fig. 4a) and increase in circulating triglyceride (P = 0.0196) (Fig. 4b) were observed in O-IF offspring. Hepatic triglyceride content (P = 0.0456), and steatosis evidenced by H&E and oil red O staining were elevated (Fig. 4e). Fat mass and adipocyte size of perirenal white adipose tissue (rWAT), epidydimal white adipose tissue (eWAT) and subcutaneous white adipose tissue (sWAT) were increased (Fig. 4f). Administration of L. intestinalis reversed the impairment in glucose tolerance (Fig.4a) as well as increment in plasma triglyceride (Fig. 4b), lipid absorption (Fig. 4c), intestinal Cd36 (P = 0.0008) (Fig. 4d), liver steatosis measured by oil red O and H&E staining (Fig. 4e), and adiposity (Fig. 4f).

Fig. 4. Lactobacillus_intestinalis improves glucose and lipid metabolism in offspring of maternal intermittent fasting mice.

Fig. 4

Lactobacillus_intestinalis at a dose of 2 × 108 CFU/day were orally gavaged to O-AL or O-IF mice for 10 weeks. Results were expressed as mean ± SEM. Two-way ANOVA was used for comparisons between multiple groups. *P < 0.05 vs. O-AL PBS. #P < 0.05 vs. O-IF PBS. N = 5 for O-AL PBS, 4 for O-AL L. intestinalis, 5 for O-IF PBS, and 4 for O-IF L. intestinalis. a Glucose tolerance test and the area under curve. b Plasma TG levels. c Levels of circulating triglyceride in response to oral administration of olive oil. N = 4. d mRNA levels of CD36, which were determined by real-time quantitative PCR and normalized to the geometric mean value of reference genes (Hprt, Rpl32 and Tbp). e Lipid contents and steatosis in liver. f Fat mass, H&E staining and adipocyte size in rWAT, eWAT and sWAT.

Offspring of maternal intermittent fasting mice co-housed with healthy mice restores intestinal barrier dysfunction

As co-housed experiment has been demonstrated to be efficient for the transfer of intestinal microbiota, we used this approach to determine whether microbial transfer from healthy mice could rescue intestinal barrier dysfunction in maternal IF offspring fed HFD. Experimental design was outlined in Fig. 5a. After 10 weeks of co-housing, intestinal barrier was examined. O-IF co-housed with healthy mice showed a restoration in intestinal villus height (P = 0.0175) and surface area (P < 0.0001) (Fig. 5b), the decrement in cldn-1 mRNA (P = 0.0953) and protein (P < 0.0001) (Fig. 5c) and increment in Tnf-a (P = 0.0071) (Fig. 5d). On the other hand, O-AL cohoused with O-IF developed intestinal barrier dysfunction evidenced by significant change of intestinal epithelial structure and CLDN-1 immunoreactivity in O-AL cohoused relative to O-AL separated, indicating mutual transfer and of intestinal microbiota and its subsequent effect on intestinal barrier. Thus, a transferable component of the microbiota in heathy mice can rescue intestinal barrier dysfunction in maternal IF offspring.

Fig. 5. Offspring of maternal intermittent fasting mice co-housed with healthy mice restores intestinal barrier dysfunction.

Fig. 5

a Experimental design. Six-week-old offspring of M-AL group and M-IF group were fed HFD for 2 weeks, then randomly selected and co-housed for 10-weeks. Results were expressed as mean ± SEM. *P < 0.05 vs. O-AL separated. #P < 0.05 vs. O-IF separated. N = 6 for O-AL separated, 4 for O-AL cohoused, 5 for O-IF separated, and 4 for O-IF cohoused. b Intestinal histomorphology. H&E staining of the small intestine and quantitative results of villus height, villus surface area, and crypt depth. c Immunoreactivity of CLDN-1 and mRNA levels of tight junction related genes (Cldn-1 and Zo-1) determined by real-time quantitative PCR. d mRNA levels of inflammation related genes (Tnf-a, Ccl2, Il-6 and Tgf-b1), which were determined by real-time quantitative PCR and normalized to the geometric mean value of reference genes (Hprt, Rpl32 and Tbp).

Offspring of maternal intermittent fasting mice co-housed with healthy mice shows improvement in glucose and lipid metabolism

Co-housing of O-IF with healthy O-AL reversed the dysfunction in glucose and lipid metabolism (Fig. 6). Relevant to O-IF housed alone, O-IF co-housed with healthy mice showed an insignificant improvement in glucose tolerance (Fig. 6a), reduction in plasma triglyceride (P = 0.0464) (Fig. 6b), decreased lipid absorption (Fig. 6c), decrement of liver steatosis measured by oil red O and H&E staining (Fig. 6d), as well as adiposity evidenced by fat mass and adipocyte size of white adipose tissues (Fig. 6e). Meanwhile, healthy O-AL mice co-housed with O-IF demonstrated an impairment in glucose and lipid metabolism (Fig. 6).

Fig. 6. Maternal intermittent fasting offspring co-housed with healthy mice shows improvement in glucose and lipid metabolism.

Fig. 6

O-AL and O-IF mice were co-housed for 10 weeks. Results were expressed as mean ± SEM. Two-way ANOVA was used for comparisons between multiple groups. *P < 0.05 vs. O-AL separated. #P < 0.05 vs. O-IF separated. a Glucose tolerance test and the area under curve. N = 5 for O-AL separated, 4 for O-AL cohoused, 4 for O-IF separated, and 4 for O-IF cohoused. b Plasma levels of triglyceride. N = 6 for O-AL separated, 4 for O-AL cohoused, 5 for O-IF separated, and 4 for O-IF cohoused. c Plasma levels of triglyceride after oral administration of olive oil. N = 5 for O-AL separated, 4 for O-AL cohoused, 4 for O-IF separated, and 4 for O-IF cohoused. d Triglyceride contents, oil red O and H&E staining of liver. N = 6 for O-AL separated, 4 for O-AL cohoused, 5 for O-IF separated, and 4 for O-IF cohoused. e Fat mass, H&E staining and adipocyte size of rWAT, eWAT, sWAT. N = 6 for O-AL separated, 4 for O-AL cohoused, 5 for O-IF separated, and 4 for O-IF cohoused.

Discussion

With increasing attention to metabolic health, IF has become a popular lifestyle choice. However, the influence of long-term maternal IF before pregnancy on the offspring remains largely unknown. Our studies indicate that prolonged maternal IF may disrupt intestinal barrier by reducing the beneficial microbiota with metabolic consequence in adult offspring (Fig. 7b). Alternate-day fasting for 12 weeks before pregnancy reduced beneficial intestinal microbiota such as L. intestinalis, suppressed the expression of intestinal tight junction protein CLDN-1, impaired intestinal barrier evidenced by increased of circulating LPS and intestinal inflammatory molecules like TNF-a in adult offspring. The disruption in intestinal barrier was associated with a subsequent impaired glucose tolerance, increased hepatic steatosis and adiposity. Supplementation of L. intestinalis restored the intestinal barrier function and metabolic phenotypes. Cohousing the maternal IF offspring with healthy mice also rescued the impairment of intestinal barrier and disorder of glucose and lipid metabolism.

Fig. 7. Graphic highlight of findings.

Fig. 7

a An experiment scheme of maternal intermittent fasting. b Maternal intermittent fasting reduces beneficial microbiota in offspring intestine, leading to disruption of intestinal barrier function of offspring and subsequent disorders of glucose and lipid metabolism. This figure was partly generated using Servier Medical Art, provided by Servier, licensed under a Creative Commons Attribution 3.0 unported license.

Prolonged maternal intermittent fasting impairs intestinal barrier via suppression of beneficial microbiota in offspring

Our present studies demonstrate that prolonged maternal intermittent fasting before pregnancy significantly reduces the diversity of intestinal microbiota in adult offspring. Substantial reduction in beneficial bacteria such as Lactobacillus_intestinalis leads to subsequent impairment in intestinal barrier characterized by increase in plasma LPS and inflammatory cytokine, and decrement in tight junction protein. Decrease in epithelial cell proliferation and concurrent increase in apoptosis also suggest an impairment in intestinal epithelial turnover. Our study thus extends the plasticity response of intestinal homeostasis to maternal nutrition. However, it is worth of noting that we only measured a proportion of intestinal barrier functions and the interpretation of our findings should be cautioned before the complex trait of intestinal barrier function is extensively investigated. Previous studies have suggested that intestinal Lactobacillu (such as L. reuteri, L. rhamnosus, Lactobacillus crispatus and L. plantarum) is critical for the integrity of intestinal epithelial barrier by increasing cell-to-cell junctions and alleviating inflammation26,27. Lactobacillus (such as Lactobacillus crispatus and Lactobacillus iners) have been detected in the placental membranes and vagina in healthy, term pregnancies28,29, suggesting that Lactobacillus may be one of the important links between dam and offspring. In line with these findings, our studies demonstrate that restoration of Lactobacillus_intestinalis or co-housing with healthy mice rescue the defect in intestinal barrier of maternal IF offspring. We thus propose that maternal intermittent fasting primes the offspring for the reduction in beneficial gut microbiota. Whether this is attributed to the decrement in the intergenerational transmission of Lactobacillus or adverse environment unfavorable for the growth of the beneficial bacteria remains unknown. Indeed, maternal nutrition or inflammation exposure during pregnancy have been reported to impact microbial transmission from mother to infant, leading to long-term consequences30,31. Further, previous studies have indicated that microbiota can inhabit the intrauterine environment. Bacteria has been detected in fetal membranes32, umbilical cord blood33, amniotic fluid34 and placenta35, suggesting that the establishment of the offspring microflora may initiate at the embryonic stage. In contrast to this concept, a series of studies has suggested that the utero is germ free36,37. In addition, previous studies in both mice and human have suggested that intermittent fasting have altered the mother’s gut microbiota, leading to significant increase in Lactobacillus38,39. Our data reveals a significant reduction of Lactobacillus in offspring of IF dams. These observations do not support the concept that offspring inherits the gut microbiota colonies directly from the mother. Rather, maternal intermittent fasting may alter the offspring gut microbiota through a mechanism yet to be defined. Further well-designed animal and human studies are thus required to define the key maternal molecules signaling for reduction of beneficial intestinal microbiota in offspring.

Metabolic consequence of intestinal microbiota dysbiosis induced by long-term maternal intermittent fasting in offspring

The homeostasis of intestinal microbiota is crucial for the host health40. Our studies further support the concept that prolonged maternal intermittent fasting may induce intestinal microbiota dysbiosis in offspring with metabolic consequence. Unexpectedly, long-term maternal intermittent fasting reduces the beneficial intestinal bacteria with Lactobacillus_intestinalis as the dominant phylotypes. Restoration of Lactobacillus_intestinalis rescues the metabolic phenotypes in the offspring. Glucose tolerance, adiposity and liver steatosis are all reduced. These observations suggest that reduction in beneficial bacteria such as Lactobacillus_intestinalis may contribute to the metabolic consequence of prolonged maternal intermittent fasting on the offspring. Consistently, the abundance of L. intestinalis has been reported to be negatively correlated with obesity and fat mass41,42. The beneficial metabolic effect of long-term treatment with Lactobacillus has been observed in both rats43,44 and humans45,46.

In summary, our study demonstrates that maternal intermittent fasting disrupts intestinal barrier leading to disorder of glucose and lipid metabolism. These effects occur through microbiota dysbiosis characterized by significant reduction in beneficial bacteria such as Lactobacillus_intestinalis. Our observations further support the concept that intestinal microbiota in offspring is vulnerable to maternal nutrition, and its homeostasis is critical for the integrity of intestinal barrier and metabolic homeostasis.

Methods

Animals and treatment

All experiments were conducted in strict accordance with the Guide for the Care and Use of Laboratory Animals prepared by the National Academy of Sciences (NIH publication 86–23, revised 1985). Experimental protocols were approved by the Peking University Health Science Center. Four-week-old C57BL/6 J female mice (n = 10) and male mice (used for the mating, n = 10) were purchased from the Department of Laboratory Animal Science at Peking university Health Science Center. Animals were housed in the SPF-level environment with a standard environment (22 ± 2 °C, humidity at 50 ± 15%) with 12 h light and 12 h dark cycle. Food and water were freely accessible except for the fasting experiment. At the end of the experiment, following tissue samples were harvested from offspring: plasma, intestine and its digesta, liver, retroperitoneal white adipose tissue (rWAT), epididymal white adipose tissue (eWAT) or parametrial white adipose tissue (pWAT), and subcutaneous white adipose tissue (sWAT).

Alternate-day maternal intermittent fasting protocol: 4-week-old female mice were subject to fasting every other day for 12 weeks, then these 16-week-old female mice were mated, and normal feeding resumed (M-IF group). Control female mice were fed ad libitum (M-AL group) (Fig. 7a).

Offspring feeding: 6-week-old male offspring of M-AL group (O-AL) and M-IF group (O-IF) were fed high fat diet (HFD, 60% fat, D12492; Research Diets) or normal chow diet (NCD, D12450H; Research Diets) for 12 weeks.

Lactobacillus_intestinalis treatment: After fed HFD for 2 weeks, O-AL and O-IF male mice were daily gavaged with 200 μL of freshly prepared suspension of Lactobacillus_intestinalis at a dose of 2 × 108 CFU or PBS for 10 weeks (Fig. 3a).

Co-housing experiment: to allow for efficient transfer of microbes between O-AL and O-IF mice, O-Al and O-IF male mice were fed HFD for 2 weeks, then randomly co-housed for 10 weeks (Fig. 5a).

Detection of LPS

LPS in serum was measured using the Tachypleus Amebocyte Lysate (TAL) assay as previously described47.

AimPlex multiple immunoassays

Intestinal cytokines were assayed in an AimPlex Platform employing mouse Th1/Th2/Th17 18-plex kit (C281118, Beijing QuantoBio Biotechnology Co., Ltd., Beijing, China) following the manufacturer’s instructions. Results were normalized by total protein in the intestinal tissue extract.

Culture of Lactobacillus_intestinalis

Lactobacillus_intestinalis (ATCC49335) purchased from American Type Culture Collection (ATCC) were cultured in De Man, Rogosa and Sharpe (MRS) broth for 12 h at 37 °C in 5% CO2, then centrifuged at 1000 × g for 10 min at 20 °C, washed with PBS, and re-suspended in PBS at the concentration of 109 CFU/ml.

Gut microbiota analysis by 16 S rRNA gene sequencing

Total genome DNA from samples harvested from ileum contents was extracted using CTAB/SDS method. Following 16 s rRNA V3-V4 region amplification, PCR products quantification and qualification, DNA library was constructed using the TruSeq® DNA PCR-Free Sample Preparation Kit. Sequencing libraries were generated using TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, USA) following manufacturer’s recommendations and index codes were added. The library quality was assessed on the Qubit@ 2.0 Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 system. After the library qualified by Qubit and Q-PCR, NovaSeq6000 was used for sequencing and 250 bp paired-end reads were generated. Sequences with ≥97% similarity were assigned to the same OTUs. Shannon index was applied in analyzing complexity of species diversity, calculated with QIIME (Version 1.7.0) and displayed with R software (Version 2.15.3). LEfSe analysis LDA score >4 was shown.

Oral glucose tolerance tests (OGTT) and insulin tolerance test (ITT)

OGTT

Mice fasted for 16 h were orally gavaged with glucose at a dose of 3 g/kg body weight. Blood was collected from the incision at the tip of the tail at 0, 15, 30, 60, 90, and 120 min after glucose administration, and the glucose concentration was immediately measured.

ITT

Mice were fasted for 6 h before intraperitoneal insulin administration at a dose of 0.75U/kg body weight. Blood was collected from the incision at the tip of the tail at 0, 15, 30, 60, 90, and 120 min after glucose administration, and the glucose concentration was immediately measured.

Oral lipid tolerance test (OLTT)

Mice fasted for 16 h were orally gavaged with olive oil (200 μL). Blood was collected from inner canthus at 0, 1, 2, 4, and 8 h after olive oil administration, and serum triglyceride were measured by colorimetry.

OGTT, ITT and OLTT tests were performed on the same mice. Ad libitum diets were resumed immediately after each test. Mice were allowed to recover for 5 days before next test.

Tissue sample preparation, H&E, immunohistochemistry (IHC) and TUNEL staining

The dissected tissues were fixed with 4% paraformaldehyde in PBS for 24 h at 4 °C and stored in 20% sucrose phosphate buffer. Samples were embedded in paraffin and sectioned at a 3 μm thickness. Intestine 5–10 cm distal to the pyloric sphincter was used for IHC and H&E staining. IHC and H&E were performed following general protocols. For IHC staining, each group contains three mice, three segments of intestine were selected and the immunoreactivity of CLDN-1 was quantified using Image J software. Anti-CLDN-1 was obtained from Abcam (Cambridge, MA). For H&E staining, each group contains 3-4 mice. Ten crypts or villus were randomly selected from each slide and analyzed using Image J software. TUNEL staining was performed according to the manufacturer’s instructions (C1098, Beyotime, China).

Oil red O staining and quantification

Samples were embedded in OTC and frozen sections at 8 to10μm prepared. After gently washing with PBS, sections were fixed with 4% paraformaldehyde for 10 mins, then stained with freshly prepared Oil Red O working solution for 60 mins. After rinsing with distilled water, nuclei were counterstained with haematoxylin. Sections were rinsed with water and sealed with 90% glycerin. Quantitative analysis was performed by Image J software.

Western blot and quantitative RT-PCR

Intestinal protein was quantitated and loaded (25 µg protein/lane) onto an SDS-PAGE gel and transferred to a PVDF membrane. Membrane was blocked with 5% nonfat dry milk in TBST at room temperature for 1 h, then incubated with the primary antibody overnight at 4 °C. Anti-PCNA was obtained from ABclonal (Wuhan, China). Anti-β-actin was purchased from Cell Signaling Technology (Beverly, MA). IRDye-labeled secondary antibodies were used to detect specific reactions and visualized with the Odyssey infrared imaging system.

Intestinal RNA was isolated from tissues using Trizol, followed by reverse transcription. Quantitative real-time PCR was performed using SYBR green in Agilent AriaMx real-time PCR system. Table 1 shows the primer sequences involved in this study.

Table 1.

Primers for quantitative RT-PCR.

Genes Upstream primer (5′-3′) Downstream primer (5′-3′)
Cldn-1 CTGGAAGATGATGAGGTGCAGAAG CCACTAATGTCGCCAGACCTGAA
Ocln TGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG
Tjp GCTTGCTGACCTACCCTGTG CACTGCCAGACTGAGCTGAAT
Zo-1 GAGGCTTCAGAACGAGGCTATT CATGTCGGAGAGTAGAGGTTCGA
Tnf-a CCAGACCCTCACACTCAGATC CACTTGGTGGTTTGCTACGAC
Ccl2 TAAAAACCTGGATCGGAACCAAA GCATTAGCTTCAGATTTACGGGT
Il-6 CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG
Il-17a CCTCAGACTACCTCAACCG CTCCCTCTTCAGGACCAG
Tgf-b1 CTTCAATACGTCAGACATTCGGG GTAACGCCAGGAATTGTTGCTA
Il-10 CTTACTGACTGGCATGAGGATCA GCAGCTCTAGGAGCATGTGG
Cd36 AGATGACGTGGCAAAGAACAG CCTTGGCTAGATAACGAACTCTG
Hprt TCAGTCAACGGGGGACATAAA GGGGCTGTACTGCTTAACCAG
Rpl32 GAGCAACAAGAAAACCAAGCA TGCACACAAGCCATCTACTCA
Tbp ACCTTATGCTCAGGGCTTGG GCCGTAAGGCATCATTGGAC

Statistics and reproducibility

Animal experiments were independently repeated at least two times with consistent results. Using Prism software for graphing and statistical analysis, the experimental results were shown as mean ± SEM. Statistical significance of differences between the groups was analyzed with a t-test or one/two-way ANOVA, followed by Tukey multiple post hoc analysis. P < 0.05 denotes statistical significance.

Supplementary information

Peer Review File (599KB, pdf)
Supplement (1.2MB, pdf)
42003_2022_4380_MOESM3_ESM.pdf (86.5KB, pdf)

Description of Additional Supplementary Files

Supplementary Data 1 (109.5KB, xlsx)
reporting-summary (1.5MB, pdf)

Acknowledgements

This study was supported by National Natural Science Foundation of China (81730020, 81930015, 82070592 and 82270610).

Author contributions

Y.L.: data acquisition, manuscript drafting; W.Y. and C.L.: animal breeding and data acquisition; Y.Y. and W.Z.: experiment design, manuscript revision, funding support; L.S., T.F., and Y.Z.: technical and reagents support. All other authors edited and approved the final manuscript.

Peer review

Peer review information

Communications Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editors: Anam Akhtar and Christina Karlsson Rosenthal. Peer reviewer reports are available.

Data availability

The source data behind the graphs in the paper can be found in Supplementary Data 1. Raw sequences have been deposited on NCBI public repository (Bioproject # PRJNA774493).

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Yuan Liang, Wenzhen Yin, Chao Luo.

Contributor Information

Yue Yin, Email: yueyin@bjmu.edu.cn.

Weizhen Zhang, Email: weizhenzhang@bjmu.edu.cn.

Supplementary information

The online version contains supplementary material available at 10.1038/s42003-022-04380-y.

References

  • 1.Patterson RE, Sears DD. Metabolic effects of intermittent fasting. Annu. Rev. Nutr. 2017;37:371–393. doi: 10.1146/annurev-nutr-071816-064634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Longo VD, Panda S. Fasting, circadian rhythms, and time-restricted feeding in healthy lifespan. Cell Metab. 2016;23:1048–1059. doi: 10.1016/j.cmet.2016.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hoddy KK, Marlatt KL, Cetinkaya H, Ravussin E. Intermittent fasting and metabolic health: from religious fast to time-restricted feeding. Obes. (Silver Spring). 2020;28:S29–S37. doi: 10.1002/oby.22829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mitchell SJ, et al. Daily fasting improves health and survival in male mice independent of diet composition and calories. Cell Metab. 2019;29:221–228. doi: 10.1016/j.cmet.2018.08.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kim KH, et al. Intermittent fasting promotes adipose thermogenesis and metabolic homeostasis via VEGF-mediated alternative activation of macrophage. Cell Res. 2017;27:1309–1326. doi: 10.1038/cr.2017.126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Joslin P, Bell RK, Swoap SJ. Obese mice on a high-fat alternate-day fasting regimen lose weight and improve glucose tolerance. J. Anim. Physiol. Anim. Nutr. 2017;101:1036–1045. doi: 10.1111/jpn.12546. [DOI] [PubMed] [Google Scholar]
  • 7.Dominguez-Perles R, Gil-Izquierdo A, Ferreres F, Medina S. Update on oxidative stress and inflammation in pregnant women, unborn children (nasciturus), and newborns—Nutritional and dietary effects. Free Radic. Biol. Med. 2019;142:38–51. doi: 10.1016/j.freeradbiomed.2019.03.013. [DOI] [PubMed] [Google Scholar]
  • 8.Cetin I, Mando C, Calabrese S. Maternal predictors of intrauterine growth restriction. Curr. Opin. Clin. Nutr. Metab. Care. 2013;16:310–319. doi: 10.1097/MCO.0b013e32835e8d9c. [DOI] [PubMed] [Google Scholar]
  • 9.Koletzko B, Symonds ME, Olsen SF. Programming research: where are we and where do we go from here? Am. J. Clin. Nutr. 2011;94:2036S–2043S. doi: 10.3945/ajcn.111.018903. [DOI] [PubMed] [Google Scholar]
  • 10.Kusin JA, Kardjati S, Houtkooper JM, Renqvist UH. Energy supplementation during pregnancy and postnatal growth. Lancet. 1992;340:623–626. doi: 10.1016/0140-6736(92)92168-F. [DOI] [PubMed] [Google Scholar]
  • 11.Wang C, et al. A randomized clinical trial of exercise during pregnancy to prevent gestational diabetes mellitus and improve pregnancy outcome in overweight and obese pregnant women. Am. J. Obstet. Gynecol. 2017;216:340–351. doi: 10.1016/j.ajog.2017.01.037. [DOI] [PubMed] [Google Scholar]
  • 12.van Ewijk R. Long-term health effects on the next generation of Ramadan fasting during pregnancy. J. Health Econ. 2011;30:1246–1260. doi: 10.1016/j.jhealeco.2011.07.014. [DOI] [PubMed] [Google Scholar]
  • 13.van Ewijk RJ, Painter RC, Roseboom TJ. Associations of prenatal exposure to Ramadan with small stature and thinness in adulthood: results from a large Indonesian population-based study. Am. J. Epidemiol. 2013;177:729–736. doi: 10.1093/aje/kwt023. [DOI] [PubMed] [Google Scholar]
  • 14.Zheng, J. et al. Maternal low-protein diet modulates glucose metabolism and hepatic microRNAs expression in the early life of offspring dagger. Nutrients. 9, 205 (2017). [DOI] [PMC free article] [PubMed]
  • 15.Devaskar SU, Chu A. Intrauterine growth restriction: hungry for an answer. Physiol. (Bethesda). 2016;31:131–146. doi: 10.1152/physiol.00033.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Forgie AJ, et al. The impact of maternal and early life malnutrition on health: a diet-microbe perspective. Bmc Med. 2020;18:135. doi: 10.1186/s12916-020-01584-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Srugo, S. A., Bloise, E., Nguyen, T. & Connor, K. L. Impact of maternal malnutrition on gut barrier defense: implications for pregnancy health and fetal development. Nutrients. 11, 1375 (2019). [DOI] [PMC free article] [PubMed]
  • 18.Indrio F, et al. Epigenetic matters: the link between early nutrition, microbiome, and long-term health development. Front Pediatr. 2017;5:178. doi: 10.3389/fped.2017.00178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wang J, et al. Intrauterine growth restriction affects the proteomes of the small intestine, liver, and skeletal muscle in newborn pigs. J. Nutr. 2008;138:60–66. doi: 10.1093/jn/138.1.60. [DOI] [PubMed] [Google Scholar]
  • 20.Meyer AM, Caton JS. Role of the small intestine in developmental programming: impact of maternal nutrition on the dam and offspring. Adv. Nutr. 2016;7:169–178. doi: 10.3945/an.115.010405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ganal-Vonarburg SC, Fuhrer T, Gomez DAM. Maternal microbiota and antibodies as advocates of neonatal health. Gut Microbes. 2017;8:479–485. doi: 10.1080/19490976.2017.1299847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mueller NT, Bakacs E, Combellick J, Grigoryan Z, Dominguez-Bello MG. The infant microbiome development: mom matters. Trends Mol. Med. 2015;21:109–117. doi: 10.1016/j.molmed.2014.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chu DM, et al. The early infant gut microbiome varies in association with a maternal high-fat diet. Genome Med. 2016;8:77. doi: 10.1186/s13073-016-0330-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chu DM, Meyer KM, Prince AL, Aagaard KM. Impact of maternal nutrition in pregnancy and lactation on offspring gut microbial composition and function. Gut Microbes. 2016;7:459–470. doi: 10.1080/19490976.2016.1241357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Selma-Royo M, et al. Maternal diet during pregnancy and intestinal markers are associated with early gut microbiota. Eur. J. Nutr. 2021;60:1429–1442. doi: 10.1007/s00394-020-02337-7. [DOI] [PubMed] [Google Scholar]
  • 26.Ghosh S, Whitley CS, Haribabu B, Jala VR. Regulation of intestinal barrier function by microbial metabolites. Cell Mol. Gastroenterol. Hepatol. 2021;11:1463–1482. doi: 10.1016/j.jcmgh.2021.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Cristofori F, et al. Anti-Inflammatory and immunomodulatory effects of probiotics in gut inflammation: a door to the body. Front Immunol. 2021;12:578386. doi: 10.3389/fimmu.2021.578386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lannon S, et al. Parallel detection of lactobacillus and bacterial vaginosis-associated bacterial DNA in the chorioamnion and vagina of pregnant women at term. J. Matern Fetal Neonatal Med. 2019;32:2702–2710. doi: 10.1080/14767058.2018.1446208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Pelzer E, Gomez-Arango LF, Barrett HL, Nitert MD. Review: Maternal health and the placental microbiome. Placenta. 2017;54:30–37. doi: 10.1016/j.placenta.2016.12.003. [DOI] [PubMed] [Google Scholar]
  • 30.Ma J, et al. High-fat maternal diet during pregnancy persistently alters the offspring microbiome in a primate model. Nat. Commun. 2014;5:3889. doi: 10.1038/ncomms4889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Segain JP, et al. Butyrate inhibits inflammatory responses through NFkappaB inhibition: implications for Crohn’s disease. Gut. 2000;47:397–403. doi: 10.1136/gut.47.3.397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Pettker CM, et al. Value of placental microbial evaluation in diagnosing intra-amniotic infection. Obstet. Gynecol. 2007;109:739–749. doi: 10.1097/01.AOG.0000255663.47512.23. [DOI] [PubMed] [Google Scholar]
  • 33.Jimenez E, et al. Isolation of commensal bacteria from umbilical cord blood of healthy neonates born by cesarean section. Curr. Microbiol. 2005;51:270–274. doi: 10.1007/s00284-005-0020-3. [DOI] [PubMed] [Google Scholar]
  • 34.DiGiulio DB, et al. Prevalence and diversity of microbes in the amniotic fluid, the fetal inflammatory response, and pregnancy outcome in women with preterm pre-labor rupture of membranes. Am. J. Reprod. Immunol. 2010;64:38–57. doi: 10.1111/j.1600-0897.2010.00830.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Collado MC, Rautava S, Aakko J, Isolauri E, Salminen S. Human gut colonisation may be initiated in utero by distinct microbial communities in the placenta and amniotic fluid. Sci. Rep. 2016;6:23129. doi: 10.1038/srep23129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kennedy KM, et al. Fetal meconium does not have a detectable microbiota before birth. Nat. Microbiol. 2021;6:865–873. doi: 10.1038/s41564-021-00904-0. [DOI] [PubMed] [Google Scholar]
  • 37.Leiby JS, et al. Lack of detection of a human placenta microbiome in samples from preterm and term deliveries. Microbiome. 2018;6:196. doi: 10.1186/s40168-018-0575-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Rinninella, E. et al. Gut microbiota during dietary restrictions: new insights in non-communicable diseases. Microorganisms. 8, 1140 (2020). [DOI] [PMC free article] [PubMed]
  • 39.Cignarella F, et al. Intermittent fasting confers protection in CNS autoimmunity by altering the gut microbiota. Cell Metab. 2018;27:1222–1235. doi: 10.1016/j.cmet.2018.05.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Nicholson JK, et al. Host-gut microbiota metabolic interactions. Science. 2012;336:1262–1267. doi: 10.1126/science.1223813. [DOI] [PubMed] [Google Scholar]
  • 41.Lecomte V, et al. Changes in gut microbiota in rats fed a high fat diet correlate with obesity-associated metabolic parameters. Plos One. 2015;10:e126931. doi: 10.1371/journal.pone.0126931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Park JM, Shin Y, Kim SH, Jin M, Choi JJ. Dietary epigallocatechin-3-gallate alters the gut microbiota of obese diabetic db/db mice: lactobacillus is a putative target. J. Med. Food. 2020;23:1033–1042. doi: 10.1089/jmf.2020.4700. [DOI] [PubMed] [Google Scholar]
  • 43.Tanida M, et al. High-fat diet-induced obesity is attenuated by probiotic strain Lactobacillus paracasei ST11 (NCC2461) in rats. Obes. Res. Clin. Pract. 2008;2:I–II. doi: 10.1016/j.orcp.2008.04.003. [DOI] [PubMed] [Google Scholar]
  • 44.Mazloom, K., Siddiqi, I. & Covasa, M. Probiotics: How effective are they in the fight against obesity? Nutrients. 11, 258 (2019). [DOI] [PMC free article] [PubMed]
  • 45.Kadooka Y, et al. Regulation of abdominal adiposity by probiotics (Lactobacillus gasseri SBT2055) in adults with obese tendencies in a randomized controlled trial. Eur. J. Clin. Nutr. 2010;64:636–643. doi: 10.1038/ejcn.2010.19. [DOI] [PubMed] [Google Scholar]
  • 46.Salles B, Cioffi D, Ferreira S. Probiotics supplementation and insulin resistance: a systematic review. Diabetol. Metab. Syndr. 2020;12:98. doi: 10.1186/s13098-020-00603-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yin Y, et al. Ghrelin ameliorates nonalcoholic steatohepatitis induced by chronic low-grade inflammation via blockade of Kupffer cell M1 polarization. J. Cell. Physiol. 2021;236:5121–5133. doi: 10.1002/jcp.30218. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Peer Review File (599KB, pdf)
Supplement (1.2MB, pdf)
42003_2022_4380_MOESM3_ESM.pdf (86.5KB, pdf)

Description of Additional Supplementary Files

Supplementary Data 1 (109.5KB, xlsx)
reporting-summary (1.5MB, pdf)

Data Availability Statement

The source data behind the graphs in the paper can be found in Supplementary Data 1. Raw sequences have been deposited on NCBI public repository (Bioproject # PRJNA774493).


Articles from Communications Biology are provided here courtesy of Nature Publishing Group

RESOURCES