Skip to main content
ZooKeys logoLink to ZooKeys
. 2022 Oct 20;1125:69–86. doi: 10.3897/zookeys.1125.85741

Chimena gen. nov., a new spider genus (Araneae, Mysmenidae) from China, with descriptions of two new species and a new combination

Yucheng Lin 1,, Shuqiang Li 2,
PMCID: PMC9836549  PMID: 36761288

Abstract

A new mysmenid genus, Chimenagen. nov., is reported from China. Two new species: C.qiongsp. nov. (Hainan, ♂♀, the type species) and C.nantousp. nov. (Taiwan, ♀) are illustrated and described in detail. A new combination is suggested: Chimenataiwanica (Ono, 2007) comb. nov. (Taiwan, ♂♀, transferred from Mysmena Simon, 1894). The molecular phylogeny and morphological characters were used to discuss the taxonomy and circumscription of the newly erected genus.

Keywords: Diagnosis, Hainan, mysmenids, new genus, symphytognathoids, Taiwan, taxonomy

Introduction

The spider family Mysmenidae Petrunkevitch, 1928 includes 158 extant species in 14 genera (WSC 2022), making it the second most species-rich spider family of the symphytognathoids. Known species of Mysmenidae are recorded mainly in Asia and South America (Brescovit and Lopardo 2008; Lin and Li 2008, 2013, 2014, 2016; Miller et al. 2009; Feng et al. 2019; Li and Lin 2019; Dupérré and Tapia 2020). Lopardo et al. (2011) suggested that this family is distributed worldwide, and its diversity is grossly underestimated due to their small size and cryptic lifestyle.

In Asia, nearly 50 species of nine genera have been recorded. Simon (1895a, b) first reported three species from Sri Lanka and the Philippines. Baert (1988) described three species from Sulawesi, Indonesia. The Vietnamese mysmenids were first reported by Lin and Li (2014), and three species were recorded. Nearly 40 species from South China have been described in the past 20 years, more than half of them from Yunnan Province (Lin and Li 2008, 2013; Miller et al. 2009). However, the extraordinary species diversity of Mysmenidae in China and surrounding areas needs to be further investigated.

The aim of this paper is to expand the knowledge about the species diversity of Chinese mysmenid spiders by describing a new genus and two new species and proposing one new combination.

Materials and methods

Material

The mysmenid specimens in this study were collected in Taiwan and Hainan, China, between June 2011 and July 2013. All the specimens were collected by sifting leaf litter or by hand and stored in 95% ethanol at –20 °C.

Molecular data

We selected seven specimens from two new species and used the prosoma and all of the legs to extract genomic DNA to amplify COI, H3, 16S, 18S, and 28S. DNA was extracted with the TIANamp Micro DNA Kit (TIANGEN) following the manufacturer’s protocol for animal tissues. The five gene fragments were amplified in 25μL reactions. Primer pairs and PCR protocols are given in Table 1. Raw sequences were edited and assembled using BioEdit v.7.2.5 (Hall 1999). New sequences from this study were deposited in GenBank, and the accession numbers are reported in Table 2. All molecular vouchers and material are stored in the Natural History Museum of Sichuan University in Chengdu (NHMSU), China.

Table 1.

The loci, primer pairs, and PCR protocols used in this study.

Locus Annealing temperature/time Direction Primer Sequence 5’→3’ Reference
16S 46.45°/30s F 16sb2_12864 CTCCGGTTTGAACTCAGATCA Hormiga et al. 2003
R LR-J-13360 GTAAGGCCTGCTCAATGA Feng et al. 2019
47°/30s F 16S-A CGCCTGTTTATCAAAAACAT Palumbi et al. 1991
R 16S-B CTCCGGTTTGAACTCAGATCA
18S 52.1°/30s F 18s_1F TACCTGGTTGATCCTGCCAGTAG Giribet et al. 1996
R 18s_1000R GTGGTGCCCTTCCGTCAATT Balczun et al. 2005
28SD2 54.9°/30s F 28sa GACCCGTCTTGAAACACGGA Rix et al. 2008
R LSUR GCTACTACCACCAAGATCTGCA
COI 48.95°/30s F LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
R HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
46°/30s F LCO1490 GGTCAACAAATCATAAAGATATTGG Simon et al. 1994
R COI-Nancy CCCGGTAAAATTAAAATATAAACTTC
H3 48°/30s F H3af ATGGCTCGTACCAAGCAGACVGC Colgan et al. 1998
R H3ar ATATCCTTRGGCATRATRGTGAC
50°/30s F H3nf ATGGCTCGTACCAAGCAGAC
R H3nr ATRTCCTTGGGCATGATTGTTAC

Table 2.

GenBank accession numbers for newly generated DNA sequences.

We analysed data from 50 species of symphytognathoids including members of the families Theridiosomatidae Simon, 1881, Mysmenidae, Anapidae Simon, 1895, and Symphytognathidae Hickman, 1931. We used the MAFFT v.7.450 online server (https://mafft.cbrc.jp/alignment/server/) with default parameters to align the sequences of Chimena and Chanea species involved in this study. All sequences were concatenated in SequenceMatrix v.1.7.8 (Vaidya et al. 2011). PartitionFinder2 (Lanfear et al. 2017) was used to identify the best-fit models of molecular evolution for each locus. GTR+I+G was selected for COI, H3, 18S, and 28S, and GTR+G was selected for 16S.

We analysed the data using both maximum parsimony (MP) and Bayesian Inference (BI). The MP tree was constructed using MEGA X (Kumar et al. 2018) with TBR (Tree-Bisection-Reconnection) branch swapping and 2000 bootstrap replicates with all other parameters set to default. BI was performed using MrBayes v.3.2.7 (Ronquist et al. 2012) on the Cipres Science Gateway (Miller et al. 2010), with four Markov Chains (MCMCs) with default heating parameters for 50,000,000 generations until the average standard deviation of split frequencies was less than 0.01. The Markov chains were sampled every 1000 generations, and the first 25% of sampled trees were burn-in.

Morphological data

Specimens were examined and measured under a Leica M205 C stereomicroscope. Further details were examined using an Olympus BX51 compound microscope. Male palps and epigynes were examined and photographed after dissection. They were treated in lactic acid for several minutes, and subsequently embedded in Hoyer’s Solution before photographing. Photos were made with a Canon EOS 60D wide zoom digital camera (8.5 megapixels) mounted on the Olympus BX51 compound microscope. Images were combined using Helicon Focus v.3.10 software (Khmelik et al. 2006). All measurements are in millimetres. Leg measurements are given as follows: total length (femur, patella, tibia, metatarsus, and tarsus). Abbreviations of institutions and morphological terminology are given in Table 3. References to figures in cited papers are listed in lowercase (fig. or figs), and figures in this paper are noted with an initial capital (Fig. or Figs).

Table 3.

List of abbreviations used in the text or figures.

Morphological terminologies
AER anterior eye row FD fertilization ducts
ALE anterior lateral eyes MN male metatarsal nodule at distal-prolaterally
AME anterior median eyes MS male metatarsal clasping spine
BH basal haematodocha PC paracymbium
CD copulatory ducts PER posterior eye row
CS cheliceral spines rooted at base PLE posterior lateral eyes
CyC cymbial conductor PME posterior median eyes
CyF cymbial fold S spermathecae
CyFs setae on cymbial fold SD spermatic duct
CyP1 process on cymbial conductor SP scape
CyP2 process on paracymbium St subtegulum
E embolus Ti palpal tibia
Institutions
FRIT Forestry Research Institute of Taipei, Taipei, China
IZCAS Institute of Zoology, Chinese Academy of Sciences, Beijing, China
NSMT Department of Zoology, National Science Museum, Tokyo, Japan
NHMSU Natural History Museum of Sichuan University, Chengdu, China

Results

Phylogenetic analysis

The topologies from both the MP and BI analyses (Figs 1, 2) showed mysmenids and theridiosomatids were highly supported as monophyletic in both analyses, although the position of theridiosomatids was not consistent between analyses. Symphytognathidae was rendered polyphyletic by three anapid species. The monophyly of Anapidae is not strongly supported and is rendered paraphyletic due to the placement of the theridiid Steatodaborealis (Hentz, 1850). In the BI tree anapids are divided into two highly supported clades that we refer to as “Anapidae 1” and “Anapidae 2” (Fig. 2), but Anapidae 2 is rendered polyphyletic by the theridiid Steatodaborealis and the linyphiid Linyphiatriangularis (Clerck, 1757).

Figure 1.

Figure 1.

Tree topology obtained by maximum likelihood. Numbers at nodes are bootstrap values. Тhe clade of Chimena gen. nov. (yellow) + Chanea is nested within Mysmenidae (blue). Further clades are Symphytognathidae (green), Anapidae (pink) and Theridiosomatidae (orange).

Figure 2.

Figure 2.

Bayesian inference tree. Numbers at nodes posterior probabilities. The monophyly of Mysmenidae (blue), Theridiosomatidae (orange), and Chimena gen. nov. (yellow) are highly supported. Note the paraphyly of Anapidae (pink) and placement of Steatoda_borealis and Linyphia_triangularis within “Anapidae 2”; three anapid species (red star) are nested within Symphytognathidae (green).

Taxonomy

Mysmenidae Petrunkevitch, 1928

. Chimena gen. nov.

7DC578FA-3E86-5796-8B3B-CDD4387AE989

https://zoobank.org/76A8EC9A-6199-4D97-810E-966B5C675A56

Type species.

Chimenaqiong sp. nov.

Etymology.

The generic name is a combination of the first three letters of China and the latter half of Mysmena. The gender is feminine.

Diagnosis.

Chimena gen. nov. differs from other mysmenid genera by the presence of strong spines on the chelicerae of males (as in some Chinese species of Gaoligonga Miller, Griswold & Yin, 2009 and Mysmena Miller, Griswold & Yin, 2009; see fig. 38A in Miller et al. 2009, fig. 8C in Lin and Li 2014, and figs 5E, 6A, 7E in Lin and Li 2008); a very long embolus spiralling around the bulb at least 5 times; and the spermathecae near the posterior margin of the epigyne; the copulatory ducts are highly coiled and extend anteriorly. Chimena gen. nov. is morphologically similar to Chanea Miller, Griswold & Yin, 2009 in having an extremely coiled embolus (cf. Figs 3A, 5A; figs 49A–B, 51A–B in Miller et al. 2009; figs 3A in Lin and Li 2016) and a membranous, translucent, wrinkled scape (Figs 4J, 6J, 7F; fig. 4D in Lin and Li 2016). Males can be distinguished by the presence of a cymbial process (CyP1, CyP2), which is absent in Chanea (Figs 3D, 3F, 5B, 5G vs. 49A, 49B in Miller et al. 2009 and figs 2C, 3C in Lin and Li 2016). Females differ by having the spiral rod-shaped spermathecae close to the posterior margin of the epigyne, versus globular spermathecae located anteriorly in Chanea, as well as the copulatory ducts not being entwined with the fertilization ducts [intertwined in Chanea (Figs 4I, J, 6I, J, 7E–F vs. fig. 49C in Miller et al. 2009 and fig. 4C–D in Lin and Li 2016)].

Figure 3.

Figure 3.

Chimenaqiong sp. nov., male A left palpal bulb, retrolateral B palpal bulb, prolateral C distal segments of right leg I, prolateral D cymbium, apical E cymbium, retrolateral F left palp, retrolateral G left palp, prolateral. Abbreviations: BH basal haematodocha; CyC cymbial conductor; CyF cymbial fold; CyFs setae on cymbial fold; CyP1 process on cymbial conductor; CyP2 process on paracymbium; PC paracymbium; E embolus; MN male metatarsal nodule at distal-prolaterally; MS male metatarsal clasping spine; SD spermatic duct; St subtegulum; Ti palpal tibia. Scale bars: 0.10 mm.

Figure 5.

Figure 5.

Chimenataiwanica (Ono, 2007) comb. nov., male A left palpal bulb, retrolateral B cymbium, apical C cymbium, dorsal-retrolateral D left palp, apical E left palp, ventral F left palp, dorsal G left palp, retrolateral H left palp, retrolateral. Abbreviations: Cy cymbium; CyC cymbial conductor; CyF cymbial fold; CyFs setae on cymbial fold; CT cymbial tooth; CyP2 process on paracymbium; PC paracymbium; E embolus; SD spermatic duct; St subtegulum; T tegulum; Ti palpal tibia. Scale bars: 0.10 mm.

Figure 4.

Figure 4.

Chimenaqiong sp. nov., male (A, B, E, F) and female (C, D, G–J) A, C habitus, dorsal B, D habitus, ventral E prosoma, front-lateral, F, G habitus, lateral H epigyne, ventral I vulva, ventral J vulva, dorsal. Abbreviations: CD copulatory ducts; CS cheliceral spines rooted at base; FD fertilization ducts; MN male metatarsal nodule at distal-prolaterally; MS male metatarsal clasping spine; S spermathecae; SP scape. Scale bars: 0.50 mm (A–D, F, G); 0.20 mm (E); 0.10 mm (H–J).

Figure 6.

Figure 6.

Chimenataiwanica (Ono, 2007) comb. nov., male (A, B, E, F) and female (C, D, G–J) A, C habitus, dorsal B, D habitus, ventral E prosoma, front-lateral F, G habitus, lateral H epigyne, ventral I vulva, ventral J vulva, dorsal. Abbreviations: CD copulatory ducts; CS cheliceral spines rooted at base; FD fertilization ducts; MS male metatarsal clasping spine; S spermathecae; SP scape. Scale bars: 0.50 mm (A–D, F, G); 0.20 mm (E); 0.10 mm (H–J).

Figure 7.

Figure 7.

Chimenanantou sp. nov., holotype female A habitus, dorsal B habitus, ventral C habitus, lateral D epigyne, ventral E vulva, ventral F vulva, dorsal. Abbreviations: CD copulatory ducts; FD fertilization ducts; S spermathecae; SP scape. Scale bars: 0.50 mm (A–C); 0.10 mm (D–F).

Description.

Carapace pear-shaped, cephalic part distinctly raised in male; clypeus slightly concave. Ocular area black, AME black, others white; AER procurved, PER recurved or straight; ALE adjoined to AME and PLE, AMEs separated by at least its diameter; further separated in males than in females. Two or three pairs of strong spines on anterior surface of male chelicerae (Figs 4E, 6E). Labium fused to sternum. Sternum triangular, slightly plump, posteriorly truncated, light colour anteriorly and centrally. Each leg segment proximally pale yellow, distally darkish grey. Male with a mesal clasping spine and a distal, small nodule prolaterally on metatarsus I (Fig. 3C), female with weakly sclerotized spot on femur I. Abdomen dorsally rounded, surrounded by stripe of white pigmentation laterally and posteriorly. Venter black between epigastric furrow and spinnerets (Figs 4B, D, 6B, D, 7B).

Male palp. Tibia swollen, proximally narrow and distally broad, larger number of long setae on dorsally than ventrally (Figs 3F–G, 5G–H). Cymbium translucent, encloses ventral and prolateral sides of bulb (Figs 3G, 5E, H). Paracymbium flat, wide, with a few long setae and a horn-shaped process (CyP2) distally (Figs 3D, F, 5B, D). Distal part of cymbium extends to form an apical cymbial conductor (CyC), with horn-shaped or dentoid process (CyP1) attached to lateral margin of cymbial conductor (Figs 3E, F, 5B–D, G–H). Tegulum flat, without any process or projection (Figs 3F, 5D, F). Embolus slender, filiform, elongate, encircles the bulb multiple times, end extends to apex of cymbial conductor (Figs 3F, 5E, G–H).

Epigyne and vulva. Genital area covered with sparse setae, sclerotized spermathecae faintly visible through tegument (Figs 4H, 6H, 7D). Scape wrinkled, membranous, finger-like, short. Spermathecae rod-shaped, spiral, near epigynal posteromargin, separated from one another by about their length. Most of copulatory ducts membranous, extending anteriorly, coiled, overlapped with anterior end of spermathecae. Fertilization ducts relatively long, wide, originating at distal part of spermathecae, middle and proximal parts entwined with spermathecae, distal part thins gradually, inflexed (Figs 4I–J, 6I–J, 7E–F).

Composition.

Chimenaqiong sp. nov., C.taiwanica (Ono, 2007) comb. nov., and C.nantou sp. nov.

Distribution.

China (Hainan, Taiwan).

. Chimena qiong sp. nov.

675399F5-154F-558B-AA30-83DA2C2FAC76

https://zoobank.org/B9AAA398-0B07-4F88-8477-643064500729

Figs 3 , 4 , 8

Figure 8.

Figure 8.

Distribution records of three Chimena spp.: C.qiong sp. nov. (red dot), C.taiwanica (green dot) and C.nantou sp. nov. (blue dot).

Type material.

Holotype ♂ (IZCAS) and paratypes 2♀ (IZCAS), China: Hainan Province, Limushan Township, Limushan Natural Reserve, Yinhe Protected Station, 19°12.002'N, 109°43.710'E, 591±20 m, 25.III.2012, Z. Chen leg.; paratypes 2♀ (IZCAS), China: Hainan Province, Changjiang Township, Bawangling Natural Reserve, near the Yaga Convention Centre, 19°04.828'N, 109°07.369'E, 567±20 m, 13.IV.2012, Z. Chen leg.; Paratypes 1♂ (IZCAS); China: Hainan Province, Lingshui County, Diaoluoshan Natural Reserve, 18°43.505'N, 108°52.104'E, 920 m, 18.VI.2011, Y. Zhou leg.

Etymology.

The species epithet, a noun in apposition, refers to ‘qiong’, which is short for Hainan Province.

Diagnosis.

Males and females are similar to Chimenataiwanica comb. nov. in having a long, coiled embolus and the configuration of the vulva, but they can be distinguished by having three pairs of cheliceral spines (two pairs in the latter) (Fig. 4E vs. Fig. 6E) and a horn-shaped process (CyP1) on the cymbial conductor (tooth-shaped in the latter) (Fig. 3E, G vs. Fig. 5C, H). The female differs from congeners by the strongly spiralled, longer spermathecae (moderately spiralled in C.taiwanica comb. nov., and shorter in C.nantou sp. nov.) (Fig. 4I, J vs. Figs 6I, J, 7E, F).

Description.

Male. Habitus as in Fig. 4A, B, E, F. Total length 0.63. Carapace 0.23 long, 0.24 wide. Clypeus 0.11 high. Sternum 0.20 long, 0.19 wide. Abdomen 0.45 long, 0.44 wide. Length of legs: I 0.92 (0.29, 0.13, 0.18, 0.14, 0.18); II 0.80 (0.27, 0.09, 0.17, 0.12, 0.15); III 0.60 (0.17, 0.08, 0.12, 0.11, 0.12); IV 0.73 (0.21, 0.08, 0.15, 0.14, 0.15). Carapace pale yellow, black on cephalic area, pear-shaped. Cephalic area strongly raised. AER procurved, PER straight. Mouthparts pale brown. Chelicerae bearing 3 pairs of strong spines anteriorly (Fig. 4E). Sternum subtriangular, slightly plump, pale, anterior-centrally and laterally black, posteriorly truncated. Legs pale, gradually darkening to grey at each segment distally. Patella with distodorsal seta, proximal seta on tibia. Mesal clasping spine and distal, small nodule on metatarsus I (Figs 3C, 4B). Abdominal dorsum rounded, darkish grey, with paired light speckles, white stripe laterally and posteriorly. Posterior area of epigastric furrow and spinnerets black. Colulus black, long, tongue shaped.

Palp (Fig. 3A, B, D–G): weakly sclerotized. Femur equal to 2.2× length of patella, patella approximately half of tibial width. Tibia cup-shaped, with dense, long setae dorsally. Cymbium narrow basally, wrapped around bulb ventrally and retrolaterally; distal cymbial conductor triangular, lamellar, a sub-distal tooth-shaped process (CyP1) at medial margin; paracymbium wide, earlobe shaped, bearing a few long setae and a sharp process (CyP2) distally. CyP1 almost same length as CyP2. Cymbial fold located at base of CyP1, with a few short setae (CyFs). Tegulum flat, smooth; subtegulum translucent, inner spermatic duct faintly visible. Embolus very long, filiform, tightly coiled around entire tegulum at least 10 times, distal end extending to cymbial conductor (CyC).

Female. Habitus as in Fig. 4C, D, G. Total length 0.72. Carapace 0.23 long, 0.25 wide. Clypeus 0.06 high. Sternum 0.19 long, 0.17 wide. Abdomen 0.48 long, 0.43 wide. Length of legs: I 0.90 (0.28, 0.12, 0.18, 0.15, 0.17); II 0.82 (0.25, 0.10, 0.18, 0.13, 0.15); III 0.63 (0.18, 0.09, 0.12, 0.11, 0.13); IV 0.76 (0.22, 0.09, 0.15, 0.14, 0.16). Cephalic area moderately raised, chelicerae unmodified, femur I with weak sclerotized spot; other features as in male.

Epigyne (Fig. 4H–J): genital area bears sparse setae, with central dark speckle. Scape tongue shaped, protruded, rugose, membranous. Spermathecae long, claviform, separated by about their length, base near epigynal posterior margin. Copulatory ducts membranous, translucent, distal part overlapping and convoluted at spermathecae anteriorly. Fertilization ducts long, middle and proximal parts entwined with spermathecae, distal part extends horizontally to atrium.

Distribution.

China (Hainan) (Fig. 8).

. Chimena taiwanica

(Ono, 2007) comb. nov.

934CD32B-547E-505C-AA77-0DB2EB8D40D9

Figs 5 , 6 , 8

Type material.

Holotype ♂ (FRIT) and paratypes 2♀ (NSMT), China: southern Taiwan, Kaohsiung Hsien, Shanping Work Station of Liukuei Research Center, ca 700 m, by sifting soil litter in a forest, 9.III.2005, H. Ono leg. Not examined.

Examined materials.

6♂13♀ (IZCAS), China: central Taiwan, Nantou County, Ren’ai Township, Xinsheng Village, Huisun Farm, 24°05.279'N, 121°02.078'E, 788 m, 1.VII.2013, G. Zheng leg.

Diagnosis.

Chimenataiwanica comb. nov. is similar to C.qiong sp. nov. in having strong, modified cheliceral spines in the males (cf. Figs 6E, 4E), a long and multi-coiled embolus (cf. Figs 5A, 3A), and in females, the similar configuration of the vulva, as in that of C.nantou sp. nov. (cf. Figs 6J, 4J, 7F). Males of C.taiwanica can be distinguished by having 2 pairs of cheliceral spines (3 pairs in C.qiong sp. nov.) (Fig. 6E vs. Fig. 4E and figs 8, 10 in Ono et al. 2006) and a tooth-shaped process (CyP1) (process horn-shaped in C.qiong) (Fig. 5C, H vs. Fig. 3E, G). The female differs from C.qiong sp. nov. by the moderately spiralled, thinner spermathecae tapered at the base (strongly spiralled, thicker and blunt at the base in C.qiong sp. nov.) (Fig. 6I, J vs. Fig. 4I, J); and from C.nantou sp. nov. by the longer spermathecae narrowed in the middle (shorter and wider at the middle in C.nantou sp. nov.) (Fig. 6I, J vs. Fig. 7E, F).

Description.

Male. Habitus as in Fig. 6A, B, E, F. Total length 0.65. Carapace 0.24 long, 0.24 wide. Clypeus 0.12 high. Sternum 0.22 long, 0.20 wide. Abdomen 0.43 long, 0.43 wide. Length of legs: I 0.96 (0.30, 0.13, 0.19, 0.14, 0.20); II 0.84 (0.27, 0.11, 0.17, 0.13, 0.16); III 0.62 (0.17, 0.09, 0.12, 0.11, 0.13); IV 0.74 (0.22, 0.09, 0.15, 0.14, 0.16). Features same as in C.qiong sp. nov., except for 2 paired spines on chelicerae and darker body colouration.

Palp (Fig. 5A–H): weakly sclerotized. Femur equal to 2.4× length of patella, patella about half of tibial width. Tibia cup-shaped in prolateral view, slightly wider than long, bearing long setae with more dorsally than ventrally. Cymbium constricted basally, enwrapping bulb ventrally and retrolaterally; distal cymbial conductor (CyC) triangular, lamellar, tooth-shaped process (CyP1) at medial margin (Fig. 5G). Paracymbium long, with sharp distal process (CyP2), a few long setae (Fig. 5C, G). CyP1 smaller and shorter than CyP2. Cymbial fold at base of CyP1 (Fig. 5B), with a few short setae (CyFs). Tegulum flat, smooth, button-shaped (Fig. 5D); subtegulum translucent, spermatic duct faintly visible. Embolus very long, filiform, strongly sclerotized, tightly coiled around entire tegulum ca 8 times, distal end extended slightly beyond cymbial conductor (CyC) (Fig. 5G, H).

Female. Habitus as in Fig. 6C, D, G. Total length 0.78. Carapace 0.24 long, 0.22 wide. Clypeus 0.06 high. Sternum 0.24 long, 0.20 wide. Abdomen 0.46 long, 0.44 wide. Length of legs: I 1.00 (0.30, 0.13, 0.20, 0.15, 0.22); II 0.86 (0.27, 0.12, 0.17, 0.13, 0.18); III 0.68 (0.18, 0.09, 0.14, 0.14, 0.15); IV 0.78 (0.23, 0.10, 0.16, 0.14, 0.17). Cephalic area lower than in male, chelicerae unmodified, femur I with weak sclerotized spot; other features as in male.

Epigyne (Fig. 6H–J): vulval configuration similar to C.qiong sp. nov. Spermathecae narrow, proximally base tapering, separated by more than their length.

Distribution.

China (Taiwan) (Fig. 8).

Remarks.

Although the type specimens of Chimenataiwanica comb. nov. (= Mysmenataiwanica Ono, 2007) have not been examined for this study, the modified strong spines on the male chelicerae, the very long, multiply coiled embolus around the bulb, the paracymbium with two processes (CyP1, CyP2), the shape of epigyne, and the protruded scape depicted in the original illustrations (see figs 8, 10, 12–15, 18–19 in Ono et al. 2006: 74–76) leave little doubt that our identification is correct. Additionally, the specimens examined here were also collected from Taiwan, not too far from the type locality.

. Chimena nantou sp. nov.

407048FF-A32F-5EB0-B25F-D33540B1DE48

https://zoobank.org/DCD77110-6568-4DBA-9B03-8063C16EBC41

Figs 7 , 8

Type material.

Holotype ♀ (IZCAS), China: Taiwan, Nantou County, Ren’ai Township, Songgang Village, 24°05.222'N, 121°10.335'E, 2067 m, 2.VII.2013, G. Zheng leg.

Etymology.

The new species is named after the type locality; noun in apposition.

Diagnosis.

Chimenanantou sp. nov. shares a similar configuration of the vulva to C.qiong sp. nov. and C.taiwanica comb. nov., but differs from the former by the shorter spermathecae with fewer spirals (longer and with more spirals in C.qiong) (cf. Fig. 7E, F vs. Fig. 4I, J), and from the latter by the more compact spermathecae (elongated in the latter) (cf. Fig. 7E, F vs. Fig. 6I, J).

Description.

Female: Habitus as in Fig. 7A–C. Total length 0.75. Carapace 0.25 long, 0.23 wide. Clypeus 0.07 high. Sternum 0.24 long, 0.22 wide. Abdomen 0.45 long, 0.42 wide. Length of legs: I 0.98 (0.30, 0.13, 0.19, 0.14, 0.22); II 0.87 (0.27, 0.12, 0.17, 0.14, 0.18); III 0.66 (0.19, 0.09, 0.14, 0.14, 0.16); IV 0.80 (0.23, 0.10, 0.16, 0.15, 0.18). Somatic features as in female of C.taiwanica comb. nov.

Epigyne (Fig. 7D–F): vulval configuration similar to C.qiong sp. nov. and C.taiwanica comb. nov. Genital area bears sparse setae, without a dark speckle. Spermathecae short, tapering at distal end and proximal base, separated by ca 1.1× their length. Scape knob shaped, rugose, membranous. Copulatory ducts translucent. Most of fertilization ducts intertwined with spermathecae, distal part of fertilization ducts thin, inflected.

Male. Unknown.

Distribution.

China (Taiwan) (Fig. 8).

Discussion

We tested the phylogenetic and taxonomic position of Chimena gen. nov. based on molecular data and unique morphological evidence. The results of our analyses indicate that Chimena gen. nov. is highly supported. However, further detailed phylogenetic analysis based on more mysmenid specimens will help better place the mysmenid species and genera.

Supplementary Material

XML Treatment for Chimena
XML Treatment for Chimena qiong
XML Treatment for Chimena taiwanica
XML Treatment for Chimena nantou

Acknowledgements

We thank Yuri M. Marusik (Magadan, Russia) and an anonymous referee for insightful comments, and are especially grateful to Dimitar Dimitrov (Bergen, Norway), the subject editor of this manuscript, for his kind help. Danni Sherwood (UK) and Sarah Crews (San Francisco, USA) kindly checked the English of the final draft. This study was supported by the National Natural Foundation of China (NSFC-31972870, 31772410, 31750002).

Citation

Lin Y, Li S (2022) Chimena gen. nov., a new spider genus (Araneae, Mysmenidae) from China, with descriptions of two new species and a new combination. ZooKeys 1125: 69–86. https://doi.org/10.3897/zookeys.1125.85741

Contributor Information

Yucheng Lin, Email: linyucheng@scu.edu.cn.

Shuqiang Li, Email: lisq@ioz.ac.cn.

References

  1. Baert L. (1988) The Ochyroceratidae and Mysmenidae from Sulawesi (Araneae). Indo-Malayan Zoology 5: 9–22. [Google Scholar]
  2. Brescovit AD, Lopardo L. (2008) The first record on the spider genus Trogloneta Simon in the southern hemisphere (Araneae, Mysmenidae), with descriptions of three new species from Brazil and remarks on the morphology. Acta Zoologica, Stockholm 89(2): 93–106. 10.1111/j.1463-6395.2007.00296.x [DOI] [Google Scholar]
  3. Dupérré N, Tapia E. (2020) Megadiverse Ecuador: A review of Mysmenopsis (Araneae, Mysmenidae) of Ecuador, with the description of twenty-one new kleptoparasitic spider species. Zootaxa 4761(1): 1–81. 10.11646/zootaxa.4761.1.1 [DOI] [PubMed] [Google Scholar]
  4. Feng C, Miller JA, Lin Y, Shu Y. (2019) Further study of two Chinese cave spiders (Araneae, Mysmenidae), with description of a new genus. ZooKeys 870: 77–100. 10.3897/zookeys.870.35971 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hall TA. (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. https://10.1021/bk-1999-0734.ch008 [Google Scholar]
  6. Khmelik VV, Kozub D, Glazunov A. (2006) Helicon Focus 3.10.3. http://www.heliconsoft.com/heliconfocus.html [accessed on 10 September 2018]
  7. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. (2017) Partitionfinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34(3): 772–773. 10.1093/molbev/msw260 [DOI] [PubMed] [Google Scholar]
  9. Li Y, Lin Y. (2019) Taxonomic review of the Asian Trogloneta species (Araneae, Mysmenidae). ZooKeys 817: 41–60. 10.3897/zookeys.817.30468 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Lin Y, Li S. (2008) Mysmenid Spiders of China (Araneae: Mysmenidae). Annales Zoologici 58(3): 487–520. 10.3161/000345408X364337 [DOI] [Google Scholar]
  11. Lin Y, Li S. (2013) Two new species of the genera Mysmena and Trogloneta (Mysmenidae, Araneae) from southwestern China. ZooKeys 303: 33–51. 10.3897/zookeys.303.4808 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lin Y, Li S. (2014) Mysmenidae (Arachnida, Araneae), a spider family newly recorded from Vietnam. Zootaxa 3826(1): 169–194. 10.11646/zootaxa.3826.1.5 [DOI] [PubMed] [Google Scholar]
  13. Lin Y, Li S. (2016) Mysmenidae, a spider family newly recorded from Tibet (Arachnida, Araneae). ZooKeys 549: 51–69. 10.3897/zookeys.549.6046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lopardo L, Giribet G, Hormiga G. (2011) Morphology to the rescue: Molecular data and the signal of morphological characters in combined phylogenetic analyses – a case study from mysmenid spiders (Araneae, Mysmenidae), with comments on the evolution of web architecture. Cladistics 27(3): 278–330. 10.1111/j.1096-0031.2010.00332.x [DOI] [PubMed] [Google Scholar]
  15. Miller JA, Griswold CE, Yin CM. (2009) The symphytognathoid spiders of the Gaoligongshan, Yunnan, China (Araneae, Araneoidea): Systematics and diversity of micro-orbweavers. ZooKeys 11: 9–195. 10.3897/zookeys.11.160 [DOI] [Google Scholar]
  16. Miller MA, Pfeiffer WT, Schwartz T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Gateway Computing Environments Workshop (GCE), 1–8. 10.1109/gce.2010.5676129 [DOI]
  17. Ono H, Chang YH, Tso IM. (2006) Three new spiders of the families Theridiidae and Anapidae (Araneae) from southern Taiwan. Memoirs of the National Science Museum, Tokyo 44: 71–82. 10.2476/asjaa.44.71 [DOI] [Google Scholar]
  18. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Simon E. (1895a) Etudes arachnologiques. 26e. XLI. Descriptions d’espèces et de genres nouveaux de l’ordre des Araneae. Annales de la Société Entomologique de France 64: 131–160. [Google Scholar]
  20. Simon E. (1895b) Histoire naturelle des araignées. Deuxième édition, tome premier. Roret, Paris, 761–1084.
  21. Vaidya G, Lohman DJ, Meier R. (2011) SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27(2): 171–180. 10.1111/j.1096-0031.2010.00329.x [DOI] [PubMed] [Google Scholar]
  22. WSC (2022) World Spider Catalog. Version 23.0. Natural History Museum Bern. [accessed April 21, 2022]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Chimena
XML Treatment for Chimena qiong
XML Treatment for Chimena taiwanica
XML Treatment for Chimena nantou

Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES