Skip to main content
NCBI home page
ZooKeys logoLink to ZooKeys
. 2022 Nov 17;1130:65–78. doi: 10.3897/zookeys.1130.91325

The complete mitochondrial genome of the terrestrial snail Monachacartusiana (O.F. Müller, 1774) (Gastropoda, Eupulmonata, Hygromiidae)

Ewa Kosicka 1, Joanna R Pieńkowska 1, Andrzej Lesicki 1,✉
PMCID: PMC9836564  PMID: 36761020

Abstract

The mitochondrial genome of Monachacartusiana is the first complete mitochondrial sequence described for the pulmonate snail genus Monacha and for the family Hygromiidae. The identified mitogenome has a length of 13,894 bp and encodes 13 proteins, 22 tRNAs, and two rRNAs. A phylogenetic analysis of available mitogenomes from representatives of helicoid families shows a sister group relationship of Hygromiidae and Geomitridae, which have been recently recognised as separate families.

Keywords: Carthusian snail, Helicoidea, mitogenome, phylogeny, Stylommatophora

Introduction

Mollusca is the second largest animal phylum after Arthropoda in terms of the number of named species, with the class Gastropoda as the most speciose group with approximately 95,000 species (Ponder et al. 2020). Stylommatophoran pulmonates constitute the most species-rich gastropod order with an estimated number of about 30,000 species (Mordan and Wade 2008). Although the monophyly of Stylommatophora within panpulmonate heterobranchs is relatively well established (Jörger et al. 2010; Ponder et al. 2020), the phylogenetic relationships between stylommatophoran families are still debated (White et al. 2011; Gaitán-Espitia et al. 2013; Razkin et al. 2015; Doğan et al. 2020; Ponder et al. 2020).

Mitogenome sequences are of great importance in molecular phylogenetic studies (Moritz et al. 1987), especially to infer evolutionary relationships at species level (Avise et al. 1987); this is also the case within Mollusca (Boore 1999). The analysis of mito­genomes may thus provide additional evidence related to stylommatophoran phylogeny (White et al. 2011; Parmakelis et al. 2013; Minton et al. 2016a). The number of available stylommatophoran mitogenomes has increased in the last two decades, from three at the end of the 20th century (Hatzoglou et al. 1995; Terrett et al. 1996; Yamazaki et al. 1997) to 35 in recent years (Yang et al. 2019; Doğan et al. 2020). However, considering the number of recognised extant families within the Stylommatophora (117 according to Bouchet et al. 2017), the number of stylommatophoran mitogenomes still is very small and new mitogenomes, especially from families for which no, or very few, mito­genomes are available, are worth publishing. Hitherto, two mitogenomes were available for the Hygromiidae, viz. Cernuellavirgata (Da Costa, 1778) and Helicellaitala (Linnaeus, 1758), published by Lin et al. (2016) and Romero et al. (2016), respectively. However, these two species have recently been transferred from the Hygromiidae to the Geomitridae (Razkin et al. 2015; Neiber et al. 2017; Bouchet et al. 2017), so that the Hygromiidae, very rich in species, is left without any available mitogenome.

The hygromiid genus Monacha Fitzinger, 1833 is widespread in the western Palae­arctic from western Europe to North Africa, Iran, and Arabia. It includes a large number of nominal species and shows its highest diversity in south-eastern Europe and Turkey (Hausdorf 2000a, 2000b; Welter-Schultes 2012). Although most of the Monacha species occur in rather narrow areas (Welter-Schultes 2012; Neiber and Hausdorf 2017), Monachacartusiana (O.F. Müller, 1774), the type species of the genus, is widely distributed and can be found in almost the whole of Europe excluding its north-eastern fringes (Scandinavia, Russia, Baltic States, Belarus, northern Ukraine) (Welter-Schultes 2012; Pieńkowska et al. 2018). The mitogenome of this species will facilitate the future identification of species within the genus and the understanding of their phylogenetic relationships, as is the case with other families of terrestrial pulmonate snails (González et al. 2016; Groenenberg et al. 2017; Korábek et al. 2019; Doğan et al. 2020). Hence, in this paper, we present the complete mitogenome of M.cartusiana and analyse its phylogenetic position within the superfamily Helicoidea.

Material and methods

The specimen of Monachacartusiana used for this research was collected in Ostrowiec Świętokrzyski (Poland) by Mariusz Gwardjan on 03.07.2015. It was identified by the sequence of the cytochrome c oxidase subunit I gene fragment (coI) of M.cartusiana in GenBank (KX258398) deposited by Pieńkowska et al. (2016). Total genomic DNA was extracted following Pieńkowska et al. (2015). The sequencing of the M.cartusiana mitogenome (for gene acronyms see Table 3) was started using four pairs of primers complementary to the conservative regions of coI (Folmer et al. 1994), 16S rRNA (Palumbi et al. 1991), coII (Hugall et al. 2002) and cytb (Merritt et al. 1998), the missing fragments between them were identified by primer walking (Lin et al. 2016). The primers used for the amplification of mtDNA are listed in Table 1.

Table 3.

Organisation of the mitogenome of Monachacartusiana.

Type Gene product Gene acronym Start End Length (bp) Direction Start codon Stop codon
PCG cytochrome c oxidase subunit I coI 0 1552 1552 + ATG TAA1
tRNA valine transfer RNA tRNA Val 1525 1585 61 +
rRNA 16S ribosomal RNA 16S rRNA 1242 2652 1410 +
tRNA leucine transfer RNA tRNA Leu 2593 2657 65 +
tRNA proline transfer RNA tRNA Pro 2654 2718 60 +
tRNA alanine transfer RNA tRNA Ala 2716 2778 63 +
PCG NADH dehydrogenase subunit 6 nd6 2777 3263 451 + ATT TAA
PCG NADH dehydrogenase subunit 5 nd5 3316 4915 1657 + ATA TAG
PCG NADH dehydrogenase subunit 1 nd1 4896 5799 901 + ATA TAA1
PCG NADH dehydrogenase subunit 4L nd4l 5843 6076 233 + TTG TAT
PCG cytochrome b cytb 6054 7192 1097 + GTC TAA1
tRNA aspartic acid transfer RNA tRNA Asp 7192 7263 71 +
tRNA cysteine transfer RNA tRNA Cys 7250 7310 61 +
tRNA phenylalanine transfer RNA tRNA Phe 7310 7369 60 +
PCG cytochrome c oxidase subunit II coII 7370 8052 672 + ATG TAA1
tRNA tyrosine transfer RNA tRNA Tyr 8040 8102 55 +
tRNA tryptophan transfer RNA tRNA Trp 8094 8158 65 +
tRNA glycine transfer RNA tRNA Gly 8158 8223 66 +
tRNA histidine transfer RNA tRNA His 8216 8274 58 +
tRNA glutamine transfer RNA tRNA Gln 8274 8331 57 -
tRNA leucine transfer RNA tRNA Leu 8320 8392 73 -
PCG ATP synthase F0 subunit 8 atp8 8385 8544 104 - ATG TAA1
tRNA asparagine transfer RNA tRNA Asn 8544 8602 59 -
PCG ATP synthase F0 subunit 6 atp6 8582 9242 661 - ATG TAA
tRNA arginine transfer RNA tRNA Arg 9241 9304 62 -
tRNA glutamic acid transfer RNA tRNA Glu 9303 9367 65 -
rRNA 12S ribosomal RNA 12S rRNA 9412 10120 798 -
tRNA metionine transfer RNA tRNA Met 10118 10180 63 -
PCG NADH dehydrogenase subunit 3 nd3 10160 10493 307 - ATT TAA1
tRNA serine transfer RNA tRNA Ser 10523 10576 53 -
tRNA serine transfer RNA tRNA Ser 10648 10700 52 +
PCG NADH dehydrogenase subunit 4 nd4 10721 12005 1210 + ATT TAG
tRNA threonine transfer RNA tRNA Thr 11996 12058 63 -
PCG cytochrome c oxidase subunit III coIII 12046 12833 776 - ATG TAA1
tRNA isoleucine transfer RNA tRNA Ile 12877 12937 61 +
PCG NADH dehydrogenase subunit 2 nd2 12899 13872 833 + ATA TAA1
tRNA lysine transfer RNA tRNA Lys 13842 13894 60 +
Open in a new tab

1 Stop codons completed by the addition of 3' A residues to mRNA.

Table 1.

List of primers used for the amplification of Monachacartusiana mitochondrial DNA.

Primer Sequence 5' – 3' References
LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
HC02198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994
16Sar-L CGCCTGTTTATCAAAAACAT Palumbi et al. 1991
16Sbr-H CCGGTCTGAACTCAGATCACGT Palumbi et al. 1991
144F TGAGSNCARATGTCNTWYTG Merritt et al. 1998
272R GCRAANAGRAARTACCAYTC Merritt et al. 1998
FCOII AAATAATGCTATTTCATGAYCAYG Hugall et al. 2002
RCOII GCTCCGCAAATCTCTGARCAYTG Hugall et al. 2002
1F_556 Os TACCTGTACTAGCGGGGGCT this paper
1R_75 Os CAGTCAGGGTACTGCGGCTA this paper
2F_342 Os TTGTGACCTCGATGTTGGACT this paper
2R_83 Os CCGCCTCAGACCCAACTAAC this paper
3F_320 Os GGCCTAACTTGTTCACTGATCCT this paper
3R_50 Os TTTCTAGGGTCTGCGCTTCA this paper
4F_429 Os TTGTGGGGGTTTATTACGGGC this paper
4R_110 Os ATCACTCAACACCCCTGAAGT this paper
seqF_F1 ACGGTTTCCTGTTCTATTATTTG this paper
seqF_R1 CAAATAATAAGCTCCTAATGTAATC this paper
seqF_R2 ATAAACTTTCCACTTCAGGGAAT this paper
seqF_R3 GTAAAACATTTATTGGGGCCCAG this paper
seqF_R4 AACTAATTAACAACCTATATAGGG this paper
seqF_R5 TAGTCCCGTGCTGGCTAGTATT this paper
seqH_F2 CTATTGTAACTCGCCTTAACTCTAA this paper
seqH_R2 GAAATAAACACCTAAAATTACTGTA this paper
seqH_R3 GATGTACCTGATATTAAACCTA this paper
seqH_F4 CTACTAAACAGAAAAAGCGAACCC this paper
seqH_R4 GCAGCCACAATTTACTTCTT this paper
Open in a new tab

The mitogenome was annotated using the MITOS Web Server (Bernt et al. 2013). For the phylogenetic analysis we used a concatenated sequence alignment of 12 protein coding genes (PCGs; excluding atp8), and 2 rRNAs (12S rRNA and 16S rRNA). Every set of 14 sequences was separately aligned using CLUSTAL W (Thompson et al. 1994) implemented in BIOEDIT v. 7.0.6 (Hall 1999; BioEdit 2017). The length of the alignment after combining the 14 gene sequences was for each species 14,287 bp. For the phylogenetic analysis we used all mitogenome sequences deposited in GenBank for species of the superfamily Helicoidea (Table 2). The mitogenome of Thebapisana (MH362760) was not annotated, so we designated the individual PCGs and rRNAs by aligning the whole T.pisana sequence with the extracted sequences of species belonging to the family Helicidae. Each of the T.pisanaPCGs was tested for start and stop codons with ORF Finder (2004). Mitogenomes of two arionoid species (Arionvulgaris and Meghimatiumbilineatum, Table 2) were used as the outgroup.

Table 2.

Mitogenomes from GenBank used in the phylogenetic analysis and their lengths.

species GenBank Accession No. Mitogenome length (bp) References
Camaenidae: Aegistaaubryana (Heude, 1882) KT192071 14238 Yang et al. 2016
Camaenidae: Aegistadiversifamilia Huang, Lee, Lin & Wu, 2014 KR002567 14039 Huang et al. 2016
Camaenidae: Camaenacicatricosa (O. F. Müller, 1774) KM365408 13843 Wang et al. 2014
Camaenidae: Camaenapoyuensis Zhou, Wang & Ding, 2016 KT001074 13798 Lin et al. 2016
Camaenidae: Dolicheulotaformosensis (Adams, 1866) KR338956 14237 Huang et al. 2016
Camaenidae: Fruticicolakoreana (L. Pfeiffer, 1850) KU237291 13979 Hwang 2015
Camaenidae: Mastigeulotakiangsinensis (Martens, 1875) KM083123 14029 Deng et al. 2016
Geomitridae: Cernuellavirgata (Da Costa, 1778) KR736333 14147 Lin et al. 2016
Geomitridae: Helicellaitala (Linnaeus, 1758) KT696546 13967 Romero et al. 2016
Helicidae: Cylindrusobtusus (Draparnaud, 1805) JN107636 14610 Groenenberg et al. 2012
Helicidae: Cepaeanemoralis (Linnaeus, 1758) U23045 14100 Terrett et al. 1996
Helicidae: Cornuaspersum (O. F. Müller, 1774) JQ417194 14050 Gaitán-Espitia et al. 2013
Helicidae: Helixpomatia Linnaeus, 1758 MK347426 14070 Korabek et al. 2019
Helicidae: Helixpomatia Linnaeus, 1758 MK488030 14072 Groenenberg and Duijm 2019
Helicidae: Helixpomatia Linnaeus, 1758 MK488031 14070 Groenenberg and Duijm 2019
Helicidae: Thebapisana (O. F. Müller, 1774) MH362760 14795 Wang et al. 2018
Hygromiidae: Monachacartusiana (O. F. Müller, 1774) MW485067 13894 This paper
Polygyridae: Practicolellamexicana Perez, 2011 1 KX278421 14008 Minton et al. 2016a
Polygyridae: Practicolellamexicana Perez, 2011 2 KX240084 14153 Minton et al. 2016b
Arionidae: Arionvulgaris Moquin-Tandon, 1855 MN607980 14548 Doğan et al. 2020
Philomycidae: Meghimatiumbilineatum (Benson, 1842) MG722906 14347 Yang et al. 2019
Open in a new tab

1 Deposited in GenBank as mitogenome of Polygyracereolus (Megerle von Mühlfeldt, 1818) but according to Minton et al. (2016a) it represents Practicolellamexicana Perez, 2011. 2 Mitogenome not mentioned in the paper by Minton et al. (2016a) but directly submitted to GenBank (Minton et al. 2016b).

Phylogenetic analysis was performed using maximum likelihood (ML) as implemented in the online version of IQ-TREE (Trifinopoulos et al. 2016). ML analysis was done using 14 partitions. Best substitution models were inferred according to the Bayesian information criterion (BIC) for each of the partitions by ModelFinder (Kalyaanamoorthy et al. 2017) implemented in IQ-TREE. The TVM+F+I+G4 model was selected for nd1, nd2, nd4, nd5, atp6, and 16S rRNA; TPM3u+F+I+G4 for nd3; K3Pu+F+G4 for nd4l; TPM3+F+I+G4 for nd6; K3Pu+F+I+G4 for cytb, and coII; TIM+F+I+G4 for coI; GTR+F+I+G4 for coIII, and 12S rRNA. ML trees were constructed under 1,000 ultrafast bootstrap replicates (Minh et al. 2013) and with Shimodaira-Hasegawa-like approximate likelihood ratio test with 1,000 replicates (SH-aLRT; Guindon et al. 2010). A Bayesian inference (BI) analysis was performed with MrBayes v. 3.2.6 (Ronquist et al. 2012). Four Monte Carlo Markov chains were run for 1 million generations, sampling every 100 generations (the first 25% of trees were discarded as “burn-in”). Ultrafast bootstrap support, SH-aLRT support (both expressed in percentages) and posterior probability (PP) values obtained on 50% majority rule consensus Bayesian tree were mapped on the ML tree of concatenated sequences. The ML tree was visualized using FigTree v. 1.4.3 (Rambaut 2016).

Results and discussion

The complete mitogenome of M.cartusiana was deposited in GenBank under accession number MW485067. With 13,894 bp in length, it was one of the shortest mito­genomes known in Helicoidea, which ranged from 13,798 bp (Camaenapoyuensis) to 14,795 bp (Thebapisana) (Table 2). The mitogenome included: 13 PCGs, 22 tRNA genes and two rRNA genes (Fig. 1, Table 3), typical for most metazoan mitogenomes. The base composition of the M.cartusiana mitogenome was: 30.26% A, 37.95% T, 16.94% G and 14.85% C, i.e. with a bias towards A and T (68.21% content of A-T). These values differ from other helicoid species, but fit into the range previously reported for helicoids, especially when compared with the A-T values for C.virgata (65.96%) and H.itala (66.22%) (Doğan et al. 2020: table S3). The total length of all PCGs was 10,404 bp (74.88% of the entire mitogenome), and they had different start and stop codons, which also vary among helicoid mitogenomes (Table 4). Some of the stop codons TAA were generated by posttranscriptional polyadenylation (as in Groenenberg et al. 2012 and Yang et al. 2016). Nine PCGs were encoded in the “plus” direction (nd1, nd2, nd4, nd4l, nd5, nd6, cytb, coI, coII) and four in the “minus” direction (coIII, atp6, atp8, nd3). Furthermore, 14 tRNA and one rRNA were encoded in the “plus” direction and eight tRNA and one rRNA in the “minus” direction (Table 3). Additionally, seven intergenic regions (with noncoding sequences) were identified with a total length of 295 bp (the longest was 70 bp while the shortest 19 bp) (Fig. 1). The gene order in M.cartusiana mitogenome was exactly the same as in C.virgata and H.itala (geomitrid species). Yet, the polygyrid Practicolellamexicana differed in four places and helicid species in seven (Table 5). The species representing the Camaenidae formed three groups with the same order of genes, but each of these groups differed in gene order from species from Hygromiidae, Geomitridae, Helicidae, and Polygyridae (Table 5).

Figure 1.

Figure 1.

Open in a new tab

Circular diagram of the mitochondrial genome of Monachacartusiana (GenBank acc. no. MW485067). Genes encoded in the “plus” and the “minus” directions are shown outside and inside the circle, respectively. Particular gene types are marked with different colours: red – PCGs coding I, II, and III subunits of cytochrome c oxidase; green – PCGs coding NADH dehydrogenase family; orange – PCGs coding ATPase family; yellow – sequence coding cytochrome b; purple – tRNAs coding sequences; blue – rRNA coding genes. Noncoding sequences are mapped on a small inner circle. The circular diagram was created with GenomeVx (Conant and Wolfe 2008).

Table 4.

Start and stop codons in the mitogenome protein coding genes of helicoid species.

Species Start codons Stop codons
Monachacartusiana ATA – 3; ATG – 5; ATT – 3; GTC – 1; TTG – 1 TAA – 10; TAG – 2; TAT – 1
Cernuellavirgata ATA – 4; ATG – 4; ATT – 5 TAA – 9; TAG – 4
Helixpomatia ATA – 1; ATC – 1; ATG – 6; GTG – 3; TTG – 2 TAA – 8; TAG – 5
Cepaeanemoralis ATA – 5; ATG – 2; ATT – 6 TAA – 2; TAG – 4; TA – 7
Cornuaspersum ATA – 5; ATG – 6; TTG – 2 TAA – 5; TAG – 5; T – 3
Thebapisana ATA – 2; ATC – 1; ATG – 2; ATT – 8 TAA/TAG – 12; T – 1
Cylindrusobtusus ATA – 5; ATG – 4; ATC – 1; GTG – 1; TTG – 2 TAA – 4; TAG – 5; T – 4
Practicolellamexicana ATC – 1; ATG – 5; ATT – 2; GTG – 2; TTG – 3 TAA – 3, TAG – 4; T – 6
Aegistaaubryana ATA – 6; ATG – 7 TAA/TAG – 11; T – 2
Aegistadiversifamilia ATG – 5; ATT – 3; TTG – 3; TTA – 2 TAA – 5; TAG – 2; TA – 2; T – 4
Camaenacicatricosa ATA – 5; ATG – 4; ATT – 3; GTG – 1 TAA – 11; TAG – 2
Dolicheulotaformosensis ATG – 4; ATA – 3; ATT – 3; TTG – 2; GTG – 1 TAA – 5; TAG – 2; TA – 6
Mastigeulotakiangsinensis ATA – 4; ATG – 7; ATT – 1; GTG – 1 TAA – 7; TAG – 6
Open in a new tab

For references see Table 2.

Table 5.

Gene order in known mitogenomes of helicoid species.

M.cartusiana coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Tyr Trp Gly His Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
C.virgata coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Tyr Trp Gly His Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
H.itala coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Tyr Trp Gly His Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
P.mexicana coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Gly His Tyr Trp Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
H.pomatia coI Val 16S Leu Ala nd6 Pro nd5 nd1 nd4l cytb Asp Cys Phe coII Tyr Trp Gly His Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Thr coIII Ser nd4 Ile nd2 Lys
C.aspersum coI Val 16S Leu Ala nd6 Pro nd5 nd1 nd4l cytb Asp Cys Phe coII Tyr Trp Gly His Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Thr coIII Ser nd4 Ile nd2 Lys
C.nemoralis coI Val 16S Leu Ala nd6 Pro nd5 nd1 nd4l cytb Asp Cys Phe coII Tyr Trp Gly His Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Thr coIII Ser nd4 Ile nd2 Lys
C.obtusus coI Val 16S Leu Ala nd6 Pro nd5 nd1 nd4l cytb Asp Cys Phe coII Tyr Trp Gly His Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Thr coIII Ser nd4 Ile nd2 Lys
Ae.aubryana coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Gly His Tyr nd3 Trp Gln Leu atp8 Asn atp6 Arg Glu 12S Met Ser Ser nd4 Thr coIII Ile nd2 Lys
Ae.diversifamilia coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Gly His Tyr nd3 Trp Gln Leu atp8 Asn atp6 Arg Glu 12S Met Ser Ser nd4 Thr coIII Ile nd2 Lys
D.formosensis coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Gly His Tyr Trp Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
F.koreana coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Gly His Tyr Trp Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
M.kiangsinensis coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Asp Cys Phe coII Gly His Tyr Trp Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
C.cicatricosa coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Cys Phe coII Asp Tyr Gly His Trp Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
C.poyuensis coI Val 16S Leu Pro Ala nd6 nd5 nd1 nd4l cytb Cys Phe coII Asp Tyr Gly His Trp Gln Leu atp8 Asn atp6 Arg Glu 12S Met nd3 Ser Ser nd4 Thr coIII Ile nd2 Lys
Open in a new tab

Light blue background shows the same position in gene order as in M.cartusiana mitogenome. For gene acronyms (tRNA genes shortened to aminoacid symbol) and references see Table 2. Colours for the families as in Fig. 2: light blue – Hygromiidae; green – Geomitridae; brown – Polygyridae; red – Helicidae; dark blue – Camaenidae

Phylogenetic analyses of the stylommatophoran mitogenomes (González et al. 2016; Romero et al. 2016) showed them in a well-supported clade among Panpulmonata (with PP and bootstrap values 1 and 99, respectively). Previous mitogenome phylogenies of stylommatophoran superfamilies (Groenenberg et al. 2017; Harasewych et al. 2017; Yang et al. 2019; Doğan et al. 2020) showed a clade of Helicoidea separate from other superfamilies, although mitogenomes of only 11 stylommatophoran superfamilies (Yang et al. 2019) out of 26 listed by Bouchet et al. (2017) are represented in GenBank. According to Bouchet et al. (2017), Helicoidea includes 17 families but hitherto phylogenetic relationships could be analysed only for three or four of them, namely Helicidae, Camaenidae, Geomitridae, and Polygyridae (González et al. 2016; Lin et al. 2016; Minton et al. 2016a; Harasewych et al. 2017; Doğan et al. 2020).

For the phylogenetic analysis, a concatenated alignment of 12 PCGs (excluding atp8, because it was too short, too variable, and not annotated in the mitogenome of Cernuellavirgata) and 2 rRNAs (12S and 16S) was used. The dataset included 19 helicoid species (Table 2) yielding the ML tree shown in Fig. 2. The Bayesian tree (not shown) had the same topology.

Figure 2.

Figure 2.

Open in a new tab

Maximum likelihood (ML) tree of mitochondrial genomes of species representing the superfamily Helicoidea (see Table 1). Mitogenome sequences included all PCGs (except atp8) and two rRNA genes were 14,287 positions in length. Ultrafast bootstrap support values (%), SH-aLRT support values (%) and Bayesian posterior probabilities are indicated next to the branches. The tree was rooted with sequences of Arionvulgaris (MN607980) and Meghimatiumbilineatum (MG722906) mitogenomes deposited in GenBank by Doğan et al. (2020) and Yang et al. (2019), respectively.

The mitogenome of M.cartusiana allows to add Hygromiidae to the previous analyses of Helicoidea families. It shows up in a clade with mitogenomes of the geomitrid species, Cernuellavirgata and Helicellaitala, confirming the close relationships of two families, i.e., Hygromiidae and Geomitridae (Razkin et al. 2015). The mitogenome of the helicid Cylindrusobtusus of the subfamily Ariantinae forms a branch separated from the subfamily Helicinae (Fig. 2). This was also noted in previous phylogenetic analyses (Korábek et al. 2019; Doğan et al. 2020). Moreover, Camaenidae are separated into two clades i.e., Bradybaeninae and Camaeninae, treated frequently as two separate families (Lin et al. 2016; Minton et al. 2016a; Harasewych et al. 2017). Our results agree with the division of Helicidae and Camaenidae into subfamilies (Bouchet at al. 2017). However, the five helicid and seven camaenid species (Table 2, Fig. 2) represent only a tiny fraction of these speciose families. Therefore, more helicoid and stylommatophoran mitogenomes are urgently needed.

Acknowledgements

We are grateful to Ondřej Korábek (Charles University, Prague, Czech Republic) and two anonymous reviewers for their constructive remarks, Thierry Backeljau (Royal Belgian Institute of Natural Sciences, Brussels, Belgium) for his editorial help, Robert A.D. Cameron (University of Sheffield, UK) for revising the English text, and Krzysztof Duda (Adam Mickiewicz University, Poznań) for help in preparing figures for print.

Citation

Kosicka E, Pieńkowska JR, Lesicki A (2022) The complete mitochondrial genome of the terrestrial snail Monacha cartusiana (O.F. Müller, 1774) (Gastropoda, Eupulmonata, Hygromiidae). ZooKeys 1130: 65–78. https://doi.org/10.3897/zookeys.1130.91325

References

  1. Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, Saunders NC. (1987) Intraspecific phylogeography: The mitochondrial DNA bridge between population genetics and systematics. Annual Review of Ecology and Systematics 18(1): 489–522. 10.1146/annurev.es.18.110187.002421 [DOI] [Google Scholar]
  2. Bernt M, Donath A, Jühling F, Exterbrink F, Florentz C, Fritzsch G, Pütz J, Middendorf M, Stadler PF. (2013) MITOS: Improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution 69(2): 313–319. 10.1016/j.ympev.2012.08.023 [DOI] [PubMed] [Google Scholar]
  3. BioEdit (2017) BioEdit 7.2. https://bioedit.software.informer.com/7.2 [Accessed on: 2021-03-04]
  4. Boore JL. (1999) Animal mitochondrial genomes. Nucleic Acids Research 27(8): 1767–1780. 10.1093/nar/27.8.1767 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bouchet P, Rocroi J-P, Hausdorf B, Kaim A, Kano Y, Nützel A, Parkhaev P, Schrödl M, Strong EE. (2017) Revised classification, nomenclator and typification of gastropod and monoplacophoran families. Malacologia 61(1–2): 1–526. 10.4002/040.061.0201 [DOI] [Google Scholar]
  6. Conant GC, Wolfe KH. (2008) GenomeVx: Simple web-based creation of editable circular chromosome maps. Bioinformatics 24(6): 861–862. 10.1093/bioinformatics/btm598 [DOI] [PubMed] [Google Scholar]
  7. Deng PJ, Wang WM, Huang XC, Wu XP, Xie GL, Ouyang S. (2016) The complete mitochondrial genome of Chinese land snail Mastigeulotakiangsinensis (Gastropoda: Pulmonata: Bradybaenidae). Mitochondrial DNA. Part A, DNA Mapping, Sequencing, and Analysis 27: 1441–1442. 10.3109/19401736.2014.953083 [DOI] [PubMed] [Google Scholar]
  8. Doğan Ö, Schrödl M, Chen Z. (2020) The complete mitogenome of Arionvulgaris Moquin-Tandon, 1855 (Gastropoda: Stylommatophora): mitochondrial genome architecture, evolution and phylogenetic considerations within Stylommatophora. PeerJ 8: e8603. 10.7717/peerj.8603 [DOI] [PMC free article] [PubMed]
  9. Folmer O, Black M, Hoeh W, Lutz RA, Vrijenhoek RC. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. [PubMed] [Google Scholar]
  10. Gaitán-Espitia JD, Nespolo RF, Opazo JC. (2013) The complete mitochondrial genome of the land snail Cornuaspersum (Helicidae: Mollusca): intra-specific divergence of protein-coding genes and phylogenetic considerations within Euthyneura. PLoS ONE 8(6): e67299. 10.1371/journal.pone.0067299 [DOI] [PMC free article] [PubMed]
  11. González VL, Kayal E, Halloran M, Shrestha Y, Harasewych MG. (2016) The complete mitochondrial genome of the land snail Cerionincanum (Gastropoda: Stylommatophora) and the phylogenetic relationships of Cerionidae within Panpulmonata. The Journal of Molluscan Studies 82(4): 525–535. 10.1093/mollus/eyw017 [DOI] [Google Scholar]
  12. Groenenberg DSJ, Duijm E. (2019) The complete mitogenome of the Roman snail Helixpomatia Linnaeus, 1758 (Stylommatophora: Helicidae). Mitochondrial DNA Part B 4(1): 1494–1495. 10.1080/23802359.2019.1601512 [DOI] [Google Scholar]
  13. Groenenberg DSJ, Pirovano W, Gittenberger E, Schilthuizen M. (2012) The complete mitogenome of Cylindrusobtusus (Helicidae, Ariantinae) using Illumina next generation sequencing. BMC Genomics 13(1): 114. 10.1186/1471-2164-13-114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Groenenberg DSJ, Harl J, Duijm E, Gittenberger E. (2017) The complete mitogenome of Orculadolium (Draparnaud, 1801); ultra-deep sequencing from a single long-range PCR using the lon-Torent PGM. Hereditas 154(1): 7. 10.1186/s41065-017-0028-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Systematic Biology 59(3): 307–321. 10.1093/sysbio/syq010 [DOI] [PubMed] [Google Scholar]
  16. Hall TA. (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]
  17. Harasewych MG, González VL, Windsor AM, Halloran M. (2017) The complete mitochondrial genome of Cerionuvauva (Gastropoda: Panpulmonata: Stylommatophora: Cerionidae). Mitochondrial DNA Part B 2(1): 159–160. 10.1080/23802359.2017.1303343 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hatzoglou E, Rodakis GC, Lecanidou R. (1995) Complete sequence and gene organization of the mitochondrial genome of the land snail Albinariacoerulea. Genetics 140(4): 1353–1366. 10.1093/genetics/140.4.1353 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hausdorf B. (2000a) The genus Monacha in Turkey (Gastropoda: Pulmonata: Hygromiidae). Archiv für Molluskenkunde 128(1–2): 61–151. 10.1127/arch.moll/128/2000/61 [DOI] [Google Scholar]
  20. Hausdorf B. (2000b) The genus Monacha in the Western Caucasus (Gastropoda: Hygromiidae). Journal of Natural History 34(8): 1575–1594. 10.1080/00222930050117495 [DOI] [Google Scholar]
  21. Huang CW, Lin SM, Wu WL. (2016) Mitochondrial genome sequences of land snails Aegistadiversifamilia and Dolicheulotaformosensis (Gastropoda: Pulmonata: Stylommatophora). Mitochondrial DNA. Part A, DNA Mapping, Sequencing, and Analysis 27(4): 2793–2795. 10.3109/19401736.2015.1053070 [DOI] [PubMed] [Google Scholar]
  22. Hugall A, Moritz C, Moussalli A, Stanisic J. (2002) Reconciling paleodistribution models and comparative phylogeography in the wet tropics rainforest land snail Gnarosophiabellendenkerensis (Brazier 1875). Proceedings of the National Academy of Sciences of the United States of America 99: 6112–6117. 10.1073/pnas.092538699 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hwang UW. (2015) Complete mitochondrial genome of Koreanohadrakoreana. Direct submission. https://www.ncbi.nlm.nih.gov/nuccore/KU237291. [Accessed on: 2021-03-04]
  24. Jörger KM, Stöger I, Kano Y, Fukuda H, Knebelsberger T, Schrödl M. (2010) On the origin of Acochlidia and other enigmatic euthyneuran gastropods, with implication for the systematics of Heterobranchia. BMC Evolutionary Biology 10(1): 323. 10.1186/1471-2148-10-323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Korábek O, Petrusek A, Rovatsos M. (2019) The complete mitogenome of Helixpomatia and the basal phylogeny of Helicinae (Gastropoda, Stylommatophora, Helicidae). ZooKeys 827: 19–30. 10.3897/zookeys.827.33057 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lin JH, Zhou W, Ding HL, Wang P, Ai HM. (2016) The mitochondrial genome of the land snail Cernuellavirgata (Da Costa, 1778): The first complete sequence in the family Hygromiidae (Pulmonata, Stylommatophora). ZooKeys 589: 55–69. 10.3897/zookeys.589.7637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Merritt TJS, Shi L, Chase MC, Rex MA, Etter RJ, Quattro JM. (1998) Universal cytochrome b primers facilitate intraspecific studies in molluscan taxa. Molecular Marine Biology and Biotechnology 7: 7–11. [PubMed] [Google Scholar]
  29. Minh BQ, Nguyen MAT, von Haeseler A. (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30(5): 1188–1195. 10.1093/molbev/mst024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Minton RL, Martinez Cruz MA, Farman ML, Perez KE. (2016a) Two complete mitochondrial genomes from Praticolellamexicana Perez, 2011 (Polygyridae) and gene order evolution in Helicoidea (Mollusca, Gastropoda). ZooKeys 626: 137–154. 10.3897/zookeys.626.9633 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Minton RL, Martinez Cruz MA, Farman ML, Perez KE. (2016b) Direct submission. https://www.ncbi.nlm.nih.gov/nuccore/KX240084 [Accessed on: 2021-03-04]
  32. Mordan P, Wade C. (2008) Heterobranchia II: the Pulmonata. In: Ponder W, Linberg DR. (Eds) Phylogeny and Evolution of the Mollusca.University of California Press, Berkeley, 409–426. 10.1525/california/9780520250925.003.0015 [DOI]
  33. Moritz C, Dowling TE, Brown WM. (1987) Evolution of animal mitochondrial DNA: Relevance for populational biology and systematics. Annual Review of Ecology and Systematics 18(1): 269–292. 10.1146/annurev.es.18.110187.001413 [DOI] [Google Scholar]
  34. Neiber MT, Hausdorf B. (2017) Molecular phylogeny and biogeography of the land snail genus Monacha (Gastropoda, Hygromiidae). Zoologica Scripta 46(3): 308–321. 10.1111/zsc.12218 [DOI] [Google Scholar]
  35. Neiber MT, Razkin O, Hausdorf B. (2017) Molecular phylogeny and biogeography of the land snail family Hygromiidae (Gastropoda: Helicoidea). Molecular Phylogenetics and Evolution 111: 169–184. 10.1016/j.ympev.2017.04.002 [DOI] [PubMed] [Google Scholar]
  36. ORF FINDER (2004) Open Reading Frame Finder [Internet]. National Library of Medicine (US), National Center for Biotechnology Information, Bethesda. https://www.ncbi.nlm.nih.gov/orffinder/ [Accessed on: 2022-07-06]
  37. Palumbi S, Martin A, Romano S, McMillan WO, Stice L, Grabowski G. (1991) The Simple Fool’s Guide to PCR. Department of Zoology, University of Hawaii, Honolulu, 45 pp. [Google Scholar]
  38. Parmakelis A, Kotsakiozi P, Rand D. (2013) Animal mitochondria, positive selection and cytonuclear coevolution: Insight from Pulmonates. PLoS ONE 8(4): e61970. 10.1371/journal.pone.0061970 [DOI] [PMC free article] [PubMed]
  39. Pieńkowska JR, Giusti F, Manganelli G, Lesicki A. (2015) Monachaclaustralis (Rossmässler 1834) new to Polish and Czech malacofauna (Gastropoda: Pulmonata: Hygromiidae). Journal of Conchology 42: 79–93. http://docplayer.net/56112556-Monacha-claustralis-rossmassler-1834-new-to-polish-and-czech-malacofauna-gastropoda-pulmonata-hygromiidae.html [Google Scholar]
  40. Pieńkowska JR, Górka M, Matuszak M, Bocianowski P, Gwardjan M, Lesicki A. (2016) New data on the distribution and molecular diagnostics of Monachaclaustralis (Rossmässler 1834) and M.cartusiana (O. F. Müller, 1774) (Gastropoda: Eupulmonata: Hygromiidae) in Poland, Bosnia and Serbia. Folia Malacologica 24(4): 223–237. 10.12657/folmal.024.019 [DOI] [Google Scholar]
  41. Pieńkowska JR, Proćków M, Górka M, Lesicki A. (2018) Distribution of Monachaclaustralis (Rossmässler, 1834) and M.cartusiana (O. F. Müller, 1774) (Eupulmonata: Hygromiidae) in central European and Balkan countries: new data. Folia Malacologica 26(2): 103–120. 10.12657/folmal.026.009 [DOI] [Google Scholar]
  42. Ponder WF, Lindberg DR, Ponder JM. (2020) Biology and Evolution of the Mollusca. Volume 1. CRC Press Taylor & Francis Group, Boca Raton, London/New York, 870 pp. 10.1201/9781351115254-1 [DOI] [Google Scholar]
  43. Rambaut A. (2016) Molecular evolution, phylogenetics and epidemiology: FigTree. Institute of Evolutionary Biology, University of Edinburgh. http://tree.bio.ed.ac.uk/software/figtree/ [Accessed on: 2022-10-18]
  44. Razkin O, Gómez-Moliner BJ, Prieto CE, Martínez-Ortí A, Arrébola JR, Muñoz B, Chueca LJ, Madeira MJ. (2015) Molecular phylogeny of the western Palaearctic Helicoidea (Gastropoda, Stylommatophora). Molecular Phylogenetics and Evolution 83: 99–117. 10.1016/j.ympev.2014.11.014 [DOI] [PubMed] [Google Scholar]
  45. Romero PE, Weigand AM, Pfenninger M. (2016) Positive selection on panpulmonate mito­genomes provide new clues on adaptations to terrestrial life. BMC Evolutionary Biology 16(1): 164. 10.1186/s12862-016-0735-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model selection across a large model space. Systematic Biology 61(3): 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Terrett JA, Miles S, Thomas RH. (1996) Complete DNA sequence of the mitochondrial genome of Cepaeanemoralis (Gastropoda: Pulmonata). Journal of Molecular Evolution 42(2): 160–168. 10.1007/BF02198842 [DOI] [PubMed] [Google Scholar]
  48. Thompson JD, Higgins DG, Gibson TJ. (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22(22): 4673–4680. 10.1093/nar/22.22.4673 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ. (2016) W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44(W1): 232–235. 10.1093/nar/gkw256 [DOI] [PMC free article] [PubMed]
  50. Wang P, Yang HF, Zhou WC, Hwang CC, Zhang WH, Qian ZX. (2014) The mitochondrial genome of the land snail Camaenacicatricosa (Muller, 1774) (Stylommatophora, Camaenidae): The first complete sequence in the family Camaenidae. ZooKeys 451: 33–48. 10.3897/zookeys.451.8537 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wang P, Yang SP, Lin JH, Zhang MZ, Zhou WC. (2018) The mitochondrial genome of the land snail Thebapisana (Müller, 1774) (Stylommatophora: Helicidae): the first complete sequences in the genus Theba. Mitochondrial DNA Part B 3(2): 798–800. 10.1080/23802359.2018.1491341 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Welter-Schultes FW. (2012) European Non-marine Molluscs, a Guide for Species Identification. Planet Poster Editions, Göttingen, 679 pp. [Google Scholar]
  53. White TR, Conrad MM, Tseng R, Balayan S, Golding R, de Frias Martin AM, Dayrat B. (2011) Ten new complete mitochondrial genomes of pulmonates (Mollusca: Gastropoda) and their impact on phylogenetic relationships. BMC Evolutionary Biology 11(1): 295. 10.1186/1471-2148-11-295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Yamazaki N, Ueshima R, Terrett JA, Yokobori S, Kaifu M, Segawa R, Kobayashi T, Numachi K, Ueda T, Nishikawa K, Watanabe K, Thomas RH. (1997) Evolution of pulmonate gastropod mitochondrial genomes: Comparisons of gene organizations of Euhadra, Cepaea and Albinaria and implications of unusual tRNA secondary structures. Genetics 145(3): 749–758. 10.1093/genetics/145.3.749 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Yang X, Xie GL, Wu XP, Ouyang S. (2016) The complete mitochondrial genome of Chinese land snail Aegistaaubryana (Gastropoda: Pulmonata: Bradybaenidae). Mitochondrial DNA Part A, DNA Mapping, Sequencing, and Analysis 27(5): 3538–3539. 10.3109/19401736.2015.1074207 [DOI] [PubMed] [Google Scholar]
  56. Yang T, Xu G, Gu B, Shi Y, Mzuka HL, Shen H. (2019) The complete mitochondrial genome sequences of the Philomycusbilineatus (Stylommatophora: Philomycidae) and phylogenetic analysis. Genes 10(3): 198. 10.3390/genes10030198 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES