Skip to main content
Skin Research and Technology logoLink to Skin Research and Technology
. 2022 Dec 28;29(1):e13266. doi: 10.1111/srt.13266

Efficacy of a home‐used high‐intensity focused ultrasound device on wrinkle reduction

Mi Hee Kwack 2,3, Weon Ju Lee 1,
PMCID: PMC9838762  PMID: 36704876

Abstract

Background

High‐intensity focused ultrasound (HIFU) has been developed for the treatment of skin wrinkles on the face, neck, and body.

Objectives

This study aimed to evaluate the effects of a home‐used HIFU device on wrinkles in mice based on the expression of fibrosis‐related genes and proteins.

Methods

The backs of 20‐week‐old mice were treated with a home‐used HIFU using the following probes: 4 MHz, 1.5 mm focal depth. The treated mice were compared with young mice by histological examination, real‐time polymerase chain reaction (PCR), and immunohistochemistry. Histological examination was performed by trichrome staining. Real‐time PCR and immunohistochemistry were conducted to determine the expression of collagen types I and III, matrix metalloproteinase (MMP)‐1, and tissue inhibitor of metalloproteinase (TIMP)‐1.

Results

Dermal thickness was increased after treatment with the home‐used HIFU device at 30 and 60 s per day for 1 week or 30 and 60 s per day for 2 weeks on trichrome. Gene and protein expression of collagen types I and III and elastin were increased after treatment with HIFU at all options of 30 and 60 s per day for 1 week or 30 and 60 s per day for 2 weeks. Gene and protein expressions of MMP‐1 and TIMP‐1 were decreased after treatment with HIFU device at 30 and 60 s per day for 1 week or 30 and 60 s per day for 2 weeks.

Conclusion

The home‐used HIFU device can be an effective therapeutic modality for skin tightening.

Keywords: collagen, elastin, home‐used high‐intensity focused ultrasound device, matrix metalloproteinase‐1, mice, tissue inhibitor of metalloproteinase‐1

1. INTRODUCTION

Skin wrinkles are part of the natural process of aging in humans, although sun exposure, pollutants, and smoking are major causes of premature skin wrinkles. Although it is inevitable to develop wrinkles, its appearance is highly disliked by the majority of people. This aversion for wrinkles has enabled the global antiaging market to expand significantly.

Therapeutic modalities for reducing skin wrinkles have been developed throughout the world. 1 Botulinum toxin A is a popular anti‐wrinkle agent used to improve the appearance of aging skin. 2 Frown lines and crow's feet are the cosmetic indications approved by the US Food and Drug Administration for botulinum toxin A. Dermal filler and thread lifting are also popular therapeutic tools for the treatment of skin wrinkles. 3 , 4 Treatment of skin wrinkles with laser devices is well known. The variety of laser devices that have been used include Er:YAG laser, fractional Er:YAG laser, CO2 laser, fractional CO2 laser, and picosecond laser. 5 , 6 , 7 Only recently, radiofrequency therapy has been introduced in esthetic dermatology. 8 Furthermore, mesotherapy, microneedling, and chemical peels were used as options for the treatment of aging skin. 9 , 10 Most of these therapeutic modalities are performed in general hospitals or private clinics.

The demand for safe and effective home‐used therapeutic devices for reducing skin wrinkles has been rising in recent years. Thus, we developed a new home‐used high‐intensity focused ultrasound (HIFU) device for skin wrinkle treatment. HIFU has been used in medicine to treat certain conditions, such as tumors. It has significant advantages over conservative treatment options using focused ultrasound energy. 11 It treats patients using nonsurgical methods. Nevertheless, it is not used for brain disease because errors can occur for reasons such as sensory and gait disturbances until 2016. Currently, it overcame the problem and uses it to treat Parkinson's disease. 12 Recently, commercially available HIFU devices are being developed for various therapeutic purposes. This device we made emits 4 Mhz HIFU and has a microneedle that can be adjusted according to the depth of the skin. The cartridge can be replaced, and the usage time and HIFU intensity can be adjusted. We tested the efficacy of our HIFU device against wrinkles by histological examination, real‐time polymerase chain reaction (PCR), and immunohistochemistry in a mouse model.

2. MATERIALS AND METHODS

2.1. Application of HIFU device on mouse skin

A novel HIFU device was provided by Research And Ubiquitous Inc. (Figure 1). This device allows the user to control the intensity, duration, and depth of the HIFU.

FIGURE 1.

FIGURE 1

A novel high‐intensity focused ultrasound (HIFU) device

To study the effect of HIFU on mouse skin, nude female mice (n = 30) were purchased from Orient Bio Inc. (Sungnam, Republic of Korea) and were stabilized until 20 weeks in ventilated cages. Seven‐week‐old mice were used as a positive control group (n = 5). The experimental care and treatment were conducted in accordance with the ARRVE guidelines. The animal experiments were approved by the Institutional Animal Care and Use Committee of Kyungpook National University (Approval No. KNU 2021‐0184).

Old mice (20‐week old) were treated with HIFU 30 and 60 s per day for 1 week or 30 and 60 s per day for 2 weeks on the back skin. At 21 and 22 weeks, mice were sacrificed by CO2 inhalation after HIFU treatment. Pictures were immediately taken, and mouse skins were obtained.

2.2. Histological examination by trichrome staining

Excised mouse tissues were embedded in the optimum cutting temperature compound (Tissue‐Tek; Miles, Napierville, IL, USA). Tissues were cut to a thickness of 8 μm using a cryostat (Leica CM3050 S; Leica, Heidelberg, Germany). Slides were stained with trichrome, and immunohistochemistry was performed.

Trichrome staining kit (Scy Tek Laboratories, Logan, UT, USA) were used according to the manufacture's instructions to visualize collagenous connective tissue fibers in tissue sections. Briefly, the slides were fixed with preheated Bouin's Fluid for 60 min and then washed with water. After staining with hematoxylin mixture for 5 min, the slides were washed with water and placed in 0.5% acid alcohol solution for 5 s to adjust the pH. After staining with trichrome stain solution for 15 min and washing with water, the slides were rinsed in absolute alcohol for 10 s in 0.5% acetic acid solution. Blue indicates collagen, and red represents fibers.

Dermal thickness was measured in Trichrome‐stained images using a Zeiss micrometer (Carl Zeiss, Oberkochen, Germany) at 200× magnification.

2.3. Real‐time PCR

Total RNA was isolated from cutaneous dorsal mouse skin treated with HIFU using TRIzol reagent (Invitrogen, Waltham, MA, USA), and cDNA was synthesized using the cDNA synthesis kit ImProm‐II reverse transcriptase kit (Promega, Madison, WI, USA). Real‐time PCR was performed with 50 ng cDNA, 10 pM primers and SYBR Green I at 95°C for 10 min, 40 cycles at 95°C for 15 s, and 60°C for 60 s. The products of the PCR were quantified using the StepOnePlus Real‐Time PCR analysis software (Applied Biosystems). The primers sequences are showed in Table 1.

TABLE 1.

Polymerase chain reaction (PCR) primers used in this study

Gene Oligonucleotide primers
Mouse GAPDH AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA
Mouse collagen I GAGCGGAGAGTACTGGATCG GTTCGGGCTGATGTACCAGT
Mouse collagen III CACCTGCTCCTGTGCTTCCT ACCTGGTTGTCCTGGAAGGC
Mouse elastin GCTACTGCTTGGTGGAGAATG CCCTTGGAGATGGAGACTGT
Mouse MMP‐1 GTTGGAGCAGGCAGGAAGG TAGCAGCCCAGAGAAGCAAC
Mouse TIMP‐1 TCCCCAGAAATCAACGAGAC CATTTCCCACAGCCTTGAAT

Abbreviations: MMP, matrix metalloproteinase, TIMP, tissue inhibitor of metalloproteinase.

2.4. Immunohistochemistry

Frozen section slides were fixed in 4% paraformaldehyde with 0.1% Triton X‐100 for 10 min. After 30 min of treatment in 3% H2O2 to remove nonspecific signals, blocking was performed in 5% donkey serum (Abcam, Cambridge, UK) for 1 h after washing. Sections were incubated with collagen type I (1:100 dilution; Invitrogen), collagen type III (1:100 dilution; Invitrogen), elastin (1:100 dilution; Bioss Antibodies, Woburn, MA, USA), matrix metalloproteinase (MMP‐1; 1:100 dilution; Invitrogen), and tissue inhibitor of metalloproteinase (TIMP‐1; 1:100 dilution; Bioss Antibodies) antibodies at 4°C overnight, washed three times with PBS, and incubated with horseradish peroxidase (HRP)‐conjugated donkey anti‐rabbit antibody for 1 h. After washing with PBS, AEC+ high sensitivity substrate chromogen (DAKO, Glostrup, Denmark) was used as color developer for HRP. Hematoxylin (DAKO) was used for counterstaining.

2.5. Statistical analysis

All statistical analyses were performed using the SPSS 22.0 software (IBM, Armonk, NY, USA). The results were expressed as the mean ± standard error of means. The results of multiple group analysis were analyzed using one‐way analysis of variance. Data were a representative of at least two independent experiments. Differences were considered to be statistically significant differences where p < 0.05.

3. RESULTS

3.1. Skin wrinkles were decreased after treatment with the HIFU device

Immediately after scarifying mice, images of the back skin mice treated with HIFU device were taken and compared to the vehicle control at the same magnification and location (Nikon D7000, Japan). Mouse skin wrinkles were decreased after treatment with the HIFU device at both 30 and 60 s for 2 weeks compared with control (Figure 2).

FIGURE 2.

FIGURE 2

Skin wrinkles were decreased after treatment with the high‐intensity focused ultrasound (HIFU) device on mice

3.2. Dermal thickness was increased after treatment with the HIFU device

As the skin develops dermal thinning with age, wrinkles appearance tends to increase. As previously reported, the dermal thickness of old mice was thinner than that of young mice. Dermal thickness was increased after all treatment options with the HIFU device at of 30 and 60 s for 1 week or 30 and 60 s per day for 2 weeks in old mice (*p < 0.05) (Figure 3A). No significant difference was found between the 30 and 60 s per day treatments. In addition, no significant difference was found between the 1‐ and 2‐week treatment periods. Furthermore no significant differences were found between young mice and all treated mice.

FIGURE 3.

FIGURE 3

Measurement of dermal thickness after treatment with the high‐intensity focused ultrasound (HIFU) device (30 or 60 s per day for 1 week, 30 or 60 s per day for 2 weeks). (A) Dermal thickness was increased after all treatment options with the HIFU device. Data are the means ± SEM (n = 5) (*p < 0.05). (B) Histological examination by trichrome staining showed a denser and thicker dermis after all treatment options with the HIFU device

Next, trichrome staining was used to analyze the changes in arrangement and structure of collagen. Histological examination by trichrome staining showed that the dermis was denser and thicker in all mice that underwent all treatment options (Figure 3B). The dermis of young mice and all treated mice were all similar on histological examination.

3.3. Collagen fibers and elastin were increased after treatment with the HIFU device

Gene expressions of collagen types I and III and elastin were increased after all treatment options with the HIFU device at 30 and 60 s per day for 1 week or 30 and 60 s per day for 2 weeks (*p < 0.05) (Figure 4A–C). No significant differences were found between the 30 and 60 s per day treatment. In addition, no significant difference was found between the 1‐ and 2‐week duration. Furthermore, no significant differences were found between young mice and all treated mice.

FIGURE 4.

FIGURE 4

Expression of collagen fibers and elastin after treatment with the high‐intensity focused ultrasound (HIFU) device (30 or 60 s per day for 1 week, 30 or 60 s per day for 2 weeks). (A–C) Gene expressions of collagen types I and III and elastin were increased after all treatment options with HIFU device. The mRNA expression levels were measured by qPCR and normalized with GAPDH. Data are the means ± SEM (n = 5) (*p < 0.05). (D) Protein expressions of collagen types I and III and elastin were increased after all treatment options with HIFU device. Representative histologic section findings of mouse tissue immunostained with collagen type I (upper panels), collagen type III (mid panels) and elastin (lower panels) at 1 and 2 weeks after HIFU treatment

Immunohistochemical findings revealed that protein expressions of collagen types I and III and elastin were increased after all treatment options with an HIFU device at 30 and 60 s per day for 1 week or 30 and 60 s per day for 2 weeks compared with control mice (Figure 4D). Furthermore, protein expressions of collagen types I and III and elastin were similar between young mice and all treated mice.

3.4. MMP‐1 and TIMP‐1 were decreased after treatment with an HIFU device

Degradation of collagen and elastin in aged skin is related to increased MMP and TIMP expression. Gene expressions of MMP‐1 and TIMP‐1 were decreased after all treatment options with the device at 30 and 60 s per day for 1 week or 30 and 60 s per day for 2 weeks (*p < 0.05) (Figure 5A,B). No significant difference was found between the 30 and 60 s per day treatment, as well as differences were found between young mice and treated mice.

FIGURE 5.

FIGURE 5

Expression of matrix metalloproteinase (MMP)‐1 and tissue inhibitor of metalloproteinase (TIMP)‐1 after treatment with the high‐intensity focused ultrasound (HIFU) device (30 or 60 s per day for 1 week, 30 or 60 s per day for 2 weeks). (A and B) Gene expressions of MMP‐1 and TIMP‐1 were decreased after all treatment options with HIFU device. The mRNA expression levels were measured by qPCR and normalized with GAPDH. Data are the means ± SEM (n = 5) (*p < 0.05). (C) Protein expressions of MMP‐1 and TIMP‐1 in the mouse skin were decreased after all treatment options with HIFU device. Representative histologic section findings of mouse tissue immunostained with MMP‐1 (upper panels) and TIMP‐1 (lower panels) at 1 and 2 weeks after HIFU treatment

Immunohistochemical analysis showed that the protein expressions of MMP‐1 and TIMP‐1 in treated mice were decreased after all treatment options with an HIFU device at 30 and 60 s per day for 1 week or 30 and 60 s per day for 2 weeks than control mice (Figure 5C).

4. DISCUSSION

HIFU is one of the effective therapeutic modalities for skin wrinkles reduction. Many researchers have tried to develop an effective, simple, and practical HIFU for the reduction of skin wrinkles. Choi et al. 13 reported that HIFU using transducers with a lower frequency and deep focal depth offers safe and effective treatment for dermal and subdermal tightening. In the study, all subjects were treated with HIFU to both cheeks, upper arms, lower abdomen, thighs, and calves using a variety of probes: 7 MHz, 1.5 mm focal depth; 2 MHz, 3.0 mm focal depth; 2 MHz, 4.5 mm focal depth; 2 MHz, 6.0 mm focal depth, and 2 MHz, 9.0 mm focal depth. They assessed results using the investigator and subject global aesthetic improvement scale, a cutometer, and a visual analog scale. Moreover, Jung et al. 14 conducted a clinical trial comparing the efficacy and safety of two HIFU devices for facial skin tightening using qualitative and quantitative assessments of both clinicians and patients. They concluded that both HIFU devices can be used safely and effectively for facial skin tightening. Furthermore, Ko et al. 15 reported that HIFU improves skin elasticity and clinical contouring of the face and body. Park et al. 16 concluded that HIFU can be used to improved facial wrinkles and skin laxity in Asian skin, especially around the jawline, cheeks, and perioral areas.

In addition, researchers are trying to develop a device that combines the function of HIFU with other functions for better skin wrinkle improvement. Skin wrinkles due to multifactorial causes need a multifactorial approach for treatment. 17 Combinations of neuromodulators, three‐ and two‐dimensional fillers, and energy‐based devices or surgical interventions can be used for treatment. HIFU can also be combined with dermal fillers for facial skin tightening. 18 Nam et al. 19 reported the synergistic effect of HIFU and low‐fluence Q‐switched Nd:YAG laser in the treatment of aging skin in the neck. In another study, the combination of HIFU and fractional CO2 laser resurfacing was safe and effective for lifting and tightening the face and neck. 20 HIFU can also be applied with botulinum toxin and dermal filler to improve lines and wrinkles. 21

Although numerous clinical trials on HIFU with or without combination therapy have been conducted, studies that evaluated the histological, immunohistochemical, and molecular effects of HIFU are limited. Casabona and Michalany 22 performed a clinical and histological evaluation of neocollagenesis after treatment with microfocused ultrasound and filler. They showed the enhancement and quality of the new collagen and elastin fibers in histological findings. Interestingly, a report on changes in circulating immunosuppressive cytokine levels in cancer patients after treatment with HIFU was introduced. 23

In this study, we demonstrated that the novel home‐used HIFU device we developed was safe and effective in the treatment of skin wrinkles. Skin wrinkles on mice were improved after treatment with the device. The improvement of skin wrinkles was proved with histological findings, real‐time PCR, and immunohistochemistry. Trichrome staining showed increased dermal thickness, whereas real‐time PCR and immunohistochemistry revealed an increase in the gene and protein expressions of collagen I and III and a decrease in the gene and protein expression of MMP‐1 and TIMP‐1. As previously reported, there are limitations in evaluating the anti‐wrinkle effect only with increased expression of collagen and elastin and decreased expression of MMP and TIMP, but these are currently used as wrinkle‐improving markers. Furthermore, it is necessary to gradually evaluate whether the HIFU we developed is effective for humans.

Based on these preliminary results in mouse, this HIFU device might prove useful in humans. Future studies are needed to evaluate whether these exploratory results can be extrapolated into humans.

CONFLICTS OF INTEREST

The authors have no conflicts of interest to disclose.

ACKNOWLEDGMENTS

This research was supported by a grant from the Regional Industry R&D Project through the Korea Institute for Advancement of Technology, funded by the Ministry of SMEs and Startups, Republic of Korea (grant number: S3060290).

Kwack MH, Lee WJ. Efficacy of a home‐used high‐intensity focused ultrasound device on wrinkle reduction. Skin Res Technol. 2023;29:e13266. 10.1111/srt.13266

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  • 1. Zouboulis CC, Ganceviciene R, Liakou AI, Theodoridis A, Elewa R, Makrantonaki E. Aesthetic aspects of skin aging, prevention, and local treatment. Clin Dermatol. 2019;37:365‐372. [DOI] [PubMed] [Google Scholar]
  • 2. Small R. Botulinum toxin injection for facial wrinkles. Am Fam Physician. 2014;90:168‐175. [PubMed] [Google Scholar]
  • 3. Ballin AC, Brandt FS, Cazzaniga A. Dermal fillers: an update. Am J Clin Dermatol. 2015;16:271‐283. [DOI] [PubMed] [Google Scholar]
  • 4. Atiyeh BS, Chahine F, Ghanem OA. Percutaneous thread lift facial rejuvenation: literature review and evidence‐based analysis. Aesthetic Plast Surg. 2021;45:1540‐1550. [DOI] [PubMed] [Google Scholar]
  • 5. Li D, Lin SB, Cheng B. Complications and posttreatment care following invasive laser skin resurfacing: a review. J Cosmet Laser Ther. 2018;20:168‐178. [DOI] [PubMed] [Google Scholar]
  • 6. Robati RM, Asadi E. Efficacy and safety of fractional CO(2) laser versus fractional Er:YAG laser in the treatment of facial skin wrinkles. Lasers Med Sci. 2017;32:283‐289. [DOI] [PubMed] [Google Scholar]
  • 7. Saluja R, Gentile RD. Picosecond laser: tattoos and skin rejuvenation. Facial Plast Surg Clin North Am. 2020;28:87‐100. [DOI] [PubMed] [Google Scholar]
  • 8. Beasley KL, Weiss RA. Radiofrequency in cosmetic dermatology. Dermatol Clin. 2014;32:79‐90. [DOI] [PubMed] [Google Scholar]
  • 9. Lee JC, Daniels MA, Roth MZ. Mesotherapy, microneedling, and chemical peels. Clin Plast Surg. 2016;43:583‐595. [DOI] [PubMed] [Google Scholar]
  • 10. Alster TS, Graham PM. Microneedling: a review and practical guide. Dermatol Surg. 2018;44:397‐404. [DOI] [PubMed] [Google Scholar]
  • 11. Maloney E, Hwang JH. Emerging HIFU applications in cancer therapy. Int J Hyperthermia. 2015;3:302‐309. [DOI] [PubMed] [Google Scholar]
  • 12. Moosa S, Martínez‐Fernández R, Elias WJ, Del Alamo M, Eisenberg HM, Fishman PS. The role of high‐intensity focused ultrasound as a symptomatic treatment for Parkinson's disease. Mov Disord. 2019;34:1243‐1251 [DOI] [PubMed] [Google Scholar]
  • 13. Choi SY, No YA, Kim SY, Kim BJ, Kim MN. Tightening effects of high‐intensity focused ultrasound on body skin and subdermal tissue: a pilot study. J Eur Acad Dermatol Venereol. 2016;30:1599‐1602. [DOI] [PubMed] [Google Scholar]
  • 14. Jung HJ, Min J, Seo HM, Kim WS. Comparison of effect between high intense focused ultrasound devices for facial tightening: evaluator‐blinded, split‐face study. J Cosmet Laser Ther. 2016;18:252‐256. [DOI] [PubMed] [Google Scholar]
  • 15. Ko EJ, Hong JY, Kwon TR, et al. Efficacy and safety of non‐invasive body tightening with high‐intensity focused ultrasound (HIFU). Skin Res Technol. 2017;23:558‐562. [DOI] [PubMed] [Google Scholar]
  • 16. Park H, Kim E, Kim J, Ro Y, Ko J. High‐intensity focused ultrasound for the treatment of wrinkles and skin laxity in seven different facial areas. Ann Dermatol. 2015;27:688‐693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Carruthers J, Carruthers A. A multimodal approach to rejuvenation of the lower face. Dermatol Surg. 2016;42(suppl 2):S89‐S93. [DOI] [PubMed] [Google Scholar]
  • 18. Casabona G, Kaye K. Facial skin tightening with microfocused ultrasound and dermal fillers: considerations for patient selection and outcomes. J Drugs Dermatol. 2019;18:1075‐1082. [PubMed] [Google Scholar]
  • 19. Nam JH, Choi YJ, Lim JY, Min JH, Kim WS. Synergistic effect of high‐intensity focused ultrasound and low‐fluence Q‐switched Nd:YAG laser in the treatment of the aging neck and decolletage. Lasers Med Sci. 2017;32:109‐116. [DOI] [PubMed] [Google Scholar]
  • 20. Woodward JA, Fabi SG, Alster T, Colón‐Acevedo B. Safety and efficacy of combining microfocused ultrasound with fractional CO2 laser resurfacing for lifting and tightening the face and neck. Dermatol Surg. 2014;40(suppl 12):S190‐S193. [DOI] [PubMed] [Google Scholar]
  • 21. Fabi SG, Goldman MP, Mills DC, et al. Combining microfocused ultrasound with botulinum toxin and temporary and semi‐permanent dermal fillers: safety and current use. Dermatol Surg. 2016;42(suppl 2):S168‐S176. [DOI] [PubMed] [Google Scholar]
  • 22. Casabona G, Michalany N. Microfocused ultrasound with visualization and fillers for increased neocollagenesis: clinical and histological evaluation. Dermatol Surg. 2014;40(suppl 12):S194‐S198. [DOI] [PubMed] [Google Scholar]
  • 23. Zhou Q, Zhu XQ, Zhang J, Xu ZL, Lu P, Wu F. Changes in circulating immunosuppressive cytokine levels of cancer patients after high intensity focused ultrasound treatment. Ultrasound Med Biol. 2008;34:81‐87. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.


Articles from Skin Research and Technology are provided here courtesy of International Society of Biophysics and Imaging of the Skin, International Society for Digital Imaging of the Skin, and John Wiley & Sons Ltd

RESOURCES