Downregulation of Sonic hedgehog signaling induces G2‐arrest in genital warts

Abstract

Background

Human papillomavirus (HPV) infected keratinocyte dysfunction results in the formation of genital warts, and the specific role of Sonic hedgehog (SHh) signaling in genital warts remains elusive. Thus, this study aimed to identify the correlation between wart formation and SHh signaling.

Materials and methods

In this study, nine male patients with genital warts were recruited, and the expression of SHh and its downstream signal molecules Patched‐1 and GLI family zinc finger 1 (Ptch1 and Gli1) was detected. Moreover, G2‐phase cells in the collected genital warts samples were assessed with normal foreskin samples as a comparison. HPV6/11 were detected via in situ hybridization (ISH), and SHh expression of the corresponding paraffin sections was determined via immunohistochemical staining (IHC). In addition, an in vitro down‐regulated SHh model was constructed by siRNA transfection of the HaCaT cell line, and the cell cycle was detected at 36 h by flow cytometry with propidium iodide staining.

Results

SHh, Ptch1, and Gli1 in warts were significantly downregulated in the condyloma acuminatum (CA) group compared to the normal foreskin group. G2‐phase cells in the middle section of the spinous layer of CA wart tissues were significantly increased. Moreover, the expression of HPV‐DNA was amplified and negatively correlated with SHh activity in CA wart tissues. Lastly, the downregulation of SHh‐induced G2 arrest in vitro.

Conclusions

The downregulation of the SHh signaling promotes HPV replication and the formation of warts by inducing G2/M arrest in the keratinocytes of CA.

1. INTRODUCTION

Condyloma acuminatum (CA) is a sexually transmitted disease caused by the infection of low‐risk human papillomavirus (such as HPV6/11), with clinical manifestations on the anus or genital papillary or verrucous skin lesions. ¹ There is no unified standard for the treatment of CA worldwide, and most topical CA treatments aim to eliminate warts. ² Nonetheless, the recurrence rate remains as high as 67%. ³ In recent years, CA has been shown to possess high infectivity, incidence, and recurrence rates. ⁴ Therefore, it is crucial to gain a better understanding of the molecular mechanism by which warts are formed in keratinocytes to develop personalized treatments and preventive strategies.

More and more researchers have shed light on the role of the Sonic hedgehog (SHh) pathway in mediating the proliferation of keratinocytes (KCs) and skin renewal. ⁵ , ⁶ , ⁷ KCs are the main cell components of the epidermis, and their normal proliferation and differentiation form the basis for skin homeostasis. ⁸ Aberrant proliferation, apoptosis, and loss of KCs are conducive to the occurrence and development of several skin diseases, including basal cell carcinoma (BCC), caused by abnormal and excessive proliferation of basal layer KCs, which illustrates that the SHh signaling pathway plays a crucial role in mediating the proliferation of KCs. ⁹

SHh, a member of the Hedgehog (Hh) family, was first discovered by Christiane and Eric in 1980 in a study on the effect of gene mutations on cell division in drosophila ¹⁰ . SHh, a secreted glycoprotein, can bind with receptors on the surface of the cell membrane—patched (Ptch)/smoothened (Smo) complex, ¹¹ thereby disintegrating it. SHh further activates Smo and increases the abundance of the suppressor of fused (sufu) ‐Gli compound ¹² in the cell membrane, allowing Gli to penetrate the nucleus and bind with the Gli transcription binding sites of cell DNA and further upregulating the expression of Ptch‐ and Gli‐related genes, as well as other target genes (cell cycle‐related: Cyclin D, Cyclin E; Apoptosis‐related: BCL‐2 and more). ¹³ Overall, this gives rise to a series of orderly downstream activities such as alteration in cell proliferation. ¹² , ¹⁴

Clinically, HPV is typically classified as high‐risk HPV (HR‐HPV) or low‐risk HPV (LR‐HPV) according to its risk of carcinogenicity. Some researchers have attempted to elucidate the relationship between intracellular SHh signaling pathways and infection‐related tumor cell proliferation in epithelial cells exposed to HR‐HPV infection. For instance, studies of head and neck tumors and cervical cancer related to HR‐HPV infection exposed that the proliferation of cancer cells induced by the E6 and E7 proteins of HPV16 was related to the up‐regulation of SHh signaling, ¹⁵ , ¹⁶ , ¹⁷ thereby leading to the elimination of the HPV gene. ¹⁸ Moreover, Gli1, a downstream transcription factor of SHh, can inhibit the replication of HPV18. ¹⁹ The researchers also pointed out that activation of SHh is not conducive to the replication and amplification of HPV. Studies on the intracellular expansion of HR‐HPV in infected cells have revealed that HPV needs to complete its life cycle, DNA replication, viral packaging, and release and is reliant on keratinocyte proliferation and differentiation. ²⁰ Moreover, in the middle and upper layers of KCs, the HPV‐DNA expanded substantially during the G2 phase. ²¹ Other studies on HPV replication have reported that the G2 phase checkpoint of cells was activated by the expression of the E1 and E2 proteins of HPV, which then mediated the DNA damage response (DDR). Given that the G2 phase marker, Cyclin B1, is highly expressed in the cytoplasm and is accompanied by the amplification of the HPV nucleus, the G2 phase is a critical period for HPV replication. ²² , ²³ , ²⁴

In case of fluctuations in the internal and external environment of cells, this either activates or inhibits the SHh pathway, and thus their physiological state is also altered to adapt to their cycle regulation and proliferation needs in the different environments. ²⁵ Earlier studies have established that the activated SHh pathway can up‐regulate the expression of Cyclin D and Cyclin E, shift cell transformation from the G1 phase to the S phase, and mediate cell proliferation. ¹² , ¹³ It has also been reported that the up‐regulation of SHh in some tumor cells is representative of the rapid transformation of the G2/M phase, which disrupts the growth cycle of healthy cells and leads to the malignant proliferation of cells. ²⁶ The discrepancy between the two findings may be attributed to different research purposes or methods. At the same time, prior studies have reported that inhibition of the SHh signaling pathway may correlate with G2/M phase arrest, ²⁷ and the reason may be that Ptch, when not activated by its ligand, binds to Cyclin B1 and prevents it from penetrating the nucleus. ²⁸ Therefore, this study aimed to investigate specific changes in the expression of the SHh signaling in KCs to elucidate the underlying mechanism by which HPV‐infected KCs form CA warts.

HPV infection is considered a risk factor for wart development. To date, the SHh level and its impact on the epithelial cells in LR‐HPV infection have not been reported. Based on the above, we investigated the expression and role of the SHh signaling pathway in the KCs of CA.

2. MATERIALS AND METHODS

2.1. Specimens

In this study, the warts of nine male patients with CA were assigned to the CA group, and the male foreskin tissue was assigned to the control group. CA patients were detected by HPV6/11 polymerase chain reaction (PCR) and met the inclusion criteria. Meanwhile, all participants signed the informed consent form, and the study was conducted with the approval of the Ethics committee of Tongji hospital. CA warts were carefully excised with scissors or surgical blades, collected into a cryopreservation tube, and stored in liquid nitrogen for transportation and further analysis.

2.2. Immunohistochemical staining

The collected samples were fixed in 4% paraformaldehyde and then embedded in paraffin. Immunohistochemical staining was performed using 4 μm thick wart and foreskin sections. First, the sections were placed on a microscope slide, baked for about 30 min, deparaffinized in xylene and ethanol, and subsequently placed into the immunohisto stainer (Leica bond‐max). The sections were then incubated with 3% H₂O₂ solution for 20 min to inhibit endogenous peroxidase. Thereafter, the sections were treated with 3% goat serum for 30 min and then incubated with the primary antibodies, namely rabbit anti‐SHh monoclonal antibody (Abcam, ab53281, diluted at 1:500), anti‐Ptch1 polyclonal antibody (Abcam, ab53715, diluted 1:100), a polyclonal antibody of Gli1 (Abcam, ab217326, diluted 1:800), and anti‐Cyclin B1 monoclonal antibody (Abcam, ab32053, diluted 1:250). After removing the primary antibodies, they were incubated with the secondary antibody (DAKO, antGene ANT058) for 25 min. The sections without primary antibodies were used as the negative control. Sections were stained in diaminobenzidine solution, counterstained in hematoxylin solution, blued in bluing reagent, dehydrated in a series of ethanol and xylene, and resin sealed. The slides were visualized using a light microscope. The average optical density (AOD) of the photos was calculated by the Image J software.

2.3. In situ hybridization

The sections were included in in situ hybridization (ISH), similar to the steps for immunohistochemical staining (IHC) – the sections were deparaffinized in xylene and ethanol and tested with the Digoxin Staining kit for HPV6/11 subtypes (Triplex international bioscience, China), following the manufacturer's instructions using the Leica Bond‐Max automated immuno‐histo stainer. The probe cocktail contains two types of full‐length RNA probes, demonstrating positive hybridization to the two genotypes for low risk: 6 and 11. After the sections were sealed by resin and reviewed, ISH sections corresponded with the IHC slides at almost the same “position” (continuous section slides) as the samples.

2.4. Cell culture

The human immortal keratinocyte HaCaT cell line was obtained from the China Center for Type Culture Collection (Wuhan, China) and cultured as directed by the directions.

2.5. RNA interference

The small interference RNA sequences of SHh‐gene, as well as negative and positive control sequences, were designed and synthesized by RiboBio (Guangzhou, China). The riboFECT CP Transfection Kit (RiboBio Guangzhou, China) was used for cell siRNA transfection according to the manufacturer's instructions. Interference was validated by quantitative reverse transcription (qRT)‐PCR and western blot analysis. The details of sequences are as follows: SHh^#1(ACTCCGAGCGATTTAAGGA), SHh^#2(CGAGCGATTTAAGGAACTC), siGAPDH(siP0000001‐1‐5, RiboBio Co., Ltd. Guangzhou, China).

2.6. Western blotting analysis

The cells or samples were lysed in precooled RIPA lysate. The supernatant was collected after centrifugation at 12,000 rpm and a temperature of 4°C for 15 min. The loading amount was determined according to the concentration determined by BCA Kit(Boster, AR0197. The lysate was added to the loading buffer, separated by SDS‐PAGE, and transferred to the PVDF membrane. Finally, the membrane was incubated at 4°C overnight with the following antibodies (anti‐SHh diluted 1:2000, anti‐Ptch1 diluted 1:1000, anti‐Gli1 diluted 1:4000, anti‐β‐actin), and treated with IgG‐HRP and the bands were visualized by enhanced chemiluminescence.

2.7. RNA preparation and qRT‐PCR

RNA was extracted using NcmZol Reagent (NCM Biotech) according to the manufacturer's instructions. cDNA was synthesized using the HifairII 1st Strand cDNA Synthesis SuperMix for qPCR (YEASON, 11123ES60) kit. qRT‐PCR was performed using HieffUNICON Power qPCR SYBRGreen Master Mix on the Bio‐Rad qPCR system. The relative expression of the target gene was represented by the fold change relative to β‐actin. All experiments were performed in triplicate. The qPCR primers used in this study are presented in Table 1.

TABLE 1.

List of primers in a quantitative polymerase chain reaction (qPCR)

Gene	Forward primer	Reverse primer
h‐SHh	CTCGCTGCTGGTATGCTCG	ATCGCTCGGAGTTTCTGGAGA
h‐Ptch1	GCTGCACTACTTCAGAGACTGG	CACCAGGAGTTTGTAGGCAAGG
h‐Gli1	AGCCTTCAGCAATGCCAGTGAC	GTCAGGACCATGCACTGTCTTG
h‐Smo	TGCTCATCGTGGGAGGCTACTT	ATCTTGCTGGCAGCCTTCTCAC
h‐GAPDH	TCTCCTCTGACTTCAACAGC	GTCTCTCTCTTCCTCTTGTG
h‐β‐Actin	AGTCCTCTCCCAAGTCCAC	ACCAAAAGCCTTCATACATCTC

2.8. Cell cycle analysis

HaCaT cells were cultured in 6 cm culture dishes at a density of 8×10⁵ cells and transfected with siRNA for 24 and 48 hours. HaCaT cells were digested with trypsin, collected into a centrifuge tube, and centrifuged at 2000 rpm for 5 min. After washing with 1×PBS, HaCaT cells were added to a pre‐cooled 70% ethanol PBS solution and fixed at 4°C overnight. Afterward, the cells were treated with propidium iodide and RNase solutions (KGA511, KeyGen Biotech) at a 9:1 ratio. After being stained for 1 h at room temperature, the cells were filtered into the flow tube with a 200 mesh filter, then analyzed with a flow cytometer, and analyzed with ModFit software.

2.9. Statistical analysis

Graphpad Prism 8.0 was used for statistical analysis. The student's t‐test was used to compare normally distributed data between the two groups. The results were expressed as mean ± SEM, and p < 0.05 was considered statistically significant.

3. RESULTS

3.1. Downregulation of SHh pathway molecules in KCs of genital warts

Immunohistochemical results exposed that the expression of SHh as well as its downstream molecules Ptch1 and Gli1 in KCs of healthy skin tissues were significantly higher than that in genital wart tissues (p < 0.05) via AOD comparison (Figure 1A). At the same time, the mRNA and protein levels of SHh and its related molecules were analyzed by qRT‐PCR (Figure 1B) and western blotting (Figure 1C). The results were consistent with immunohistochemical results, validating that the SHh pathway was downregulated in CA warts.

FIGURE 1.

Sonic hedgehog (SHh) and its downstream molecules are downregulated in condyloma acuminatum (CA) warts. (A) CA warts (n = 9) and normal foreskin (n = 9) were immunohistochemically stained with SHh, Ptch1 and Gli1(×100). Data expressed as average optical density (AOD) value. (B) The quantitative reverse transcription polymerase chain reaction (qRT‐PCR) of the mRNA expression in CA warts (n = 9) and normal foreskin (n = 8). Gli1, SHh, Ptch1, and Smo expression were evaluated in the tissues isolated from normal and patients. Representative images are shown. Gli1, SHh, Ptch1, and Smo expression are all significantly decreased in CA warts. (C) The protein levels of SHh, Gli1, and Ptch1 detected by Western blot in normal foreskin tissue and CA tissue, respectively. Data are expressed as mean ± SEM, and each dot represents a clinical sample (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

3.2. The number of G2‐phase cells increased in the spinous layer of warts

To determine the reason behind the downregulation in the expression of SHh in CA tissues and whether the HPV‐infected KCs would be in the G2‐arrest state, we detected the level of cyclin B1, the core cycle protein in the G2/M phase, in the healthy skin and wart tissue samples using immunohistochemical staining. The results demonstrated that cells with upregulated cyclin B1 expression, which stayed at the G2 phase, had shallow cytoplasm stained and were increased in the spinous layer of warts compared with the healthy skin tissues (Figure 2).

FIGURE 2.

The G2‐phase cells are increased in condyloma acuminatum (CA) warts. CA warts and normal foreskin were immunohistochemically stained with Cyclin B1 and Sonic hedgehog (SHh), and hybridized in situ with HPV6/11‐DNA probe (×40, ×100). Normal foreskin (A) showed less cyclin B1 keratinocytes (KCs) than CA warts (B). Patterns of SHh immunohistochemical staining (IHC) showed more brown in normal skin (C) than it presents in CA warts (D), and HPV6/11 in situ hybridization (ISH) is tested positive in CA warts (F), while negative results shown in genital skin (E)

3.3. Negative correlation between HPV6/11‐DNA expression and SHh

Numerous previous research described that HPV‐DNA replication occurs in the G2 phase. Meanwhile, our study found that the SHh pathway was downregulated, while the number of cells in the G2 phase was higher in wart tissues, which led us to speculate on the likely connection between HPV replication and the SHh signaling pathway. Thus, paraffin sections were used to merge the replication of HPV6/11‐DNA with the expression of SHh (Figure 2), and SHh expression levels were compared at parts of HPV+ (HPV high‐replicated site) and HPV− (HPV low‐replicated site) (Figure 3A). The results uncovered that the downregulation of SHh was correlated with HPV6/11‐DNA replication (p < 0.05).

FIGURE 3.

Negative correlation between replication of human papillomavirus (HPV) and Sonic hedgehog (SHh). (A) Immunohistochemistry of SHh and HPV6/11‐DNA in situ hybridization in the almost same level of condyloma acuminatum (CA) warts (n = 9). (B) Five fields of HPV low‐replicated site (HPV−) and HPV high‐replicated site (HPV+) in nine sections of CA were randomly chosen under the magnification of 200 and merged with the same position in the continuous section of SHh. Data were expressed as the average optical density (AOD) value of SHh (mean ± SEM), and each dot represented a mean AOD value of five positions of each clinical CA sample (**p < 0.01)

3.4. Silencing of SHh leads to G2 arrest

In the in vitro research model, the HaCaT cell line was employed as KCs, and we interfered with the expression of SHh in these cells. First, we verified the suitability of our transfection method by a positive control group of siGAPDH and then detected the interference efficiency of SHh by qPCR compared with the negative control group. A downregulation ratio of SHh mRNA between the si group and NC group exceeding 70% indicated that the transfected cell line was successfully established (Figure 4A). Meanwhile, a western blot was used to further verify transfection efficiency to ensure that SHh expression was knocked down in HaCaT cells. The number of cells in the G2/M phase in SHh‐interferenced HaCaT cells was significantly increased (p < 0.05) compared with that in the negative control group (Figure 4B), with insignificant differences in the number of cells in the S and G1/G0 phases between the two groups. Collectively, these findings demonstrate that a G2‐arrested state may be achieved by downregulating the expression of SHh in HPV‐infected KCs to complete HPV‐DNA replication and promote the formation of warts.

FIGURE 4.

Downregulation of Sonic hedgehog (SHh) induces G2 arrest in HaCaT. (A) HaCaT cells transfected with SHh siRNA were detected for the expression of SHh and Gli1 by qRT‐PCR and western blotting. siRNA: siSHh group, NC: negative control. (B) Cell cycle of the SHh siRNA transfected HaCaT was determined by propidium iodide (PI) staining flow cytometer analysis in 36 h. Data are expressed as mean ± SEM, and n = 3 independent experiments (*p < 0.05)

4. DISCUSSION

Condyloma acuminatum is positively correlated with HPV infection (mainly low‐risk HPV) ¹ . If HPV‐infected KCs of the genital skin are able to evade the immune system, they are likely to result in the formation of warts. Many patients experience an increase in the size of warts, but the specific molecular mechanism remains elusive. Thus, the recommended treatment of CA is the excision of warts. ³ Nonetheless, this treatment has a high recurrence rate, given the inability of wart excision to completely eradicate HPV and inhibit residual HPV replication. In terms of the pathogenetic process of CA, from HPV infection to wart body formation and the increased size, it showed that large amounts of HPV particles are produced on the wart surface, as well as the infected cell proliferation and accumulation, which leads us to more curious about the wart body formation mechanism ²⁹ . The physiological and pathological processes of cells are subject to the activation, inhibition, and equilibrium of various signaling pathways under specific environmental conditions. As is well documented, the SHh pathway modulates embryonic and tumor development and plays an instrumental role in the skin germinal process, the development of KCs, and the immune response of the skin. ³⁰ It has been reported that the SHh pathway is implicated in mediating excessive proliferation and immune impaction of KCs. ⁶ , ³¹ Due to the universality of the SHh signaling pathway in cyto‐pathophysiology, this study analyzed alterations in the intracellular SHh pathway to explore the specific molecular mechanism behind CA wart formation and the mass replication of HPV.

Our results exposed that patients with CA had a lower expression of SHh, Ptch1, and Gli1 compared with normal foreskin tissues. Next, immunohistochemical staining demonstrated that the expression of cyclin B1 cells increased in the central stratum spinosum of CA warts with shallow cytoplasm, which showed that the G2 phase was arrested in warts. Similar to a study reporting G2 phase arrest during HR‐HPV replication, ²¹ , ³² this study indicated that HPV infection is associated with SHh down‐regulation and its main function in the KCs infected with LR‐HPV is to regulate the cell cycle rather than stimulate cell proliferation. Therefore, it is reasonable to speculate that HPV creates a G2‐arrested environment in KCs of CA warts to facilitate replication. Moreover, HPV6/11‐DNA probe in situ hybridization showed HPV‐DNA replication near the upper epidermis of condyloma wart body tissues. With continuous sections to further study the relationship between the level of HPV6/11‐DNA and SHh, we found that in areas where SHh was downregulated, the nuclear HPV‐DNA replication volume was significantly increased. This suggests that the inhibition of the SHh pathway is beneficial to the DNA replication of HPV. Thereafter, the keratinocyte cell line HaCaT was used as a cell model, and the expression of the SHh gene was silenced with siRNA to observe the effect of SHh expression on KCs. The results showed that the down‐regulation of SHh led to increased G2 arrest in KCs. This suggests that the down‐regulation of SHh expression can arrest the cell cycle and promotes HPV replication.

Studies on the function of the HR‐HPV E7 protein uncovered that shortly after HPV enters the cell, E7 and E6 protein levels are downregulated, which can govern the regulation of cell activity to avoid cell apoptosis, increase the proliferation of cells carrying HPV, and enlarge the lesion. ³³ Our unpublished results showed that the HPV E7 protein did not downregulate the expression of SHh molecular proteins in HaCaTs. Furthermore, the marginal increase in the expression of SHh by E7 could inhibit apoptosis of KCs (ability to resist apoptosis and immune escape), increase cellular activity to promote cells shifting from the G1 phase to the S phase, and ensure the HPV genetic stable expression in the daughter cells. ⁶ , ¹³ During the replication stage of HPV, the expression of E7 gradually declines, while the E1 and E2 proteins of HPV coordinate to mediate the replication of HPV‐DNA. ³⁴ Besides, the E4 proteins promote the replication, packaging, and release of HPV and are related to the G2 phase arrest of infected cells. ³⁵ , ³⁶ , ³⁷ We postulate that HPV goes through different stages of different functional proteins in its life cycle to replicate its own gene and produce new HPV particles.

Previous studies on HR‐HPV have reported that HPV completes its own gene replication by mediating the G2 phase arrest of host cells. ³⁸ , ³⁹ The cell cycle is the process by which cells proliferate, and HPV is dependent on the host cell cycle. After invading cells, HPV regulates a series of processes, such as cell proliferation and cycle arrest through its viral proteins E1, E2, E4, E5, E6, and E7 to achieve immune escape, self‐replication, and packaging. ⁴⁰ HPV replication depends on the DNA replication material of the cell and occurs after cell DNA replication, resulting in G2 phase arrest. Meanwhile, SHh can govern the cell cycle in two ways: (1) When the SHh signal is downregulated, Cyclin B1 binds to Ptch, preventing the shift from the G2 phase to the M phase. (2) When the SHh signal is enhanced, the expression of Cyclin D and Cyclin E is increased, promoting the shift from the G1 phase to the S phase ¹¹ . Based on the aforementioned findings, we postulate that in CA, HPV may complete self‐amplification by down‐regulating the intracellular SHh pathway and its downstream molecules, thereby resulting in G2 phase arrest.

Vismodegib, the first approved drug for the treatment of BCC, was developed for selectively inhibiting the SHh pathway to reduce the excessive proliferation of KCs caused by SHh. This indicates that the SHh pathway is implicated in maintaining skin homeostasis. Abnormal activation of the SHh pathway can disrupt the growth cycle of normal cells, resulting in malignant cell proliferation, ²⁷ while down‐regulation of SHh can lead to G2 phase arrest, facilitating HPV replication. Moreover, activation of the SHh pathway at the proper time and level is necessary for the normal growth and differentiation of KCs ²⁵ . Therefore, regulating the expression of the local SHh pathway in CA, disrupting the G2‐blocking state of cells, and promoting the normal shedding of KCs are likely the keys to eliminating warts and inhibiting the replication of HPV so as to treating CA and preventing its recurrence.

Collectively, these results provide a new idea in the formation of genital warts – the inhibition of SHh pathway expression in KCs infected with HPV induces G2 phase arrest of the cell cycle, enabling the formation of warts and providing intracellular conditions for HPV replication. Furthermore, the activation of the SHh pathway may reverse G2 phase arrest, promoting the normal terminal differentiation and shedding of KCs, and suppressing HPV replication. Consequently, the restoration of the physiological expression of the local SHh pathway in CA is anticipated to become a novel strategy for eliminating warts and preventing their recurrence.

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.

Du X, Li S, Yang K, Cao Y. Downregulation of Sonic hedgehog signaling induces G2‐arrest in genital warts. Skin Res Technol. 2023;29:e13265. 10.1111/srt.13265

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding authors upon reasonable request.