Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2023 Jan 14;13:772. doi: 10.1038/s41598-023-28066-5

QTL mapping for seed density per silique in Brassica napus

Jifeng Zhu 1, Lei Lei 1, Weirong Wang 1, Jianxia Jiang 1, Xirong Zhou 1,
PMCID: PMC9840639  PMID: 36641540

Abstract

Seed density per silique (SDPS) and valid silique length (VSL) are two important yield-influencing traits in rapeseed. SDPS has a direct or indirect effect on rapeseed yield through its effect on seed per silique. In this study, a quantitative trait locus (QTL) for SDPS was detected on chromosome A09 using the QTL-seq approach and confirmed via linkage analysis in the mapping population obtained from 4263 × 3001 cross. Furthermore, one major QTL for SDPS (qSD.A9-1) was mapped to a 401.8 kb genomic interval between SSR markers Nys9A190 and Nys9A531. In the same genomic region, a QTL (qSL.A9) linked to VSL was also detected. The phenotypic variation of qSD.A9-1 and qSL.A9 was 53.1% and 47.6%, respectively. Results of the additive and dominant effects demonstrated that the expression of genes controlling SDPS and VSL were derived from a different parent in this population. Subsequently, we identified 56 genes that included 45 specific genes with exonic (splicing) variants. Further analysis identified specific genes containing mutations that may be related to seed density as well as silique length. These genes could be used for further studies to understand the details of these traits of rapeseed.

Subject terms: Genetic linkage study, Quantitative trait, Sequencing

Introduction

Rapeseed (Brassica napus L.) is a major oilseed crop and is also used as animal feed and in biodiesel production globally. Developing a high-yielding rapeseed variety has been an important goal to meet the increasing vegetable oil demand1,2. Rapeseed yield should be improved by increasing the seed number per silique (SPS), which is one of the three direct yield-related components, with the other being silique number and seed weight3. SPS is influenced by valid silique length (VSL) and seed density per silique (SDPS)4. VSL or SDPS has a significant positive relationship with SPS and affects rapeseed yield directly or indirectly through effects on SPS.

The silique traits, including SPS, SDPS, and VSL, are complex traits and controlled by quantitative trait loci (QTL) with high heritability4,5. Application of molecular markers and DNA sequencing are powerful tools to analyze genomes and map genes related to agronomic traits4,6. In recent years, QTL associated with silique traits have been identified by using different QTL mapping approaches in different populations of B. napus35,7,8. Hussain et al. (2022)8 detected an association of 13 loci with VSL in a genome-wide association study conducted using 331 core accessions planted in 10 environments. Wang et al. (2016)4 obtained 60 consensus QTL for six silique-related traits, including 11 for VSL, 6 for SPS, and 5 for SDPS, by consensus map construction and QTL comparison. Since B. napus has a complex genome, so far only a few QTL associated with SPS or VSL have been mapped or cloned and functionally characterized2,3,811. BnaA.ARF18, the first QTL that affects both seed weight and VSL was identified on chromosome A9 of rapeseed by fine mapping and association analysis11. In another study, BnaC9.SMG7b associated with SPS was identified on chromosome C9 of rapeseed using a map-based cloning strategy10. Furthermore, two other major QTL associated with VSL were identified on chromosome C7 (BnaC7.ROT3) and A9 (BnaA9.CYP78A9) of rapeseed and were cloned and characterized using map-based cloning2,9. Although a few candidate genes for silique traits have been cloned and functionally characterized, key candidate genes for silique traits, especially for SDPS, remain undiscovered. Thus, it is important to identify novel QTL related to SDPS and its related traits for fine mapping and cloning to accelerate the breeding of high-yield varieties of rapeseed.

Next-generation sequencing (NGS) is a useful tool to study the genetic architecture of complex traits in plants at low cost. QTL-seq is a method that combines bulked segregant analysis (BSA) and NGS to effectively and rapidly identify QTL for different traits6. The present study employed F2:3 populations derived from two inbred lines (3001 and 4263) with significant differences in silique traits, particularly SDPS, to detect the QTL for SDPS and its related traits by combining QTL-seq and linkage mapping. This study mainly aimed to (1) identify the genomic region of QTL for SDPS, (2) construct a linkage map of the candidate region with simple sequence repeat (SSR) markers, (3) validate and fine map major QTL using the linkage map by linkage association analysis, and (4) identify the candidate genes related to SDPS and its related traits by conditional QTL analysis.

Results

Phenotypic analysis and bulk construction

Phenotypic performance and frequency distribution of SDPS and its related traits in all F1 plants, F2 population, F3 families, and two parental lines were analyzed (Fig. 1 and Fig.S1). Two parental lines (3001 and 4263) had significantly different phenotypes of SDPS and its related traits; 4263 showed a higher SDPS and more seeds than 3001 in different years, whereas 3001 lines had longer siliques than 4263 lines. The SDPS of F1 (obtained from 3001 × 4263 cross [2.85 seeds/cm]) and F1′ (obtained from 4263 × 3001 cross [2.72 seeds/cm]) plants was lower than 4263 but higher than 3001, whereas the SPS and VSL of both plants obtained after the reciprocal crosses were significantly higher than those of two parental lines. Both F2 populations and F2:3 families demonstrated pronounced phenotypic variations and transgressive segregation of SDPS and its related traits. In the F2:3 families, the broad-sense heritability estimate of SPDS and VSL were 0.907 and 0.862, respectively, in the parent–offspring regression analysis, indicating that SPDS and VSL were stably inherited. In contrast, SPS demonstrated a broad-sense heritability estimate of 0.293, suggesting sensitivity to environmental variation.

Figure 1.

Figure 1

Distribution of the SDPS and its related traits phenotype in F2:3 population.

Phenotypic data of SDPS, SPS, and VSL showed continuous distributions, and their skewness and kurtosis values were < 1.0 in the segregation populations (Table 1), indicating the quantitative inheritance of these traits. The maximum and minimum SDPS values of F2 plants were 4.90 seeds/cm and 1.23 seeds/cm, respectively, whereas, at the same time, the SDPS values of 4263 and 3001 parental lines were 4.14 seeds/cm and 2.24 seeds/cm, respectively (Table 1 and Fig.S1). F2:3 families also demonstrated a wide distributed SDPS values that ranged from less than that of 3001 to higher than that of 4263. These SDPS data indicated the suitability of subsequent QTL-seq analysis. To construct the high-seed density trait (HT) and low-seed density trait (LT) bulks, F2 individuals (40 each of HT and LT) were selected. Further, the SDPS of 40 plants in the HT and LT bulks was > 4.01 seeds/cm and < 2.53 seeds/cm, respectively.

Table 1.

Statistical analysis of seed density within per silique and its related traits in F2 population and F2:3 family.

Sample Sizea Trait Mean Rangeb Variance Skewness Kurtosis W-testc p-valued
F2 780 SPSe 20.84 ± 3.36 8.58–30.36 11.27 − 0.57 0.38 0.969 0.0000
VSLf 7.12 ± 1.19 4.15–10.60 1.41 0.07 − 0.57 0.976 0.0001
SDPSg 2.98 ± 0.61 1.23–4.90 0.37 0.65 − 0.16 0.940 0.0000
F2:3 573 SPSe 19.42 ± 2.21 12.16–26.48 4.88 − 0.18 0.13 0.987 0.6981
VSLf 6.92 ± 1.07 4.67–9.98 1.15 0.32 − 0.49 0.966 0.0000
SDPSg 2.89 ± 0.54 1.71–4.39 0.29 0.26 − 0.76 0.961 0.0000

aSize of the sample population. bRange of the minimum value and maximum value for the trait. cW-test is the Shapiro Wilk W-statistic for the test of normality. dp-value is the p-value for W-test of normality. eSPS is seed number per silique. fVSL is valid silique length (cm). gSDPS is seed density within per silique (seed/cm).

Resequencing and mapping of reads

For Illumina sequencing, libraries were prepared using HT and LT bulks and the two parental lines. A total of 216,731,002, 223,784,954, 220,390,200, and 209,578,748 clean reads were obtained for HT bulk, LT bulk, high-SDPS parent (4263), and low-SDPS parent (3001), respectively. When these reads were aligned, the read depth and coverage observed were 24.81 × and 99.65%, 25.36 × and 99.66%, 25.32 × and 96.79%, and 24.12 × and 96.16% for HT bulk, LT bulk, 4263, and 3001, respectively (Table 2), based on the Ningyou7 rapeseed genome sequence12. In comparison to the reference genome, HT bulk and LT bulk were identified with a total of 5,301,640 and 5,313,578 genome-wide single nucleotide polymorphisms (SNPs) and 1,159,752 and 1,163,307 insertions or deletions (InDels), respectively (Table S1 and Fig. S2).

Table 2.

Summary of the sequencing results for two bulks and their parental lines.

Samples Clean reads Clean base (Gb) Read alignment (%) Average depth ( ×)
LT bulk 223,784,954 33.31 99.66 25.36
HT bulk 216,731,002 32.27 99.65 24.81
3001 209,578,748 31.21 96.16 24.12
4263 220,390,200 32.82 96.79 25.32

Identification of SDPS-related genomic region using QTL-seq

To identify the genomic region associated with SDPS, the Δ(SNP-index) was calculated and plotted against the genome positions based on the information of the SNP index for each bulk (Fig. 2). The Δ(SNP-index) was calculated by subtracting the SNP-index of the LT bulk from that of the HT bulk and plotted across all rapeseed chromosomes to map the putative genomic region related to SDPS. The region located between 31.71 Mb and 49.20 Mb on chromosome A09 was detected at 95% significance (Fig. 2C), and one SDPS-associated QTL was identified at the 17.49 Mb region of chromosome A09.

Figure 2.

Figure 2

QTL identification for SDPS in F2 lines by QTL-seq. (AC) represent the SNP-index plots for HT bulk and LT bulk, and the Δ(SNP-index) plot of rapeseed chromosome A09 from QTL-seq analysis, respectively. Δ(SNP-index) plot with statistical confidence interval under the null hypothesis of no QTL (orange, P < 0.01; purple, P < 0.05).The X-axis and Y-axis represent the rapeseed chromosomes and the SNP-index, respectively.

Marker development and QTL fine mapping

To fine-map the candidate region, 383 SSR markers were developed and genotyped in two parental lines. From these markers, 15 polymorphic markers (Table 3) with clear and steady bands were selected to analyze 847 F2 individuals to construct genetic linkage maps. This led to the identification of a QTL for SDPS, named qSD.A9-1, that accounted for 53.1% of the phenotypic variations (PVs) in the F2:3 families. qSD.A9-1 was mapped in a 2.40 cM genetic interval between Nys9A190 and Nys9A531 on the linkage map and a 401.8 kb physical interval between 42.22 Mb and 42.63 Mb on rapeseed chromosome A09 of the Ningyou7 reference genome12. Coincidentally, another QTL, named qSL.A9, was identified for VSL in the same region as qSD.A9-1, explaining a PV of 47.6% in this population. Furthermore, qSD.A9-1 had additive and dominant effects of 0.4 and -0.2, respectively, whereas qSL.A9 had additive and dominant effects of -1.0 and 0.3, respectively, indicating that the major QTL in the region between Nys9A190 and Nys9A531 controlled the expression of SDPS from 4263 and VSL from 3001. We also identified 56 genes in this region predicted based on the annotations of Ningyou7 reference genome12 (Table S2). Additionally, we detected the following minor QTL: (1) qSD.A9-2 (near qSD.A9-1) for SDPS, with a PV of 10.0% mapped in a 0.96 cM interval between Nys9A503 and Nys9A508, (2) qSP.A9-2 for SPS, which was mapped in the same region as qSD.A9-2 and showed a PV of 7.7%, and (3) qSP.A9-1 for SPS that was located in a 2.16 cM interval between Nys9A136 and Nys9A366 on the same chromosome and accounted for 7.6% of PV (Fig. 3 and Table 4).

Table 3.

Polymorphic markers used for linkage analysis.

Markers Primer sequences Locationa
Forward (5′-3′) Reverse (5′-3′)
Nys9A136 TCTCCAACTCGATTCCTTTA CCCACAAACACATGTAATCA 36814457–36814567
Nys9A366 GTGGAGAAAAAGGAAGGATT TGATACCCAAAAATGGTAGC 37172608–37172896
Nys9A458 GCATTGGTCTTCAAAGAAAC GCTGGCATTTAGTGATTTTC 40879333–40879599
Nys9A471 ATCTATCATCTCCATGTGCC GTACCACCACCACATAGCTT 41227405–41227580
Nys9A503 GAACAAAAGGATTCACAAGG ACTCGACAGAAAGGACAAGA 41999032–41999244
Nys9A508 GTTGCTTGATTTAGGGTTTG CGAAAGTAAAGCTCTCGTGT 42115771–42116068
Nys9A511 ATGGAACTCAGAGATTGGTG AGCAGAGTCTGACGAAACAT 42196513–42196746
Nys9A190 TTTTAGAACGGAGCGTAAAG TAGGATTTGGTGGAGAAGAA 42228643–42228762
Nys9A531 GTTCTCATCTTTCTTGACGC TGGTGCTTTAGGTTTCACTT 42630577–42630786
Nys9A534 AGACCCAAGAGGAAAAGAAC ACCTTCCATTGTACACGAAC 42683900–42684063
Nys9A535 CTTTCTCGATCCTTCATACG CCGACCACTGAAAAATTAAC 42689011–42689169
Nys9A537 CACAGGAACGGTTAGTTCTC CGGAGAAGTAAGTCTCCAAA 42719951–42720183
Nys9A558 CTACTACACCTGCTGCACAA AACACGAAGCTCTTTTCTTG 43130463–43130633
Nys9A256 CAGTGGCCTCTAGTGTTTTC AAGTATAACCGCCATACCCT 44757606–44757796
Nys9A258 TGGGAATAGGATACCTTGTG AAAGTCAGCGAAGATGTGTT 44795100–44795254

aLocation is the marker position on chromosome A09 of the reference genome sequence.

Figure 3.

Figure 3

QTL fine mapping of SDPS and its related traits in F2:3 families from 4263 × 3001 cross. (A) is the chromosome A09 with map interval sizes in Kosambi centiMorgan (cM) units at left, and markers at right. (B) is the logarithm of odds (LOD) score of the detected QTL for SDPS and its related traits in F2:3 families on chromosome A09. (C) is the physical position of the markers linked with the detected QTL for SDPS and its related traits on chromosome A09 of the Ningyou7 reference genome.

Table 4.

Statistics of seed density within per silique and its related traits QTL identified on chromosome A09 in F2:3 families.

QTL Marker Interval Distance (cM)a LOD PV (%)b Addc Domd
qSD.A9-1 Nys9A190-Nys9A531 2.40 77.6 53.1 0.4 − 0.2
qSD.A9-2 Nys9A503-Nys9A508 0.96 18.9 10.0 0.2 0.0
qSP.A9-1 Nys9A136-Nys9A366 2.16 6.6 7.6 0.7 0.0
qSP.A9-2 Nys9A503-Nys9A508 0.96 6.7 7.7 0.7 − 0.2
qSL.A9 Nys9A190-Nys9A531 2.40 80.7 47.6 − 1.0 0.3

aThe distance between the left and right marker of the mapping QTL in F2:3 families. bPV means the phenotypic variation of each QTL for SDPS or its related trait. cAdd is the additive effect. dDom is the dominant effect.

Sequence analysis of the major QTL for SDPS and VSL

When we screened 822 SNPs and 234 InDels in the 56 predicted genes (Table S2), 45 predicted genes in the region of qSD.A9-1 and qSL.A9 were exonic or splicing variants. Among these, 36 predicted genes were exonic variants with amino acid changes, including 33, five, two, and one with nonsynonymous single nucleotide variation, non-frameshift insertion or deletion, frameshift insertion/deletion, and splicing variant, respectively (Table S2). These variations may be related to altered seed density and silique length in rapeseed. Using the Ningyou7 annotation, the following 11 predicted genes were found to encode proteins associated with plant growth and development: (1) ChrA09g005039 encoding a pentatricopeptide (PPR) repeat, (2) ChrA09g005043 encoding an skp1 family protein, (3) ChrA09g005048, (4) ChrA09g005056, and (5) ChrA09g005072 encoding ring finger proteins, (6) ChrA09g005049 encoding a 2OG-Fe(II) oxygenase superfamily protein, (7) ChrA09g005059 encoding an F-box-like protein, (8) ChrA09g005075 encoding an auxin response factor, (9) ChrA09g005077 encoding an RNA recognition motif, (10) ChrA09g005091 encoding a protein kinase, and (11) ChrA09g005092 encoding a B3 DNA binding protein (Table S3). Except for ChrA09g005043, the coding sequence of all other genes showed variations between the two parents (Table 5).

Table 5.

Sequences alignment for CDS and amino acid of the part genes related to qSD.A9-1 (qSL.A9) between 4263 and 3001.

GeneID The base for CDS Amino acid change
Mutation position 4263 3001 Mutation position 4263 3001
chrA09g005039 346 G A 116 V M
523 A G 175 T A
1003 C G 335 P A
1087 C T 363 H Y
chrA09g005048 73 C T 25 L F
chrA09g005049 122 A C 41 K T
370 A T 124 T S
763 G A 255 G R
1014 G C 338 K N
chrA09g005056 25 T C 9 F L
chrA09g005059 315 C A 105 D E
527 T C 176 M T
961–963 CCA 321 P
chrA09g005072 551 G C 184 G A
chrA09g005075 47 C G 16 S C
829 A G 277 S G
893 G A 298 R K
1132 A G 378 I V
1188–1189 CCTCCT 396–397 PP
chrA09g005077 603 C G 201 D E
1253 C A 418 T N
chrA09g005091 166 C T 56 L F
chrA09g005092 602 G C 201 G A

Discussion

Rapeseed silique plays an important role in the accumulation of photosynthetic products, and it was demonstrated that longer siliques with higher seed density could improve the yield of the final products by increasing seed number directly or indirectly13,14. Therefore, creating and selecting new varieties with long silique and high seed density may be an effective strategy to increase the rapeseed yield. Previous studies have shown that most agronomic traits in rapeseed, including those related to seeds and siliques, are complex quantitative traits and are controlled by multiple gene products4,5,14. Although many QTL for seed weight, SPS, and VSL and underlying genes have been validated and characterized in rapeseed5,7,14, only a few QTL or genes are reported for SDPS, the ratio of SL to SPS, in rapeseed.

QTL-seq that combines BSA and NGS has been successfully used to rapidly identify many QTL for different traits in rapeseed6,15,16. In the present study, QTL that controls SDPS was identified on rapeseed chromosome A09 in a mapping population derived from the 4263 × 3001 crosses. Further, two QTL (qSD.A9-1 and qSL.A9) with 53.1% PV for SDPS from one parent (4263) and 47.6% PV for VSL from the other parent (3001) were mapped on chromosome A09 between 42.22 Mb and 42.63 Mb based on Ningyou7 reference genome sequence12. Near this genomic position, one minor QTL for SDPS and two minor QTL for SPS were identified. We speculate the existence of a gene or gene cluster in this region that simultaneously regulates SDPS and VSL or SDPS and SPS. Earlier, a QTL integration analysis performed by Zhou et al. (2021)14 identified the QTL for SDPS (cqSDPS-A9-2), VSL (cqSL-A9-2), and SPS (cqSPS-A9-2) at the same location on chromosome A09. The physical location of the major QTL associated with VSL and SDPS was detected on chromosome A09 between 27.76 Mb and 28.09 Mb based on ZS11 genome sequence17; this overlapped with previously reported QTL (cqSL-A9-2)14.

To recapitulate the physical location of linkage markers (Nys9A190 and Nys9A531) based on Ningyou7 reference genome12, 56 genes were predicted in this region, and 36 of these genes had exonic (splicing) changes. Of all the predicted genes, ChrA09g005075 and ChrA09g005049 were the most likely candidate for qSL.A9 and qSPDS.A9-1, respectively. This is because several previous studies have proved that genes associated with auxin repression affect silique length in Brassica species, and 2OG-Fe(II) oxygenase is a key player in GA and ABA signal transduction18,19. GA plays an important role in regulating seed growth and size, while ABA plays an important role in regulating seed number18. Among other important genes, those related to functions of seed development are attractive candidates; however, more studies are required to validate their association with SDPS and VSL.

Materials and methods

Plant materials

All seeds of rapeseed accessions used in this study were obtained from the Shanghai Academy of Agricultural Sciences. 4263 had a higher SDPS (more than 3.72 seeds/cm) than that of 3001 (less than 2.24 seeds/cm), while the VSL of 3001 (7.56 cm) was longer than that of 4263 (5.81 cm) in different years. The two rapeseed lines (4263 with short silique but high seed density and 3001 with long silique but low seed density) were selected to develop the mapping population to detect QTL for SDPS and its related traits (Fig. S3). 4263 is a new rapeseed line derived from a self-cross plant of the rapeseed germplasm Su YJ-3, while 3001, which was used as the male, is a new rapeseed line developed from a cross between rapeseed lines Rong Xuan and Jian7. The 4263 × 3001 hybrids were advanced from the F1 cross by self-cross to yield the segregation population for identifying the QTL of SDPS and its related traits.

Plant growth conditions and evaluation of phenotypes

All rapeseed materials including two parental lines, their F1 plants, F2 individuals, and/or F2:3 families were planted in normal growing seasons at the experiment base of Shanghai Academy of Agricultural Sciences, Shanghai, China. Each row contained 13–15 plants with a planting density of 30 cm between rows and 20 cm between plants within each row. All lines were open-pollinated to keep a full record of fertilization rates. The field management was conducted with normal agricultural practices. At the mature stage, 10 well-developed siliques of the main raceme were harvested randomly from each F2 plant to analyze the SDPS and its related traits as described by Wang et al4. Phenotypic data per plant was collected as follows: (1) VSL (cm): estimated from the average length (excluding the beak length) of all chosen siliques. (2) SPS: estimated from the average value of all chosen siliques. (3) SDPS (seed number/cm): measured using the ratio of VSL to SPS. For each of the F2:3 families, the F3 individuals with over 20 plants were grown in two rows, which enabled enough plants to evaluate the phenotype of the F2 plants. Twenty plants from each F2:3 family and parental line were selected for the phenotypic analysis at the mature stage. Subsequently, five well-developed siliques of the main raceme were harvested from each plant to measure SDPS and its related trait as described by Wang et al4 and Zhang et al5. The phenotypic data of SDPS and its related traits for each F2:3 families were collected as a mean from the 20 F3 plants, so as two parental lines. The broad-sense heritability was estimated using parent–offspring regression methods based on the variance of parents, F1-derived F2, and F2-derived F3 lines20.

Sample bulking and DNA isolation

A total of 780 F2 individuals from 4263 × 3001 crosses were selected to build DNA bulks for QTL-seq. Forty individuals each for HT and LT bulks were selected from the F2 population based on their extreme phenotypes for SDPS. Genomic DNA from HT bulk, LT bulk, their parents (4263 and 3001), and F2 individuals were isolated using Plant Genomic DNA Extraction Kit (TIANGEN, China), following the manufacturer’s instructions. The quality and concentration of DNA samples were examined by agarose gel electrophoresis (1.5%; w/v).

Illumina sequencing and NGS data analysis

Test-qualified DNA samples from HT bulk, LT bulk, and two parents (4263 and 3001) were used to construct libraries with an insert size of 350–500 bp using the TruSeq DNA LT Sample Prep Kit and sequenced (150 bp pair-end reads) via an Illumina Xten platform at Shanghai OE Biotech Co., Ltd. (China). Raw data produced from Illumina sequencing were subjected to quality control by Trimmomatic (v0.36)21. The filtered clean reads from two DNA bulks and their parents were aligned to the Ningyou7 rapeseed genome12 using BWA22, and SNP calling was performed using SAMtools23. The average SNP index was calculated in 1 Mb sliding windows with a 20 kb increment for each pool based on their parent genotype. The △(SNP-index) was calculated by subtracting the SNP-index of LT bulk from that of HT bulk. All SNP-index and △(SNP-index) for all positions were calculated to identify the QTL of SDPS as previously described6,24.

SSR marker analysis and QTL fine mapping

QTL identified by QTL-seq were validated and fine-mapped through linkage analysis in F2:3 families. Primers in the predicted regions were designed using SSR Locator25 with the parameters as previously described26 based on the reference genome12. All newly developed markers were named as previously described15. PCR and amplicon detection in F2 plants and parental lines were performed with minor modifications as previously described27. The polymorphic markers were selected to detect the F2 population for linkage map construction. Further, the linkage map was drawn using MAP functionality in QTL IciMapping v4.128 with the map distance (cM) of Kosambi mapping function29. QTL was conducted using the BIP functionality with the ICIM-ADD mapping method in QTL IciMapping v4.128. The LOD threshold and recombination frequency of QTL mapping were set at 3.0 and 0.30, respectively. The designated QTL for SDPS, VSL, and SP was named qSD, qSL, and qSP followed by the chromosome number, respectively.

Candidate gene analysis of the major QTL for SDPS and VSL

The candidate genes for the major QTL of SDPS and/or VSL were obtained using the Ningyou7 rapeseed genome annotation12. Furthermore, the SNPs or InDels in each gene were predicted using SnpEff30.

Permission statement

All the experiments on plant resources, including the collection of rapeseed germplasms, were performed following relevant local guidelines and regulations.

Conclusions

In this study, a total of 780 F2 lines and 573 F2:3 families were constructed to elucidate the genetic mechanisms of seed density and its related traits. One major QTL was mapped to a 401.8 kb interval between Nys9A190 and Nys9A531 on rapeseed chromosome A09 and was associated with seed density and silique length in this population based on QTL-seq and linkage analysis. The PV of SDPS and VSL was 53.1% and 47.6%, respectively, in F2:3 families. These findings provide a basis to conduct genetic breeding experiments involving cloning of both seed density and silique length in rapeseed.

Supplementary Information

Acknowledgements

The authors would like to thank all the editors and reviewers who participated in the review.

Author contributions

J.Z. and X.Z. designed the experiments, and conceived the study and finalized the manuscript. J.Z. collected and conducted all data analysis, and wrote the paper. X.Z. provided the materials and assisted in phenotype investigation. L.L., W.W. and X.J. worked on the materials sowing. All authors read and approved the paper final version.

Funding

This study was funded by Shanghai Agriculture Applied Technology Development Program, China (Grant No. 2021-02-08-00-12-F00774).

Data availability

This whole genome resequencing reads of QTL-seq have been deposited in the National Center of Biotechnology Information Sequence Read Archive (SRA) under BioProject accession number PRJNA885277 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA885277).

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-023-28066-5.

References

  • 1.Zhao W, et al. Genome-wide identification of silique-related traits based on high-density genetic linkage map in Brassica napus. Mol. Breed. 2019;39:86. doi: 10.1007/s11032-019-0988-1. [DOI] [Google Scholar]
  • 2.Zhou X, et al. BnaC7.ROT3, the causal gene of cqSL-C7, mediates silique length by affecting cell elongation in Brassica napus. J. Exp. Bot. 2022;73(1):154–167. doi: 10.1093/jxb/erab407. [DOI] [PubMed] [Google Scholar]
  • 3.Jiao Y, et al. Fine mapping and candidate gene analysis of a major locus controlling ovule abortion and seed number per silique in Brassica napus L. Theor. Appl. Genet. 2021;134:2517–2530. doi: 10.1007/s00122-021-03839-6. [DOI] [PubMed] [Google Scholar]
  • 4.Wang X, et al. Quantitative trait loci analysis and genome wide comparison for silique related traits in Brassica napus. BMC Plant Biol. 2016;16:71. doi: 10.1186/s12870-016-0759-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang L, et al. Genetic and correlation analysis of silique-traits in Brassica napus L. by quantitative trait locus mapping. Theor. Appl. Genet. 2011;122(1):21–31. doi: 10.1007/s00122-010-1419-1. [DOI] [PubMed] [Google Scholar]
  • 6.Takagi H, et al. QTL-seq: rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations. Plant J. 2013;74:174–183. doi: 10.1111/tpj.12105. [DOI] [PubMed] [Google Scholar]
  • 7.Yang Y, et al. High density linkage map construction and QTL detection for three silique-related traits in orychophragmus violaceus derived Brassica napus population. Front. Plant Sci. 2017;8:1512. doi: 10.3389/fpls.2017.01512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hussain Q, et al. Key genes and mechanisms underlying natural variation of silique length in oilseed rape (Brassica napus L.) germplasm. Crop J. 2022;10:617–626. doi: 10.1016/j.cj.2021.08.010. [DOI] [Google Scholar]
  • 9.Shi L, et al. A CACTA-like transposable element in the upstream region of BnaA9.CYP78A9 acts as an enhancer to increase silique length and seed weight in rapeseed. Plant J. 2019;98:524–539. doi: 10.1111/tpj.14236. [DOI] [PubMed] [Google Scholar]
  • 10.Li S, et al. BnaC9.SMG7b functions as a positive regulator of the number of seeds per silique in Brassica napus by regulating the formation of functional female gametophytes. Plant Physiol. 2015;169:2744–2760. doi: 10.1104/pp.15.01040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liu J, et al. Natural variation in ARF18 gene simultaneously affects seed weight and silique length in polyploid rapeseed. Proc. Natl. Acad. Sci. U. S. A. 2015;112:E5123–E5132. doi: 10.1073/pnas.1502160112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zou J, et al. Genome-wide selection footprints and deleterious variations in young Asian allotetraploid rapeseed. Plant Biotechnol. J. 2019;17:1998–2010. doi: 10.1111/pbi.13115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bennett EJ, Roberts JA, Wagstaff C. The role of the pod in seed development: Strategies for manipulating yield. New Phytol. 2011;190:838–853. doi: 10.1111/j.1469-8137.2011.03714.x. [DOI] [PubMed] [Google Scholar]
  • 14.Zhou X, et al. Mining favorable alleles for five agronomic traits from the elite rapeseed cultivar Zhongshuang 11 by QTL mapping and integration. Crop J. 2021;9:1449–1459. doi: 10.1016/j.cj.2020.12.008. [DOI] [Google Scholar]
  • 15.Zhu J, et al. QTL mapping for low temperature germination in rapeseed. Sci. Rep. 2021;11:23382. doi: 10.1038/s41598-021-02912-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tudor EH, et al. QTL-seq identifies BnaFT.A02 and BnaFLC.A02 as candidates for variation in vernalization requirement and response in winter oilseed rape (Brassica napus) Plant Biotechnol. J. 2020;18:2466–2481. doi: 10.1111/pbi.13421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sun F, et al. The high-quality genome of Brassica napus cultivar ‘ZS11’ reveals the introgression history in semi-winter morphotype. Plant J. 2017;92:452–468. doi: 10.1111/tpj.13669. [DOI] [PubMed] [Google Scholar]
  • 18.Hussain Q, et al. Genetic and signaling pathways of dry fruit size: Targets for genome editing-based crop improvement. Plant Biotechnol. J. 2020;18:1124–1140. doi: 10.1111/pbi.13318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kang J, et al. Up regulation of the AT-hook DNA binding gene BoMF2 in OguCMS anthers of Brassica oleracea suggests that it encodes a transcriptional regulatory factor for anther development. Mol. Biol. Rep. 2014;41:2005–2014. doi: 10.1007/s11033-014-3048-2. [DOI] [PubMed] [Google Scholar]
  • 20.Nyquist WE. Estimation of heritability and prediction of selection response in plant populations. Crit. Rev. Plant Sci. 1991;10:235–322. doi: 10.1080/07352689109382313. [DOI] [Google Scholar]
  • 21.Bolger AM, Lohse M, Usadel B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2010;25(5):1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li H, et al. 1000 Genome project data processing subgroup: the sequence alignment/map format and SAMtools. Bioinformatics. 2009;25(16):1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Abe A, et al. Genome sequencing reveals agronomically important loci in rice using MutMap. Nat. Biotechnol. 2012;30:174–178. doi: 10.1038/nbt.2095. [DOI] [PubMed] [Google Scholar]
  • 25.Maia LC, et al. SSR locator: tool for simple sequence repeat discovery integrated with primer design and PCR simulation. Int. J. Plant Genomics. 2008;2008:1–9. doi: 10.1155/2008/412696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhu JF, et al. QTL and candidate genes associated with common bacterial blight resistance in the common bean cultivar Longyundou 5 from China. Crop J. 2016;4:344–352. doi: 10.1016/j.cj.2016.06.009. [DOI] [Google Scholar]
  • 27.Zhu JF, et al. Development of genome-wide SSR markers in rapeseed by next generation sequencing. Gene. 2021;798:145798. doi: 10.1016/j.gene.2021.145798. [DOI] [PubMed] [Google Scholar]
  • 28.Lei M, Li HH, Zhang LY, Wang JK. QTL IciMapping: integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 2015;121:269–283. [Google Scholar]
  • 29.Kosambi DD. The estimation of map distances from recombination values. Ann. Hum. Genet. 1943;12:172–175. [Google Scholar]
  • 30.Cingolani P, et al. A program for annotating and predicting the effects of single nucleotide polymorphisms. SnpEff, Fly. 2012;6(2):80–92. doi: 10.4161/fly.19695. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

This whole genome resequencing reads of QTL-seq have been deposited in the National Center of Biotechnology Information Sequence Read Archive (SRA) under BioProject accession number PRJNA885277 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA885277).


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES