Skip to main content
Annals of Translational Medicine logoLink to Annals of Translational Medicine
. 2022 Dec;10(24):1320. doi: 10.21037/atm-22-5553

Correlation analysis of gastric mucosal lesions with Helicobacter pylori infection and its virulence genotype in Guiyang, Guizhou province, China

Yue Hu 1,2,3, Yan Wang 4, Mengheng Mi 3, Zhaohui Deng 5, Jian Zhu 6, Qi Liu 1, Xiaoqin Chen 1, Zhenghong Chen 2,3,
PMCID: PMC9843376  PMID: 36660645

Abstract

Background

Helicobacter Pylori (H. pylori) infection is the most important factor affecting clinical outcome in patients with gastric mucosal lesions. This study aimed to investigate H. pylori infection in patients with gastric mucosal lesions and their virulence genotype in Guiyang, China.

Methods

Pathological examinations of 1,364 biopsies from patients with upper gastrointestinal symptoms and H. pylori infection were analyzed according to different pathological types. The bacterial genome DNA was extracted from H. pylori strains isolated from gastric biopsies, and the cagA, vacA, and iceA virulence genes were detected and typed to analyze the correlation of their genotypes between different pathological lesions.

Results

The positive rate of H. pylori infection was approximately 19.9% (272/1,364), as determined by histopathological examination (HPE). It was more frequently detected in men than in women. A total of 85 H. pylori isolates were obtained from 280 clinical samples (positive rate 30.4%, 85/280). Of these 85 strains, cagA, vacA, and iceA genes were identified in 85.9%, 100%, and 83.5% of samples, respectively. Approximately 74.1% of strains were cagA East Asian type (cagA-ABD), and 11.8% of were cagA Western strains (cagA-AB, cagA-ABC), only present in patients with chronic non-atrophic gastritis. Gastric intraepithelial neoplasia and gastric cancer harbored both Asian strains. A total of 7 combinations of vacA genotypes were noted, among which s1c/m1b (30.6%) and s1c/m2 (41.2%) were the dominant genotypes. The predominant iceA genotype was iceA1 (64.7%).

Conclusions

We observed that the positive rate of H. pylori infection was related to the pathological type of patients’ gastric mucosal lesions. Isolated H. pylori strains showed a unique genotype, mainly East Asian type cagA (ABD), vacA s1c/m2 genotype, and iceA1. These results provide an important reference for further studies of H. pylori in Guizhou province, China.

Keywords: H. pylori infections, pathological type, gastric mucosal lesion, Guizhou province


Highlight box.

Key findings

• We found that the prevalence of H. pylori infection was related to the pathological type of gastric mucosal lesion.

What is known and what is new?

H. pylori was more frequently detected in men than in women. Most of the current studies have reported the relationship between clinical diagnosis and H. pylori infection and virulence genes.

• Using the gold standard (histopathological examination) for diagnosing H. pylori infection, we studied the relationship between gastric mucosa pathology and H. pylori infection and its virulence genes.

What is the implication, and what should change now?

• Eradication of H. pylori is essential to prevent further lesions in the gastric mucosa, especially for cagA-positive strains.

Introduction

In 1982, Warren and Marshall discovered a bacterium that colonized the surface of the human gastric mucosa which was later named Helicobacter pylori (H. pylori). H. pylori is a gram-negative, micro-aerobic, spiral-curved bacteria that colonizes the surface of the human gastric mucosa (1). The bacterium decomposes urea to resist gastric acid and secrete toxins into the digestive tract. These toxins destroy the defense mechanism and immunity of the host, and inflammation of the body is then induced (2). Potential consequences of H. pylori infection include upper gastrointestinal diseases, such as gastritis, gastroduodenal ulcer, gastric mucosa-associated lymphoid tissue lymphoma, and gastric cancer (3). Over the last few decades, the prevalence of H. pylori infection has been decreasing worldwide (4), and the prevalence significantly decreased from 58.3% in the period 1983–1994 to 40.0% in the period 2015–2019 in China (5). A study found the positive rates of H. pylori by rapid urease test (RUT), histopathological examination (HPE), polymerase chain reaction (PCR), and culture to be 47.1%, 51.3%, 50.3%, and 32.4%, respectively (6). Each method has its unique advantages and disadvantages, and the occurrences of false negatives and positives cannot be avoided (7,8). Bacterial culture of endoscopic biopsy specimens is the gold standard for diagnosing H. pylori colonization (9), but the frequency of positive culture is low. Typically, the bacteria are easily observed in well-differentiated hematoxylin-eosin (H&E) stained sections, and special staining for routine diagnosis is not necessary (10).

The difference in clinical outcomes after H. pylori infection is related to the host’s susceptibility, the virulence of the bacteria strain, environmental co-factors, and socio-economic conditions (11). Among them, the most important factor affecting clinical outcomes is the H. pylori virulence genes, and the 3 best-understood genes in terms of structure and function are cytotoxin-associated gene A (cagA), vacuolating cytotoxin A (vacA), and induced by contact with epithelium gene A (iceA). The virulence genotype expression of H. pylori in different digestive tract diseases varies significantly (12).

The cagA gene is an important virulence factor and cagA positive strains can increase the risk of gastric ulcers and cancers (13). The distribution of H. pylori cagA virulence genes shows obvious regional differences. The cagA gene has been detected in 50–60% of the Western H. pylori strains (14); however, over 90% of the strains isolated in an East Asian population possessed this gene (15), which is directly translocated with the epithelial cell via a type IV secretion system (16). The previous study has shown the existence of four EPIYA motifs (A, B, C, D). The East Asian type was replaced by the EPIYA-D segment instead of the EPIYA-C fragment, and it was more virulent than the Western type (17). A relevant study has shown that the population of the Guizhou province of China is dominated by the cagA East Asian type, with a positive rate of over 80% (18).

Almost all H. pylori strains produce and secrete vacA, which induces and produces a variety of cell activities (19) that damage the gastric mucosa. Several studies have shown that the vacA virulence gene is the most abundant of the H. pylori gene polymorphisms (20). Its genetic polymorphism is expressed in the signal (s) region, the middle (m) region, and the intermediate (i) region (21). In general, s1m1 and s1m2 strains produce high and moderate levels of toxins, respectively, whereas s2m2 strains produce little or no toxin (22).

The iceA gene is another important virulence factor. The 2 main allelic variants of the gene are iceA1 and iceA2 (23). Of them, iceA1 is upregulated upon contact of H. pylori with the gastric epithelium and has been considered a marker for peptic ulcer disease and gastritis (24).

This study aimed to investigate the association between gastric mucosal lesions with H. pylori infection and their cagA, vacA, and iceA genotypes in Guiyang, Guizhou. We present the following article in accordance with the MDAR reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-5553/rc).

Methods

Our study enrolled 1,364 patients with upper gastrointestinal discomfort (e.g., abdominal pain, postprandial fullness, acid reflux, and burning) and without obvious contraindications for upper gastrointestinal endoscopy who underwent electronic gastroscopy and gastroscopic gastric mucosal biopsy from the Affiliated Cancer Hospital of Guizhou Medical University and the Guiyang Hospital of Guizhou Aviation Industry between August 2018 and February 2019. The results of these procedures were reviewed retrospectively. All patients agreed to undergo electronic gastroscopy and gastroscopic gastric mucosal biopsy. The biopsies were obtained for histopathological evaluation, H. pylori culture, and virulence genotype detection.

HPE

Between 1 and 3 biopsy specimens from the antral and/or stomach body of the gastric mucosa were obtained via routine gastroscopy for histological examinations. The sections were fixed with 10% neutral formalin, then paraffin-embedded and stained with H&E. H. pylori infection and pathological lesions of the gastric mucosa were diagnosed by 2 independent pathologists using an ordinary light microscope.

Ethical considerations

The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the ethics committee of The Affiliated Hospital of Guizhou Medical University (No. 2018-100) and informed consent was taken from all the patients. Guiyang Hospital of Guizhou Aviation Industry was informed and agreed the study. Control strain: H. pylori standard strain NCTC11637 was donated by the Chinese Center for Disease Control and Prevention.

H. pylori isolation and bacterial DNA extraction

For H. pylori isolation, gastric mucosa biopsy samples were cut into tiny sections, homogenized, and smeared on the surface of brain heart infusion agar with 10% sheep blood (Qingdao Hope Biol Technology Co., Ltd., Qingdao, China) and antibiotic supplement (H. pylori selective supplement, Thermo Fisher Scientific Oxoid, Ltd., Basingstoke, UK), which were incubated afterward in a microaerobic incubator for 3–5 days. Suspected colonies of H. pylori were identified by Gram stain, spiral morphology, urease, oxidase, and catalase tests, and H. pylori specific 16S rRNA gene fragment polymerase chain reaction (PCR) amplification. The colony of H. pylori was translucent and smooth, and the morphology was Gram-negative and spiral-shaped bacilli. The primers (Sangon Biotech Co., Ltd., Shanghai, China) used for amplification are shown in Table 1. The DNA of H. pylori isolates was extracted using an Ezup column bacteria genomic DNA purification kit (Sangon Biotech Co., Ltd., Shanghai, China), according to the manufacturer’s protocol. The H. pylori strain NCTC11637 was used as a positive control.

Table 1. Primer sequences and PCR conditions.

Gene Primer Primer sequence Size (bp) Amplification condition
16S rRNA 16S rRNA-F 5'-CTTGCTAGAGTGCTGATTA-3' 550 35 cycles: 94 ℃ for 30 sec; 55 ℃ for 30 sec; 72 ℃ for 30 sec
16S rRNA-R 5'-TCCCACACTCTAGAATAGT -3'
cagA 5'- cagA F 5'-GATAACAGGCAAGCTTTTGAGG-3' 349 30 cycles: 94 ℃ for 1 min; 55 ℃ for 1 min; 72 ℃ for 1 min
cagA R 5'-CTGCAAAAGATTGTTTGGCAGA-3'
cagA 3'- cagA –VF 5'-ACCCTAGTCGGTAATGGGTTA-3' 591–856 30 cycles: 94 ℃ for 1 min; 50 ℃ for 1 min; 72 ℃ for 1 min
cagA -VR 5'-GTAATTGTCTAGTTTCGC-3'
vacA-s1a vacA -s1a-F 5'-CTCTCGCTTTAGTAGGAGC-3' 213 30 cycles: 94 ℃ for 30 sec; 60 ℃ for 30 sec; 72 ℃ for 45 sec
vacA -s1a-R 5'-CTGCTTGAATGCGCCAAAC-3'
vacA-s1b vacA -s1b-F 5'-AGCGCCATACCGCAAGAG-3' 187
vacA -s1b-R 5'CTGCTTGAATGCGCCAAAC3'
vacA-s1c vacA -s1c-F 5'-CTCTCGCTTTAGTGGGGYT-3' 213
vacA-s1c-R 5'-CTGCTTGAATGCGCCAAAC-3'
vacA-s2 vacA-s2-F 5'-GCTAACACGCCAAATGATCC-3' 199
vacA-s2-R 5'-CTGCTTGAATGCGCCAAAC-3'
vacA-m1a vacA-m1a-F 5'-GGTCAAAATGCGGTCATGG-3' 290
vacA-m1a-R 5'-CCATTGGTACCTGTAGAAAC-3'
vacA-m1b vacA-m1b-F 5'-GGCCCCAATGCAGTCATGGAT-3' 291
vacA-m1b-R 5'-GCTGTTAGTGCCTAAAGAAGCAT-3'
vacA-m2 vacA-m2-F 5'-GGAGCCCCAGGAAACATTG-3' 352
vacA-m2-R 5'CATAACTAGCGCCTTGCAC3'
iceA1 iceA1-F 5'GCTTGTAACGATAAGAAACGCCAGAT3' 297 35 cycles: 94 ℃ for 30 sec; 55 ℃ for 30 sec; 72 ℃ for 30 sec
iceA1-R 5'GGAATGAGCTTGTATTTAGAGCCGAT3'
iceA2 iceA2-F 5'GTTGGGTATATCACAATTTAT3' 229/334 30 cycles: 94 ℃ for 30 sec; 52 ℃ for 30 sec; 72 ℃ for 45 sec
iceA2-R 5'TTRCCCTATTTTCTAGTAGGT3'

PCR, polymerase chain reaction.

PCR amplification

Following DNA extraction from a pure culture of H. pylori isolates, PCR assays were performed in a volume of 26 µL containing 1 µL reverse primer, 1 µL forward primer, 1 µL genomic DNA, 13 µL 2X Taq PCR Master Mix (Beijing Solarbio Science and Technology Co., Ltd., Beijing, China), and 10 µL ddH2O. All runs included 1 negative (ddH2O) and 1 positive (NCTC11637) DNA control and DNA ladder markers (Tiangen Biotech Co., Ltd., Beijing, China). A total of 5 µL of amplified PCR products was resolved by electrophoresis on 1% agarose gels run in acetate ethylene-diamine-tetraacetic acid (EDTA) buffer and stained with cyber green. The PCR product was visualized under gel electrophoresis.

Sequencing of cagA, vacA, and iceA

Primers (Sangon Biotech Co., Ltd., Shanghai, China) were to amplify cagA, vacA, and iceA genes, and the cycling conditions in the present study are shown in Table 1. The amplification of the iceA and the allelic combinations (s1, s2, m1, and m2) of vacA were visualized using agarose gel electrophoresis. PCR assays to amplify cagA and sequence its C-terminal region were performed according to the report by Sicinschi et al. (25). The cagA C-terminal PCR products were sent to Sangon Biotech Co., Ltd. for Sanger sequencing. Biological software DNAMAN (Lynnon Biosoft, San Ramon, CA, USA) was used to convert the gene sequence into an amino acid sequence for EPIYA typing.

Statistical analysis

All data were analyzed using SPSS 22.0 (IBM Corp., Armonk, NY, USA). The rate of H. pylori infection was expressed as a percentage, and the chi-squared test was used to assess differences in rates between the groups. Patients’ age, classified according to histopathological type, was expressed as means ± standard deviations. The chi-square test and Fisher’s exact test were used to analyze correlation of cagA, vacA, and iceA genotypes with different histopathological lesions and age groups. P values <0.05 were considered statistically significant.

Results

A total of 1,364 patients were included in the analysis.

H. pylori infection in patients according to sex

The positive rate of H. pylori infection in our study population was 19.9% (Table 2). The positive infection rate was 22.2% in men and 17.8% in women, which was a significant difference (P=0.045).

Table 2 H. pylori infection in patients of different sex diagnosed by histopathology.

Gender H. pylori infection Total (n) Positive rate (%) χ2 P value
Positive (n) Negative (n)
Men 148 520 668 22.2 4.021 0.045*
Women 124 572 696 17.8
Total 272 1,092 1,364 19.9

n: number of strains; *, P<0.05. H. pylori, Helicobacter pylori.

H. pylori infection in four histopathological groups

The histopathological diagnoses determined by the examination of H&E-stained biopsy sections included chronic non-atrophic gastritis, chronic atrophic gastritis, gastric ulcer, gastric polyps, chronic metaplastic atrophic gastritis, intraepithelial neoplasia, and gastric cancer (Figure 1). The patients were divided into 4 groups according to their diagnosis: chronic non-atrophic gastritis (n=782), precancerous conditions (n=400), gastric precancerous lesions (n=151), and gastric cancer (n=31). The precancerous conditions group comprised patients with chronic atrophic gastritis, gastric ulcer, gastric polyps, and gastric stumps. The gastric precancerous lesions group comprised patients with chronic metaplastic atrophic gastritis, and intraepithelial neoplasia. The positive infection rate was 15.7% in the chronic non-atrophic gastritis group, 23.0% in the precancerous condition group, 37.1% in the gastric precancerous lesion group, and 3.2% (1/31) in the gastric cancer group. H. pylori infection rates differed among the 4 groups (P<0.01) (Table 3).

Figure 1.

Figure 1

Endoscopic gastric biopsy stained with H&E. (A) Normal gastric mucosa with mild chronic inflammatory cells. (B) Atrophy of glandular mucosa with chronic infiltrate cells. (C) Metaplastic atrophic gastritis with chronic inflammatory cells infiltrates. (D) Mucosal ulceration with chronic and acute inflammatory cells infiltrate. (E) Gastric mucosa with adenocarcinoma infiltrate. (F) Gastric mucosa with intramucosal cancer. H&E, hematoxylin and eosin. Magnification times ×100.

Table 3 H. pylori infection rate in the four histopathology groups.

Histopathological diagnosis H. pylori infection Total Positive rate (%) χ2 P value
Positive (n=272) Negative (n=1,092)
Chronic non-atrophic gastritis group 123 659 782 15.7 44.263 0.000*
Precancerous condition group 92 308 400 23.0
Gastric precancerous lesion group 56 95 151 37.1
Gastric cancer group 1 30 31 3.2
Total 272 1,092 1,364 19.9

n: number of strains; *, P<0.05. H. pylori, Helicobacter pylori.

Histopathology according to age

The mean age was 52.2±12.3 years in the chronic non-atrophic gastritis group, 55.3±13.0 years in the precancerous condition group, 56.3±11.9 years in the gastric precancerous lesion group, and 60.0±14.0 years in the gastric cancer group. The average age in the chronic non-atrophic gastritis group significantly differed from that in the other histopathological groups (Table 4).

Table 4. Different histopathological groups and their ages.

Age Chronic non-atrophic gastritis group (n=782) Precancerous condition group (n=400) Gastric precancerous lesion group (n=151) Gastric cancer group (n=31)
Average age 52.2±12.3 55.3±13.0 56.3±11.9†‡ 60.0±14.0†‡§

n: number of strains. Age is expressed as the mean ± standard deviation. , compared with Chronic non-atrophic gastritis group: P<0.01. , compared with Precancerous condition group: P>0.05. §, compared with Gastric precancerous lesion group: P>0.05.

H. pylori infection according to age groups

The positive rates of H. pylori infection were 20.7%, 20.4%, and 18.9% in patients 15–39, 40–59, and 60–91 years old, respectively; 14 patients were >80 years old. There were no significant differences in infection rates among the age groups (P>0.05) (Table 5).

Table 5 H. pylori infection in patients of different ages.

Age, years H. pylori infection Total Positive rate (%) χ2 P value
Positive (n=272) Negative (n=1,092)
15–39 35 134 169 20.7 0.464 0.793
40–59 149 581 730 20.4
60–91 88 377 465 18.9
Total 272 1,092 1,364 19.9

n: number of strains. H. pylori, Helicobacter pylori.

Numbers of patients in different histopathological groups and age groups

The numbers of affected patients differed among histopathological and age groups. The number of infected patients in an age group decreased increasing histopathological severity. Among the chronic non-atrophic gastritis group, precancerous condition group, and gastric precancerous lesion group, patients aged 40–59 years were the most prevalently infected, whereas gastric cancer was more common in patients aged 60–91 years (Table 6).

Table 6. The number of patients in different histopathological groups and different age groups.

Histopathological diagnosis 15–39 years old (n) 40–59 years old (n) 60–91 years old (n) Total (n) χ2 P value
Chronic non-atrophic gastritis group 88 405 289 782 19.645 0.003*
Precancerous condition group 50 234 116 400
Gastric precancerous lesion group 27 81 43 151
Gastric cancer group 4 10 17 31
Total 169 730 465 1,364

n: number of strains; *, P<0.05.

Patients’ clinical information and histopathological diagnosis

During the study period, 85 H. pylori isolates were obtained from 280 cases of gastric biopsies (positive rate 30.4%, 85/280). Of these 85 isolates, 49 were from men and 36 were from women. The HPE of these 85 patients showed 59 cases of chronic non-atrophic gastritis, 2 cases of chronic atrophic gastritis, 16 cases of chronic atrophic gastritis with intestinal metaplasia, 2 cases of gastric intraepithelial neoplasia, 1 case of gastric polyps, and 5 cases of gastric cancer (Table 7). There was no significant difference between different histopathological type in terms of sex and age. Patients with complete information were used for genotyping.

Table 7. Distribution of various combinations of virulence genotypes among 85 H. pylori isolates and their association with clinical information and histopathological outcomes.

Variable n Gastric polyp Chronic non-atrophic gastritis Chronic atrophic gastritis Chronic atrophic gastritis with intestinal metaplasia Gastric intraepithelial neoplasia Gastric cancer P value
Men 49 0 (0.0%) 38 (64.4%) 0 (0.0%) 8 (50.0%) 1 (50.0%) 2 (40.0%) 0.233
Women 36 1 (100%) 21 (35.6%) 2 (100%) 8 (50.0%) 1 (50.0%) 3 (60.0%)
Age (years) 85 71 48.86±12.24 49.00±8.49 53.44±12.68 66.50±14.85 60.00±9.25
cagA 85 1 (1.2%) 59 (69.4%) 2 (2.4%) 16 (18.8%) 2 (2.4%) 5 (5.9%) 0.491
Negative 12 1 (1.2%) 7 (8.2%) 1 (1.2%) 3 (3.5%) 0 (0.0%) 0 (0.0%)
cagA-AB 7 0 (0.0%) 7 (8.2%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%)
cagA-ABC 3 0 (0.0%) 3 (3.5%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%)
cagA-ABD 63 0 (0.0%) 42 (49.4%) 1 (1.2%) 13 (15.3%) 2 (2.4%) 5 (5.9%)
vacA 85 1 (1.2%) 59 (69.4%) 2 (2.4%) 16 (18.8%) 2 (2.4%) 5 (5.9%) 0.603
s1a/m1b 4 0 (0.0%) 4 (4.7%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%)
s1a/m1b/m2 1 0 (0.0%) 1 (1.2%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%)
s1a/m2 9 0 (0.0%) 8 (9.4%) 0 (0.0%) 1 (1.2%) 0 (0.0%) 0 (0.0%)
s1c/m1b/m2 8 1 (1.2%) 4 (4.7%) 0 (0.0%) 3 (3.5%) 0 (0.0%) 0 (0.0%)
s1c/m2 35 0 (0.0%) 27 (31.8%) 0 (0.0%) 5 (5.9%) 1 (1.2%) 2 (2.4%)
s1c/m1b 26 0 (0.0%) 14 (16.5%) 2 (2.4%) 6 (7.1%) 1 (1.2%) 3 (3.5%)
m1b 2 0 (0.0%) 1 (1.2%) 0 (0.0%) 1 (1.2%) 0 (0.0%) 0 (0.0%)
iceA 85 1 (1.2%) 59 (69.4) 2 (2.4%) 16 (18.8%) 2 (2.4%) 5 (5.9%) 0.392
Negative 14 0 (0.0%) 9 (10.6%) 0 (0.0%) 5 (5.9%) 0 (0.0%) 0 (0.0%)
iceA1 55 0 (0.0%) 39 (45.9%) 1 (1.2%) 8 (9.4%) 2 (2.4%) 5 (5.9%)
iceA2 8 1 (1.2%) 5 (5.9%) 0 (0.0%) 2 (2.4%) 0 (0.0%) 0 (0.0%)
Mixed 8 0 (0.0%) 6 (7.1%) 1 (1.2%) 1 (1.2%) 0 (0.0%) 0 (0.0%)

Age is expressed as the mean ± standard deviation. n, number of strains; H. pylori, Helicobacter pylori.

A total of 85 strains were isolated, which could be stably subcultured and survive. All H. pylori isolates were gram-negative campylobacter, which are urease, oxidase, and catalase positive, and the 16S rRNA fragment specificity of their strains was positive. The presence of the cagA, vacA, and iceA genes was examined in all 85 H. pylori-infected patients with upper gastrointestinal symptoms (Figure 2).

Figure 2.

Figure 2

PCR amplification of H. pylori cagA, vacA, and iceA. (A) PCR products amplified from the H. pylori specific 16S rRNA gene. M: Marker II; lane 1–14: clinical strains; lane 15: negative control; lane 16: positive control (NCTC11637). (B) Gel electrophoresis of clinical strains with different cagA N terminals. M: Marker II; lane 1–16: cagA N-end gene positive; lane 17: negative control; lane 18: positive control (NCTC11637). (C) Gel electrophoresis of H. pylori genotyping of vacA alleles. M: Marker II. (D) Gel electrophoresis of H. pylori genotyping of iceA1 alleles. M: Marker II; lane 1–7 and 9–13: positive clinical strains; lane 8: negative clinical strains; lane 14: negative control; lane 15: positive control (NCTC11637). (E) Gel electrophoresis of H. pylori genotyping of iceA2 alleles. M: Marker II; lane 8, 11, and 14: positive clinical strains; lane 1–7,9–10, and 13: negative clinical strains; lane 16: negative control; lane 15: positive control (NCTC11637). PCR, polymerase chain reaction.

Detection of H. pylori cagA, vacA, and iceA

The cagA genotype distributions of the 85 clinical strains were cagA-AB (8.2%), ABC (3.5%), ABD (74.1%), and a negative status for the others (14.1%). None of the clinical isolates showed a cagA-BD genotype of the East Asian type. Western strains (cagA-AB genotype) only appeared in patients with chronic non-atrophic gastritis. The gastric intraepithelial neoplasia and gastric cancer groups harbored both Asian strains (cagA-ABD genotype). The distribution of H. pylori cagA genotype in each histopathological type is shown in Table 7.

The vacA genotype was detected among all clinical isolates of H. pylori, and its distribution in histopathological types is shown in Table 7. All the strains were positive for vacA; vacA s1c/m2 and s1c/m1b were the main genotypes, accounting for 41.2% and 30.6%, respectively. The vacA s1c/m2 and s1c/m1b were the most frequent combination in chronic non-atrophic gastritis. The PCR analysis data presented a summary of the diversity and allelic combinations of H. pylori in different pathology.

The iceA gene was detected in 83.5% of H. pylori; iceA1 and iceA2 were detected in 64.7% and 9.4%, respectively. iceA1 was most commonly found in chronic non-atrophic gastritis. The genotype of gastric cancer was iceA1.

There was no significant difference between the histopathological type and virulence genotypes.

Discussion

H. pylori has been confirmed as an important pathogen in the human gastrointestinal tract. Different isolates cause various gastrointestinal disorders resulting in different gastric mucosal lesions, such as injury of gastric mucosa, transformation of tissue stratum, chronic inflammation, chronic gastritis, and gastric cancer (26). However, not all patients experience these complications, and more than 50% do not show any symptoms (27). Genetic pathogenesis of different isolates and environmental characteristics are essential factors responsible for this discrepancy. We assessed H. pylori infection in patients with upper gastrointestinal diseases in Guiyang, Guizhou, China, and determined whether the pathology of the gastric mucosa was related to the infection. H. pylori was analyzed for the presence of cagA, vacA, and iceA genes.

The positive rate of H. pylori infection in our study population was 19.9%; this was significantly lower than the prevalence reported in previous studies in China. Xu et al. collected 262 gastric mucosa specimens in Beijing, and the positive rate of H. pylori detected by H&E staining was 43.9% (28). Xu et al. collected 214 gastric mucosa specimens in Ningxia, and the positive rate of H. pylori detected by H&E staining was 27.6% (29). Mai et al. collected 260 gastric mucosa specimens in Xishuangbanna, and the positive rate of H. pylori detected by H&E staining was 46.2% (30). There are several potential reasons for this difference. First, the detection of H. pylori is challenging when it is distributed unevenly in the stomach and when gastric or intestinal metaplasia is present. Intestinal metaplasia lowers the sensitivity of histopathological detection (31), as does gastric atrophy, and produces false-negative results in antral specimens (32). Second, changes in the shape of H. pylori from a “comma” or “S” to a sphere can hinder its identification. Such changes occur under some conditions in patients who have recently received proton pump inhibitors or antibiotics (33). Third, histological diagnosis of H. pylori infection largely depends on the expertise of the pathologist and the time spent on the diagnosis. Fourth, overgrowth of urease-producing bacteria can cause a false-positive result in a urea breath test, which is a quick diagnostic method routinely used in the clinic. Most urease-producing bacteria reside in the intestines or originate in the oral cavity; these include α-Streptococcus, γ-Streptococcus, Hemophilus, Enterococcus, Neisseria, Klebsiella pneumoniae, Klebsiella oxytoca, Escherichia coli, Bacillus spp., Bacteroides ovatus, and Corynebacterium. spp (34). Finally, H. pylori infection rates have probably declined because of improved living and sanitation conditions and the spread of knowledge about related diseases (35,36). Recent meta-analyses have shown that the eradication of H. pylori reduces the incidence of gastric cancer by 33–47% (37).

In our study, H. pylori was more frequently detected in men than in women. This result is consistent with that of Zamani et al. (38). The difference in detection rate between the sexes may reflect more frequent alcohol and tobacco use by men than by women (38,39). Hence, healthy living habits may play an important role in reducing the frequency of H. pylori infections.

According to previous study, the positive rate of H. pylori infection and incidence of gastric cancer is highest among patients 40–60 years old (40). Therefore, this study assessed the positive rate of infection in 3 age groups (15–39, 40–59, and >60 years old). We found no association between age and the positive rate of H. pylori infection. This result is consistent with that of Binh et al. (41). The H. pylori load in the gastric mucosa may be lower in older people, particularly those aged >60 years, because of the physiological atrophy of the stomach glands or the occurrence of intestinal metaplasia. Further investigation is needed to confirm these findings.

In this study, the participants were divided into 4 groups based on the histopathology of the gastric mucosal lesion. The gastric precancerous lesion group had the highest prevalence of H. pylori infection, whereas the gastric cancer group had the lowest. The low prevalence of infection in patients with gastric cancer is inconsistent with previous findings (42). This may be explained by reduced gastric acid secretion due to gastric gland atrophy and loss of parietal cells after the gastric lesion has progressed to gastric cancer (43). Moreover, cancer-related changes in stomach acidity may have inhibited or obscured the growth of H. pylori or facilitated the growth of other bacteria (44). It is also possible that malignant mucosa is not suitable for H. pylori colonization. Finally, our patients might have previously received anti-H. pylori treatment. We found that the H. pylori load in the non-atrophic gastritis group, precancerous condition group, and precancerous lesion group gradually increased in a severity-dependent manner. This finding agrees with those of several national and international studies (45,46).

The major virulence genes of H. pylori, including cagA and vacA, are polymorphic in different regions. The cagA-positive rate of H. pylori strains in Western countries has been reported as 50–60% (47,48), and the cagA H. pylori strain is closely related to the severity of the disease (49). In Western countries, patients infected with cagA-positive H. pylori strains have been shown to face an increased risk of peptic ulcers and gastric cancers than those infected with cagA-negative strains (50), and patients infected with multiple EPIYA-C segments H. pylori have been reported to have a higher gastric cancer risk than those infected with a single EPIYA-C segment strain (51). However, in Asia, particularly in China, Korea, and Japan, the positive rate of cagA was higher than 80–90% (52-55). The present study result is similar to that of Macau’s by Pinto-Ribeiro et al. (56). A new study shows cagA-positive H. pylori strains can increase the risk of gastric ulcers and cancers, and the amounts of interleukins that are secreted during H. pylori infection are highly associated with the number and the variations within C-terminal EPIYA motifs; for instance, H. pylori strains with the EPIYA-D motif are prone to release higher amounts of interleukin-8 compared to other variations (57). In this study, 85 H. pylori strains were isolated and 74.1% were cagA East Asian type. Western strains (cagA-AB genotype) only appeared in patients with chronic non-atrophic gastritis. The gastric intraepithelial neoplasia and gastric cancer harbored both Asian strains (cagA-ABD genotype). However, it is notable that the Western type in this study only existed in the non-atrophic gastritis group, suggesting that the pathogenicity of the Western type is relatively weak and the risk of cancer is low.

VacA is another important virulence gene of H. pylori that has been studied worldwide. It also has geographical and ethnic differences, the vacA s1c genotype is common in East Asia, the s1b genotype is common in Spain, Latin America, and Poland, the s1m1 genotype is common in Japan and South Korea (52,58), whereas the m2 genotype is predominant in Taiwan and Myanmar (11). The result of this study shows that the predominant vacA genotype was s1m1 and s1m2 in Eastern China (59). The mosaic combination of s- and m-region allelic types has been shown to produce cytotoxins, and was associated with the bacterium’s pathogenicity. In general, s1m1 and s1m2 strains produced high and moderate levels of toxins, respectively, whereas s2m2 strains produced little or no toxin (22). The vacA m1 strains have been associated with more significant gastric epithelial damage than m2 strains (60). The vacA subtypes: s1as1bm2, s2 m2 and m2, s1bm2 were significantly correlated to gastritis, whereas, subtypes s1am1, s1am2, m1 were significantly associated with gastric and duodenal ulcers (12). A present study reveals a significant association between the strains carrying the vacA m1 alleles and intestinal metaplasia in addition to gastric cancer (61). In this study, the vacA genotypes of the 85 H. pylori strains were diverse, but s1c/m1b (30.6%) and s1c/m2 (41.2%) were the dominant genotypes and the most frequent combination in chronic non-atrophic gastritis. No correlation was found between vacA genotypes and gastric mucosa pathological changes; however, it showed the diversity and allelic combinations of H. pylori in different pathology.

The overall prevalence of iceA was 69.25% in China and 56.06% in other countries; a recent study showed that the prevalence of iceA1 significantly increased the risk of peptic ulcer disease. In this study, the prevalence of iceA1 was 64.7%, similar to that reported by Huang et al. (62). The presence of iceA was not associated with gastric cancer, but presence of iceA1 was significantly associated with peptic ulcer, while the presence of iceA2 was inversely associated with peptic ulcer (63). Our results revealed no pathological differences regarding the of distribution of H. pylori iceA genotypes. The iceA1 genotype was most commonly found genotype in chronic non-atrophic gastritis and chronic atrophic gastritis with intestinal metaplasia.

In addition to bacterial factors, mostly unknown host factors seem to influence the inflammatory response and the development of a more severe pathology. The response of T helper cells to H. pylori is generally thought to be the T-helper-1 (Th1) phenotype, leading to a cell-mediated immune response, whose important cytokines are interferon c (IFN-c), tumor necrosis factor A (TNF-a), and interleukin-1b (IL-1b). A study had shown that cytokine gene polymorphisms affect cytokine expression, gastric inflammation, and strain selection in H. pylori infection (64). A negative correlation between the presence of cagA and expression of programmed cell death protein-ligand 1 (PD-L1) mRNA in patients with gastritis, but not in ulcers. PD-L1 correlated positively with vacA m1 and vacA s1/m1, whereas negatively with vacA m2 and vacA s1/m2 in patients with gastric ulcer. Furthermore, vacA m1/m2 correlates negatively with programmed cell death protein-1 (PD-1) and PD-L1 in patients with gastritis, whereas positively with FOXP3 and interleukin-17 in gastritis and ulcer patients (65). Proliferation of gastric mucosa and the expression of mutated p53 gene can be greatly increased by H. pylori during the development of gastric cancer, and H. pylori can induce apoptosis in the phase of metaplasia, but in the phase of dysplasia H. pylori can inhibit cellular apoptosis (66).

A primary limitation of this study was the small number of strains obtained. However, our results suggest that the strains causing more serious mucosal lesions and cancer risk in Guiyang are the East Asian strains. It is recommended that patients clinically infected with East Asian strains should be treated as soon as possible. With the promotion of early gastric cancer screening, it is necessary to increase the sample size, isolate H. pylori from the gastric mucosa of early cancer patients, continue virulence genotyping, and study the carcinogenic risk of EPIYA motif subtype of East Asian strains.

Conclusions

In conclusion, most patients with upper gastrointestinal diseases in this study had evidence of inflammation of the gastric mucosa, regardless of their H. pylori infection status. We found that the prevalence of H. pylori infection was related to the pathological type of gastric mucosal lesion. In patients with upper gastrointestinal diseases, endoscopy and biopsy of gastric mucosal lesions for pathological examination are recommended, regardless of the severity of the disease. The cagA East Asian type was the most common cagA genotype. The distribution of cagA, vacA, and iceA genotypes was not significantly correlated with the pathological type of gastric mucosa. Moreover, patients with gastric mucosal atrophy and intestinal metaplasia should undergo long-term follow-up observation with endoscopy to ensure timely treatment of the disease.

Supplementary

The article’s supplementary files as

atm-10-24-1320-rc.pdf (149.6KB, pdf)
DOI: 10.21037/atm-22-5553
atm-10-24-1320-dss.pdf (87.6KB, pdf)
DOI: 10.21037/atm-22-5553
DOI: 10.21037/atm-22-5553

Acknowledgments

The authors would like to thank the Guiyang Hospital of Guizhou Aviation Industry and the Affiliated Cancer Hospital of Guizhou Medical University for providing us with an excellent data collection platform.

Funding: This work was supported by grants from the Research Foundation of The Affiliated Hospital of Guizhou Medical University (Nos. GYFYMF002 and GYFYMF001), and the Foundation of Key Laboratory of Microbiology and Parasitology of Education Department, Guizhou (No. QJJ [2022] 019).

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the ethics committee of the Affiliated Hospital of Guizhou Medical University (No. 2018-100) and informed consent was taken from all the patients. Guiyang Hospital of Guizhou Aviation Industry was informed and agreed the study.

Footnotes

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://atm.amegroups.com/article/view/10.21037/atm-22-5553/rc

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-5553/coif). The authors have no conflicts of interest to declare.

References

  • 1.Warren JR, Marshall B. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet 1983;1:1273-5. [PubMed] [Google Scholar]
  • 2.Sharndama HC, Mba IE. Helicobacter pylori: an up-to-date overview on the virulence and pathogenesis mechanisms. Braz J Microbiol 2022;53:33-50. 10.1007/s42770-021-00675-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Goh KL, Chan WK, Shiota S, et al. Epidemiology of Helicobacter pylori infection and public health implications. Helicobacter 2011;16 Suppl 1:1-9. 10.1111/j.1523-5378.2011.00874.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Peleteiro B, Bastos A, Ferro A, et al. Prevalence of Helicobacter pylori infection worldwide: a systematic review of studies with national coverage. Dig Dis Sci 2014;59:1698-709. 10.1007/s10620-014-3063-0 [DOI] [PubMed] [Google Scholar]
  • 5.Ren S, Cai P, Liu Y, et al. Prevalence of Helicobacter pylori infection in China: A systematic review and meta-analysis. J Gastroenterol Hepatol 2022;37:464-70. 10.1111/jgh.15751 [DOI] [PubMed] [Google Scholar]
  • 6.Shetty V, Lingadakai R, Pai GC, et al. Profile of Helicobacter pylori cagA &vacA genotypes and its association with the spectrum of gastroduodenal disease. Indian J Med Microbiol 2021;39:495-9. 10.1016/j.ijmmb.2021.06.001 [DOI] [PubMed] [Google Scholar]
  • 7.Wang YK, Kuo FC, Liu CJ, et al. Diagnosis of Helicobacter pylori infection: Current options and developments. World J Gastroenterol 2015;21:11221-35. 10.3748/wjg.v21.i40.11221 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.El-Shabrawi M, El-Aziz NA, El-Adly TZ, et al. Stool antigen detection versus 13C-urea breath test for non-invasive diagnosis of pediatric Helicobacter pylori infection in a limited resource setting. Arch Med Sci 2018;14:69-73. 10.5114/aoms.2016.61031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chey WD, Wong BC, Practice Parameters Committee of the American College of Gastroenterology . American College of Gastroenterology guideline on the management of Helicobacter pylori infection. Am J Gastroenterol 2007;102:1808-25. 10.1111/j.1572-0241.2007.01393.x [DOI] [PubMed] [Google Scholar]
  • 10.Castaneda AC, Castillo M, Sanchez J, et al. Detection of Helicobacter pylori in gastric cancer tissue through histopathology, immunohistochemistry and real-time reverse transcription-PCR. Future Microbiol 2020;15:1131-37. 10.2217/fmb-2019-0280 [DOI] [PubMed] [Google Scholar]
  • 11.Myint T, Shiota S, Vilaichone RK, et al. Prevalence of Helicobacter pylori infection and atrophic gastritis in patients with dyspeptic symptoms in Myanmar. World J Gastroenterol 2015;21:629-36. 10.3748/wjg.v21.i2.629 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Akeel M, Shehata A, Elhafey A, et al. Helicobacter pylori vacA, cagA and iceA genotypes in dyspeptic patients from southwestern region, Saudi Arabia: distribution and association with clinical outcomes and histopathological changes. BMC Gastroenterol 2019;19:16. 10.1186/s12876-019-0934-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Khatoon J, Prasad KN, Prakash Rai R, et al. Association of heterogenicity of Helicobacter pylori cag pathogenicity island with peptic ulcer diseases and gastric cancer. Br J Biomed Sci 2017;74:121-6. 10.1080/09674845.2017.1278887 [DOI] [PubMed] [Google Scholar]
  • 14.van Doorn LJ, Schneeberger PM, Nouhan N, et al. Importance of Helicobacter pylori cagA and vacA status for the efficacy of antibiotic treatment. Gut 2000;46:321-6. 10.1136/gut.46.3.321 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Acosta N, Quiroga A, Delgado P, et al. Helicobacter pylori CagA protein polymorphisms and their lack of association with pathogenesis. World J Gastroenterol 2010;16:3936-43. 10.3748/wjg.v16.i31.3936 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tegtmeyer N, Wessler S, Necchi V, et al. Helicobacter pylori Employs a Unique Basolateral Type IV Secretion Mechanism for CagA Delivery. Cell Host Microbe 2017;22:552-560.e5. 10.1016/j.chom.2017.09.005 [DOI] [PubMed] [Google Scholar]
  • 17.Yong X, Tang B, Li BS, et al. Helicobacter pylori virulence factor CagA promotes tumorigenesis of gastric cancer via multiple signaling pathways. Cell Commun Signal 2015;13:30. 10.1186/s12964-015-0111-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yin L, Liu F, Guo C, et al. Analysis of virulence diversity of 73 Helicobacter pylori strains isolated in Guizhou province, China. Mol Med Rep 2018;18:4611-20. 10.3892/mmr.2018.9462 [DOI] [PubMed] [Google Scholar]
  • 19.Gangwer KA, Shaffer CL, Suerbaum S, et al. Molecular evolution of the Helicobacter pylori vacuolating toxin gene vacA. J Bacteriol 2010;192:6126-35. 10.1128/JB.01081-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.McClain MS, Cao P, Iwamoto H, et al. A 12-amino-acid segment, present in type s2 but not type s1 Helicobacter pylori VacA proteins, abolishes cytotoxin activity and alters membrane channel formation. J Bacteriol 2001;183:6499-508. 10.1128/JB.183.22.6499-6508.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hashinaga M, Suzuki R, Akada J, et al. Differences in amino acid frequency in CagA and VacA sequences of Helicobacter pylori distinguish gastric cancer from gastric MALT lymphoma. Gut Pathog 2016;8:54. 10.1186/s13099-016-0137-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Tan HJ, Rizal AM, Rosmadi MY, et al. Distribution of Helicobacter pylori cagA, cagE and vacA in different ethnic groups in Kuala Lumpur, Malaysia. J Gastroenterol Hepatol 2005;20:589-94. 10.1111/j.1440-1746.2005.03783.x [DOI] [PubMed] [Google Scholar]
  • 23.Hemmatinezhad B, Momtaz H, Rahimi E. VacA, cagA, iceA and oipA genotypes status and antimicrobial resistance properties of Helicobacter pylori isolated from various types of ready to eat foods. Ann Clin Microbiol Antimicrob 2016;15:2. 10.1186/s12941-015-0115-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Amjad N, Osman HA, Razak NA, et al. Clinical significance of Helicobacter pylori cagA and iceA genotype status. World J Gastroenterol 2010;16:4443-7. 10.3748/wjg.v16.i35.4443 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sicinschi LA, Correa P, Peek RM, et al. CagA C-terminal variations in Helicobacter pylori strains from Colombian patients with gastric precancerous lesions. Clin Microbiol Infect 2010;16:369-78. 10.1111/j.1469-0691.2009.02811.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Han SJ, Kim SG, Lim JH, et al. Long-Term Effects of Helicobacter pylori Eradication on Metachronous Gastric Cancer Development. Gut Liver 2018;12:133-41. 10.5009/gnl17073 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Emara MH, Salama RI, Salem AA. Demographic, Endoscopic and Histopathologic Features Among Stool H. pylori Positive and Stool H. pylori Negative Patients With Dyspepsia. Gastroenterology Res 2017;10:305-10. 10.14740/gr886w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Xu SP, LI Y, Wu BY, et al. Diagnostic value of routine HE staining in gastric mucosa biopsy for Helicobacter pylori infection. World Journal of Chinese Digestion 2004;12:2. [Google Scholar]
  • 29.Xu WD, LI GF, Zhang HM, et al. Comparison of different methods in detecting Helicobacter pylori infection in gastric mucosa biopsy. J Clin Exp Pathol 2014;30:4. [Google Scholar]
  • 30.Mai HL, Zhang WH, Yang R, et al. Diagnostic Value of Routine HE Staining for Gastric Mucosal Biopsy for Helicobacter Pylori Infection. Smart Healthcare 2018;4:127. [Google Scholar]
  • 31.Shin CM, Kim N, Lee HS, et al. Validation of diagnostic tests for Helicobacter pylori with regard to grade of atrophic gastritis and/or intestinal metaplasia. Helicobacter 2009;14:512-9. 10.1111/j.1523-5378.2009.00726.x [DOI] [PubMed] [Google Scholar]
  • 32.Satoh K, Kimura K, Taniguchi Y, et al. Biopsy sites suitable for the diagnosis of Helicobacter pylori infection and the assessment of the extent of atrophic gastritis. Am J Gastroenterol 1998;93:569-73. 10.1111/j.1572-0241.1998.166_b.x [DOI] [PubMed] [Google Scholar]
  • 33.Mégraud F, Lehours P. Helicobacter pylori detection and antimicrobial susceptibility testing. Clin Microbiol Rev 2007;20:280-322. 10.1128/CMR.00033-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Furuta T, Baba S, Yamade M, et al. High incidence of autoimmune gastritis in patients misdiagnosed with two or more failures of H. pylori eradication. Aliment Pharmacol Ther 2018;48:370-7. 10.1111/apt.14849 [DOI] [PubMed] [Google Scholar]
  • 35.Venneman K, Huybrechts I, Gunter MJ, et al. The epidemiology of Helicobacter pylori infection in Europe and the impact of lifestyle on its natural evolution toward stomach cancer after infection: A systematic review. Helicobacter 2018;23:e12483. 10.1111/hel.12483 [DOI] [PubMed] [Google Scholar]
  • 36.Tang MYL, Chung PHY, Chan HY, et al. Recent trends in the prevalence of Helicobacter Pylori in symptomatic children: A 12-year retrospective study in a tertiary centre. J Pediatr Surg 2019;54:255-7. 10.1016/j.jpedsurg.2018.10.079 [DOI] [PubMed] [Google Scholar]
  • 37.Leung WK, Wong IOL, Cheung KS, et al. Effects of Helicobacter pylori Treatment on Incidence of Gastric Cancer in Older Individuals. Gastroenterology 2018;155:67-75. 10.1053/j.gastro.2018.03.028 [DOI] [PubMed] [Google Scholar]
  • 38.Zamani M, Ebrahimtabar F, Zamani V, et al. Systematic review with meta-analysis: the worldwide prevalence of Helicobacter pylori infection. Aliment Pharmacol Ther 2018;47:868-76. 10.1111/apt.14561 [DOI] [PubMed] [Google Scholar]
  • 39.Ibrahim A, Morais S, Ferro A, et al. Sex-differences in the prevalence of Helicobacter pylori infection in pediatric and adult populations: Systematic review and meta-analysis of 244 studies. Dig Liver Dis 2017;49:742-9. 10.1016/j.dld.2017.03.019 [DOI] [PubMed] [Google Scholar]
  • 40.Eom BW, Jung KW, Won YJ, et al. Trends and Outcomes of Non-compliance with Treatment for Gastric Cancer in Korea over the 16 years from 1999 to 2005. J Gastric Cancer 2019;19:92-101. 10.5230/jgc.2019.19.e5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Binh TT, Tuan VP, Dung HDQ, et al. Molecular Epidemiology of Helicobacter pylori Infection in a Minor Ethnic Group of Vietnam: A Multiethnic, Population-Based Study. Int J Mol Sci 2018;19:708. 10.3390/ijms19030708 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kwak HW, Choi IJ, Cho SJ, et al. Characteristics of gastric cancer according to Helicobacter pylori infection status. J Gastroenterol Hepatol 2014;29:1671-7. 10.1111/jgh.12605 [DOI] [PubMed] [Google Scholar]
  • 43.Osawa H, Inoue F, Yoshida Y. Inverse relation of serum Helicobacter pylori antibody titres and extent of intestinal metaplasia. J Clin Pathol 1996;49:112-5. 10.1136/jcp.49.2.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Al-Marhoon MS, Nunn S, Soames RW. Effects of cagA+ and cagA- strains of Helicobacter pylori on the human gastric mucus layer thickness. J Gastroenterol Hepatol 2005;20:1246-52. 10.1111/j.1440-1746.2005.03853.x [DOI] [PubMed] [Google Scholar]
  • 45.Abu-Taleb AMF, Abdelattef RS, Abdel-Hady AA, et al. Prevalence of helicobacter pylori cagA and iceA Genes and Their Association with Gastrointestinal Diseases. Int J Microbiol 2018;2018:4809093. 10.1155/2018/4809093 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Pan KF, Formichella L, Zhang L, et al. Helicobacter pylori antibody responses and evolution of precancerous gastric lesions in a Chinese population. Int J Cancer 2014;134:2118-25. 10.1002/ijc.28560 [DOI] [PubMed] [Google Scholar]
  • 47.Miernyk K, Morris J, Bruden D, et al. Characterization of Helicobacter pylori cagA and vacA genotypes among Alaskans and their correlation with clinical disease. J Clin Microbiol 2011;49:3114-21. 10.1128/JCM.00469-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yamaoka Y. Mechanisms of disease: Helicobacter pylori virulence factors. Nat Rev Gastroenterol Hepatol 2010;7:629-41. 10.1038/nrgastro.2010.154 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Sedaghat H, Moniri R, Jamali R, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA, babA2, and oipA genotypes in patients with upper gastrointestinal diseases. Iran J Microbiol 2014;6:14-21. [PMC free article] [PubMed] [Google Scholar]
  • 50.van Doorn LJ, Figueiredo C, Sanna R, et al. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 1998;115:58-66. 10.1016/s0016-5085(98)70365-8 [DOI] [PubMed] [Google Scholar]
  • 51.Argent RH, Kidd M, Owen RJ, et al. Determinants and consequences of different levels of CagA phosphorylation for clinical isolates of Helicobacter pylori. Gastroenterology 2004;127:514-23. 10.1053/j.gastro.2004.06.006 [DOI] [PubMed] [Google Scholar]
  • 52.Kim SY, Woo CW, Lee YM, et al. Genotyping CagA, VacA subtype, IceA1, and BabA of Helicobacter pylori isolates from Korean patients, and their association with gastroduodenal diseases. J Korean Med Sci 2001;16:579-84. 10.3346/jkms.2001.16.5.579 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Maeda S, Yoshida H, Ikenoue T, et al. Structure of cag pathogenicity island in Japanese Helicobacter pylori isolates. Gut 1999;44:336-41. 10.1136/gut.44.3.336 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Ghotaslou R, Milani M, Akhi MT, et al. Diversity of Helicobacter Pylori cagA and vacA Genes and Its Relationship with Clinical Outcomes in Azerbaijan, Iran. Adv Pharm Bull 2013;3:57-62. 10.5681/apb.2013.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Zhou J, Zhang J, Xu C, et al. cagA genotype and variants in Chinese Helicobacter pylori strains and relationship to gastroduodenal diseases. J Med Microbiol 2004;53:231-5. 10.1099/jmm.0.05366-0 [DOI] [PubMed] [Google Scholar]
  • 56.Pinto-Ribeiro I, Ferreira RM, Batalha S, et al. Helicobacter pylori vacA Genotypes in Chronic Gastritis and Gastric Carcinoma Patients from Macau, China. Toxins (Basel) 2016;8:142. 10.3390/toxins8050142 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Bridge DR, Blum FC, Jang S, et al. Creation and Initial Characterrization of Isogenic Helicobacter pylori CagA EPIYA Variants Reveals Differential Activation of Host Cell Signaling Pathway. Sci Rep 2017;7:1-14. 10.1038/s41598-017-11382-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Yamaoka Y, Kodama T, Gutierrez O, et al. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol 1999;37:2274-9. 10.1128/JCM.37.7.2274-2279.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Qiao W, Hu JL, Xiao B, et al. cagA and vacA genotype of Helicobacter pylori associated with gastric diseases in Xi'an area. World J Gastroenterol 2003;9:1762-6. 10.3748/wjg.v9.i8.1762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Atherton JC, Cao P, Peek RM, Jr, et al. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem 1995;270:17771-7. 10.1074/jbc.270.30.17771 [DOI] [PubMed] [Google Scholar]
  • 61.El Khadir M, Boukhris Alaoui S, Benajah DA, et al. VacA genotypes and cagA-EPIYA-C motifs of Helicobacter pylori and gastric histopathological lesions. Int J Cancer 2020;147:3206-14. 10.1002/ijc.33158 [DOI] [PubMed] [Google Scholar]
  • 62.Huang X, Deng Z, Zhang Q, et al. Relationship between the iceA gene of Helicobacter pylori and clinical outcomes. Ther Clin Risk Manag 2016;12:1085-92. 10.2147/TCRM.S107991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Shiota S, Watada M, Matsunari O, et al. Helicobacter pylori iceA, clinical outcomes, and correlation with cagA: a meta-analysis. PLoS One 2012;7:e30354. 10.1371/journal.pone.0030354 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Rad R, Dossumbekova A, Neu B, et al. Cytokine gene polymorphisms influence mucosal cytokine expression, gastric inflammation, and host specific colonisation during Helicobacter pylori infection. Gut 2004;53:1082-89. 10.1136/gut.2003.029736 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Aydın EM, Demir TD, Seymen N, et al. The crosstalk between H. pylori virulence factors and the PD1:PD-L1 immune checkpoint inhibitors in progression to gastric cancer. Immunol Lett 2021;239:1-11. 10.1016/j.imlet.2021.06.009 [DOI] [PubMed] [Google Scholar]
  • 66.Zhang Z, Yuan Y, Gao H, et al. Apoptosis, proliferation and p53 gene expression of H. pylori associated gastric epithelial lesions. World J Gastroenterol 2001;7:779-82. 10.3748/wjg.v7.i6.779 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

The article’s supplementary files as

atm-10-24-1320-rc.pdf (149.6KB, pdf)
DOI: 10.21037/atm-22-5553
atm-10-24-1320-dss.pdf (87.6KB, pdf)
DOI: 10.21037/atm-22-5553
DOI: 10.21037/atm-22-5553

Articles from Annals of Translational Medicine are provided here courtesy of AME Publications

RESOURCES