Skip to main content
Frontiers in Plant Science logoLink to Frontiers in Plant Science
. 2023 Jan 4;13:1048168. doi: 10.3389/fpls.2022.1048168

Whole genome resequencing identifies candidate genes and allelic diagnostic markers for resistance to Ralstonia solanacearum infection in cultivated peanut (Arachis hypogaea L.)

Chong Zhang 1,2,3, Wenping Xie 1,2, Huiwen Fu 1,2, Yuting Chen 1,2, Hua Chen 1,2, Tiecheng Cai 1,2, Qiang Yang 1,2, Yuhui Zhuang 1,2, Xin Zhong 1,2, Kun Chen 1,2, Meijia Gao 1,2, Fengzhen Liu 3, Yongshan Wan 3, Manish K Pandey 4, Rajeev K Varshney 1,5,*, Weijian Zhuang 1,2,*
PMCID: PMC9845939  PMID: 36684803

Abstract

Bacterial wilt disease (BWD), caused by Ralstonia solanacearum is a major challenge for peanut production in China and significantly affects global peanut field productivity. It is imperative to identify genetic loci and putative genes controlling resistance to R. solanacearum (RRS). Therefore, a sequencing-based trait mapping approach termed “QTL-seq” was applied to a recombination inbred line population of 581 individuals from the cross of Yueyou 92 (resistant) and Xinhuixiaoli (susceptible). A total of 381,642 homozygous single nucleotide polymorphisms (SNPs) and 98,918 InDels were identified through whole genome resequencing of resistant and susceptible parents for RRS. Using QTL-seq analysis, a candidate genomic region comprising of 7.2 Mb (1.8–9.0 Mb) was identified on chromosome 12 which was found to be significantly associated with RRS based on combined Euclidean Distance (ED) and SNP-index methods. This candidate genomic region had 180 nonsynonymous SNPs and 14 InDels that affected 75 and 11 putative candidate genes, respectively. Finally, eight nucleotide binding site leucine rich repeat (NBS-LRR) putative resistant genes were identified as the important candidate genes with high confidence. Two diagnostic SNP markers were validated and revealed high phenotypic variation in the different resistant and susceptible RIL lines. These findings advocate the expediency of the QTL-seq approach for precise and rapid identification of candidate genomic regions, and the development of diagnostic markers that are applicable in breeding disease-resistant peanut varieties.

Keywords: peanut, resistance to Ralstonia solanacearum , QTL-seq analysis, candidate genes, diagnostic markers

1. Introduction

Bacterial wilt that is caused by Ralstonia solanacearum (R. solanacearum), is the most damaging bacterial disease that globally affects over 50 and 450 botanical families and plant species, respectively, including several economically important crops such as tobacco, peanut, tomato, and pepper (Salanoubat et al., 2002; Zhang et al., 2017). R. solanacearum is a free-living saprophyte that endures in soil and aquatic habitats for long durations (Genin and Boucher, 2004). R. solanacearum mostly infects plant roots, propagates in the xylem, disseminates into the stem, and then to the entire plant resulting in wilt and eventual death (Schell, 2000). Bacterial wilt disease often significantly reduces, by 10~30%, the yield and quality of peanut and other important crops; it may also result in complete yield loss (Zhang et al., 2017). Currently, no effective pesticide and biological control method exists to control this pathogen because of its wide host range and durable survival ability (Yu et al., 2011). Nevertheless, cultivating crop varieties that are genetically resistant has efficiently controlled this disease (Sunkara et al., 2014; Reddy, 2016), leading to the development and release of many resistant varieties of the peanut. However, there exists a looming threat of a breakdown of this genetic resistance in China, due to similar resistance mechanisms in both the cultivated varieties (such as Xiekangqing, Taishan Zhenzhu) and wild species (Janila et al., 2016; Luo et al., 2020). Despite the current search for varieties whose resistance is conferred via alternate mechanisms, it is imperative to determine the genomic regions and genes that encode resistance to augment the development of new varieties via genomics-assisted breeding (GAB) (Pandey et al., 2020).

Through analysis of various plant genomes, map-based cloning of plant genes that confer resistance to R. solanacearum was conducted for a few crop species. In Arabidopsis, a recessive RRS1-R encoding a Tir-NBS-LRR resistant protein with a WRKY domain in resistant line Nd-1 was first identified and cloned by fine mapping (Deslandes et al., 2003). It conferred resistance to GMI1000 when transferred into Col-5 variants with the dominant susceptible allele. Furthermore, another resistant gene RPS4 was in the reverse orientation and directly upstream of RRS1-R. This physical association triggered host resistance to the pathogen (Narusaka et al., 2009). Relatedly, RRS1-R associated with RPS4 is a dimer that recognizes PopP2 of R. solanacearum to trigger RRS (Narusaka et al., 2014). In Arabidopsis, three quantitative trait loci (QTLs) for RRS were identified in 100 F9 recombinant inbred lines (RILs) from another cross of Col-0 × Ler (Godiard et al., 2003). A putative leucine-rich repeat receptor-like kinase (LRR-RLK) gene named ERECTA was cloned and found to trigger RRS (Godiard et al., 2003). Recently, in peanut, two genes AhRRS5 and AhRLK1 (also known as AhCLAVATA1), encoding an NBS-LRR resistance protein and a receptor-like protein kinase, respectively, were identified by reverse genetics. Transgenic tobaccos that overexpressed these two genes conferred a significantly increased level of resistance to RRS, indicating that both R genes and RLKs are involved in resistance mechanisms against BWD (Zhang et al., 2017; Zhang et al., 2019). Hitherto, no resistance genes from other plants have been cloned and characterized by the map-based method.

Recently, several QTLs associated with RRS were effectively identified by QTL mapping in many crop species, including tomato (Thoquet et al., 1996; Carmeille et al., 2006; Wang et al., 2013; Shin et al., 2020), pepper (Mimura et al., 2009) (Du et al., 2019), potato (Habe et al., 2019), eggplant (Lebeau et al., 2013; Salgon et al., 2017), tobacco (Wang et al., 2013) and Medicago truncatula (Ben et al., 2013). Up to now, both sequencing-based trait mapping and gene discovery techniques are highly utilized due to low sequencing costs and the development of new methods that elucidate genomic loci and candidate genes associated with specific traits (Varshney et al., 2019; Pandey et al., 2020). Such efforts facilitate faster development of diagnostic markers which can be employed in GAB to accelerate the development of new peanut varieties (Pandey et al., 2020). In peanut, Zhao et al. (Zhao et al., 2016) first reported mapping QTL for RRS on the B02 chromosome using a moderately dense linkage map of 237 SSR and SNP markers. By combining restriction-site-associated DNA sequencing (RAD-seq) and bulk segregant analysis (BSA) techniques, they developed resistant-related SNP markers from the RIL population of crosses between resistant (Yueyou 92) and susceptible (Xinhuixiaoli) varieties. The two detected QTLs (qBW-1 and qBW-2) in the aforementioned RRS study accounted for 21% and 12% of the resistance phenotypic variance in the F2 generation, respectively. Only two side-by-side QTLs were found at the qBW-1 locus on the B02 chromosome in the F8 generation. The resistant resource of Yueyou 92 was from a Chinese landrace Xiekangqing, which is a major source of parental types used for breeding BWD-resistant variants in South China (Janila et al., 2016; Luo et al., 2020).

The rapid QTL-seq approach is critical for identifying genomic regions of a trait of interest in plants and identifies QTLs based on BSA and next-generation sequencing (Takagi et al., 2013). QTL-seq was the preferred choice of a fast and effective method that identifies and maps QTLs of target traits in crop plants (Takagi et al., 2013). For example, it was to identify QTLs of the target trait in rice (Arikit et al., 2019; Bommisetty et al., 2020; Lei et al., 2020; Yang et al., 2021), cucumber (Lu et al., 2014; Cao et al., 2021; Zhang et al., 2021), chickpea (Das et al., 2014; Singh et al., 2016; Srivastava et al., 2017), tomato (Illa et al., 2015; Topcu et al., 2021), oilseed rape (Wang et al., 2016; Tudor et al., 2020; Dong et al., 2021), maize (Chen et al., 2018; Wang et al., 2021), and peanut (Pandey et al., 2017; Clevenger et al., 2018; Luo et al., 2019; Kumar et al., 2020; Luo et al., 2020; Topcu et al., 2021). In peanut, it was used to map genomic loci and candidate genes for the development of diagnostic markers for RRS in 195 RILs obtained by crossing Yuanza 9102 and Xuzhou 68-4 (Luo et al., 2019). A major and stable QTL (qBWRB02.1) on chromosome B02 was identified, which was significantly associated with RRS in three environments. Moreover, two SNP sites were confirmed in diverse breeding lines and cultivars. Unlike Yueyou 92, Yuanza 9102 was derived from the wild species Arachis diogoi that was resistant to BWD (Janila et al., 2016; Luo et al., 2019). A stable QTL for RRS was finely mapped via both linkage mapping and QTL-seq tools in a resistant peanut cultivar (Luo et al., 2020). Two hundred and sixty-eight RILs were sequenced, and the phenotypes of variants from the cross between Xuhua 13 (susceptible) and Zhonghua 6 (resistant) among five environments were evaluated. Using both SSR- and SNP-based genetic maps, the QTL qBWRB02-1 was identified on chromosome B02 as previously reported (Zhao et al., 2016), and this accounted for 37.79–78.86% phenotypic variation across the five environments. Two adjacent candidate QTL regions in the qBWRB02-1 locus were segmented into qBWRB02-1-1 (2.81-4.24 Mb) and qBWRB02-1-2 (6.54-8.75 Mb) (Luo et al., 2020). QBWRB02-1-1 accounted for 49.43–68.86% phenotypic variation explained (PVE), which was higher than that for qBWRB02-1-2 (3.96–6.48% PVE). Moreover, this was validated by competitive allele-specific PCR (KASP) markers in different RILs and natural populations (Luo et al., 2020).

In this study, we utilized a QTL-seq approach to identify concomitant genomic regions, candidate resistance genes and diagnostic markers in a bacterial wilt-resistant peanut variety, Yueyou92. A 7.2 Mb candidate genomic region was elucidated on chromosome 12 significantly associated with RRS. This study reports successful discovery of followed by candidate resistance genes and validated markers for potential use in marker-assisted selection (MAS) for RRS in peanut breeding programs.

2 Materials and methods

2.1 Plant material and growth

Yueyou 92 (YY92), a variety that is highly resistant to BWD, was bred by the Guangdong Academy of Agricultural Sciences, China. It stemmed from Xiekangqing, which was resistant to R. solanacearum strains from different parts of China. In comparison, Xinhuixiaoli (XHXL) was a Chinese landrace that was highly susceptible to BWD. Their resistance validation was stable during multiple years of field assessment ( Figure 1 ). A RIL population containing 581 lines was developed from the cross Yueyou 92 × Xinhuixiaoli using the single seed descent (SSD) method. A total of 581 F13 RILs were used for trait mapping for RRS. To assess the diagnostic markers, we utilized 18 resistant and 18 susceptible RILs for genotyping using allele-specific markers. All the RILs and parents were cultivated in a field in Yangzhong County (Sanming, Fujian, China).

Figure 1.

Figure 1

Phenotypic variations and construction of the extreme bulks for resistance to Ralstonia solanacearum infections. (A) Comparative evaluation of the stability of the resistance between the two parents in the three different crop seasons (2016_Spring, 2016_Autumn, and 2017_Spring). (B) Frequency distribution of disease indexes in the RIL population at three different times. The y-axis represented the number of plants, whereas the x-axis represented the disease index. The red dashed box represented the resistant bulk (R-bulk), and the green dashed box represented the susceptible bulk (S-bulk). (C) Classification of bacterial wilt disease severity. Disease severity was classified using the following scale: 1 = the inoculated leaflets either had wilt or were absent but the entire plant was intact and lacked wilt; 2 = the main stem/branches of the inoculated leaves had wilt and chlorosis; 3 = the lateral branches of the inoculated leaves had wilt or were faded green, but the main stem was green; 4 = the entire plant had wilted and died, but all its branches were green. 5 = the entire plant had wilted and dried up. Bar: 1 cm. (D) Phenotypic variations among the RILs selected for the development of extreme bulks for bacterial wilt resistance. Based on mean values from three environments each with three replications, the 30 RILs with the lowest disease index and the 30 RILs with the highest disease index were used to construct susceptible and resistant bulks.

2.2 Pathogen inoculation and resistance phenotyping

The 581 RILs were evaluated for RRS in three independent crop seasons i.e., in 2016 spring and autumn (2016S and 2016A) and in 2017 spring (2017S). The RILs of F11, F12, and F13 generations and parents were cultivated in two-row plots with 20 seeds in each season. One-month to 40-day-old RILs seedlings were inoculated via a previously described artificial method (Zhao et al., 2016; Zhang et al., 2017). Resistance phenotyping of the RILs was performed 25 days after inoculation in the different seasons. Disease symptoms were classified into six disease severity ratings (Figure 1C): (0) = the inoculated leaflets either remained green or were yellow at inoculating sites, but the entire plant was intact and lacked wilt; (1) = the inoculated leaflets had either wilted or fallen off, but the entire plant was intact and lacked wilt; (2) = the main stem/branches of the inoculated leaves had wilt and chlorosis; (3) = the leaves of non-inoculated branches had wilt or were faded green, but the main stem was green; (4) = the entire plant had wilted and died, and all its branches were greenish; and (5) = the entire plant had wilted, dried, and was brownish. The disease index (DI) was calculated using the following formula:

Disease index=05xiyixmaxyi×100%

Where,x i : disease grade value, x max : the highest disease grade value, and y i : the number of diseased plants corresponding to the disease rating.

The average DI was calculated for the three replications in a single environment. Statistical analysis of variance (ANOVA) was performed using the DPS7.5 software (Date Processing System, Science Press, China), Values are expressed as the mean ± standard deviation or standard error as indicated. Differences between groups were evaluated using one-way ANOVA. Statistical significance was set at P<0.05.

2.3 Extreme bulks construction and whole genome resequencing

The average DI for each RIL was calculated based on phenotyping data from the 2016S, 2016A, and 2017S seasons. We selected 30 resistant and 30 susceptible lines to construct the extreme R/S pool. To develop the resistant bulk (R-Bulk) for RRS, we selected 30 RILs with a low mean disease index and pooled the same amount of DNA from each into one. Similarly, DNA samples of 30 RILs with a high mean disease index were pooled to construct the susceptible bulk (S-Bulk) for RRS. The genomic DNA of these two extreme pools and those of the two parents was used to construct DNA sequencing libraries. Paired-end reads (151 bp) of four libraries were generated via the Illumina HiSeq 2500 platform (Illumina, Inc., USA) with a sequencing depth of approximately 30× of the cultivated peanut genome (~2.7 Gb) for each pool and about 40× for parental plants. The raw sequencing data of the four libraries have been deposited in the NCBI Sequence Read Archive (SRA) under the BioProject ID PRJNA851221.

2.4 SNP/InDel genotype detection and annotation

A QTL-seq approach was used to identify the QTLs for RRS ( Figure S1 ) (Takagi et al., 2013). The quality of re-sequenced raw reads from the four libraries was checked. Low-quality reads (those with a proportion of uncalled bases >5%) and adapter sequences were culled. High-quality reads (those with more than 95% nucleotide base calls and high Phred quality scores) were aligned and mapped to the reference genome using the BWA software package (http://bio-bwa.sourceforge.net/) with the default parameters (Li and Durbin, 2009). For further analysis, the genome sequences of allotetraploid progenitors of the cultivated peanut Arachis hypogaea (Shitouqi) were downloaded from the Peanut Genome Resource website (http://peanutgr.fafu.edu.cn/) and used as the reference sequences. Duplicated reads were identified and filtered using Picard (http://broadinstitute.github.io/picard/) after mapping the clean reads to the reference genome. To determine the locations and effects of the SNP/InDel variants, we detected and filtered variants in the four libraries using the Genome Analysis Toolkit (GATK, https://software.broadinstitute.org/gatk/) (Cingolani et al., 2012) and annotated using SnpEff software (V.5.0e; https://pcingola.github.io/SnpEff/) (Reumers et al., 2012).

2.5 Identification of candidate genomic regions

To identify the candidate genomic regions associated with RRS, we further filtered high-quality reads from S-bulk and R-bulk libraries by removing unpaired reads. To equalize the number of reads from each bulk, the filtered reads of the R-bulk were randomly reduced to the same number of the filtered reads of the S-bulk. During the analysis, the SNP sites with genotypes that differed between the two bulks were used to calculate both the sequencing depth of each base in the different bulks and the Euclidean Distance (ED) value of each site. To eliminate the background noise, the original ED value was processed by power. In this study, the fifth power of the original ED was taken as the correlation value to eliminate the background noise. Then the distance method was used to fit the ED value. For every SNP and InDel in each bulk, ED values were calculated with the formula:

ED=(ARbulkASbulk)2+(CRbulkCSbulk)2+(GRbulkGSbulk)2+(TRbulkTSbulk)2

Each A, G, C, and T letter represented the frequency of its corresponding DNA nucleotide in the resistant and susceptible bulks. The higher the ED value, the stronger the association between the variant with the target characteristic.

The SNP index value was calculated as follows:

SNP-index(aa)=MaaMaa+Paa
SNP-index(ab)=MabMab+Pab

ΔSNP-index = SNP-index (aa)- SNP-index (ab)

ΔSNP-index was calculated by subtracting the SNP-index of the R-bulk from the SNP-index of the S-bulk. SNP-index plots were generated using sliding window analysis with a window size of 2 Mb and increments of 50 Kb. The SNPs with SNP-index <0.3 or read depth<10 in both bulks were culled ( Supplementary Figure 1 ). The SNP index of remaining SNPs as calculated from each bulk was physically plotted onto the 20 cultivated peanut chromosomes. ΔSNP index was calculated by subtracting the SNP index of the resistant bulk from the SNP index of the susceptible bulk. Notably, only those SNPs that had homozygous alleles in both bulks were selected for ΔSNP index calculation. Furthermore, SNP positions were considered as the causal SNPs responsible for the trait of interest if they passed the criterion ΔSNP index = -1. ΔSNP index = -1 indicated that the allele called in resistant bulk was the same as that of the resistant parent while an alternate base was called in susceptible bulk ( Supplementary Figure 3 ). This analysis was also used in the InDel correlation analysis ( Supplementary Figure 4 ). The DISTANCE method was used to fit ΔSNP-indexes and ED values, and the regions above the correlation threshold value (add value) were selected as those related to traits.

The candidate genomic regions related to RRS had the following significant ΔSNP/InDel index requirements: ΔSNP/InDel index significantly deviated from the statistical confidence intervals under the null hypothesis of no QTLs at a P < 0.01 level, and SNP/InDel-index significantly deviated from 0.5 in both bulks. Moreover, the ED values for SNP and InDel were remarkably higher than 0.29 and 0.28, respectively. Finally, the two sets of genomic regions identified from the S-bulk and R-bulk assemblies were combined and considered the genomic regions associated with RRS.

2.6 Diagnostic marker development and validation

To validate the identified genomic regions for RRS, SNPs with different alleles in both bulks and near the intersection terminal were identified and a special marker was developed to narrow the candidate region. For the RIL lines under R. solanacearum treatments and with the highest and lowest DI values, we randomly selected 18 of each of these two groups, then extracted DNA from them as well as the parents and the other selected samples. The total volume for the PCR reaction was 20 μl, comprising DNA template: 50 ng, 2×PCR Master Mix: 5 μl, forward primer: 10 μM, and reverse primer: 10 μM. The PCR cycling conditions were as follows: 94°C, 3 min; 30–35 cycles of 94°C, 30 s; 56°C, 30 s; 72°C, 30 s; final extension at 72°C, 10 min. After PCR amplification, the targeted amplicons were identified via 1.2% agarose gel electrophoresis.

3 Results

3.1 Phenotype diversity and construction of extreme RRS bulks

To investigate variation in RRS levels of cultivated peanuts, we utilized the resistant “Yueyou 92” (RP) and susceptible “Xinhuixiaoli” (SP) varieties as parents to create multiple generations of segregating RILs populations ( Figure 1A ). The resistance rate was evaluated based on the severity of R. solanacearum infections in RILs, which was calculated as a disease index (DI). The DI value of Yueyou 92 was significantly lower than that of Xinhuixiaoli in three consecutive crop seasons ( Figure 1A and Supplementary Table 1 ). The RILs population had a wide segregation of phenotype variations that formed two peaks of resistance distributions, displaying the main QTLs for RRS regulation ( Figure 1B and Supplementary Table 1 ). Based on the mean values of the disease index in the three field environments, the 30 RILs with the lowest disease index (10.22–20.00%) and the 30 RILs with the highest index (81.68–92.79%) were selected for construction of the resistant (R-bulk) and susceptible bulks (S-bulk) respectively ( Figure 1D and Supplementary Table 1 ). Furthermore, phenotypic identification of R- and S-bulk resistance in the greenhouse was like that in the field environment ( Supplementary Figure 1 ).

3.2 Genome sequencing and SNP/InDel discovery and evaluation

Whole genome sequencing of the parents and the bulks DNA samples was performed on the Illumina HiSeq platform. A total of 114.67 and 103.10 Gb reads were generated for Yueyou 92 and Xinhuixiaoli, and 108.38 and 96.92 Gb for R-bulk and S-bulk respectively. Approximately 97.69% of the reads correctly mapped to the cultivated peanut cv. Shitouqi reference genome ( Table 1 ). An average coverage depth of 42× and 37× of the reference genome was achieved by Yueyou 92 and Xinhuixiaoli reads respectively, and 38× and 34× depth for the R-bulk and S-bulk, respectively ( Table 1 ). The mapping results showed that the genome was evenly covered, indicating that the sequencing randomness was good ( Supplementary Figure 2 ).

Table 1.

Summary of whole genome re-sequencing of parents and bulk lines for bacterial wilt resistance.

Sample ID Genotype/bulks Total_reads Clean reads Clean_Base Q30(%) GC(%) Average depth(X) Genome coverage ration_1X (%) Genome coverage ration_5X (%) Genome coverage ration_10X (%) Mapped(%) Properly_mapped(%)
RP Resistant parent 467,742,004 382,713,001 114,670,878,822 89.89% 36.08% 42 97.72% 97.01% 96.42% 99.55% 96.59%
SP Susceptible parent 602,985,958 344,100,662 103,101,745,626 90.68% 35.86% 37 97.42% 96.62% 95.77% 99.72% 96.31%
R-bulk Resistant bulk 602,985,958 361,696,407 108,373,962,086 90.94% 35.99% 38 97.83% 97.11% 96.34% 99.74% 96.23%
S-bulk Susceptible bulk 630,443,472 323,474,233 96,921,445,922 91.27% 35.94% 34 97.77% 96.99% 95.98% 99.74% 96.84%

The short reads of parents and the extreme bulks were aligned to the genome sequences of cultivated peanut, cv. Shitouqi, Arachis hypogaea Linn (Peanut Genome Resource: http://peanutgr.fafu.edu.cn/).

SNPs/InDels were detected and extracted by the GATK software package. A total of 585,258 SNPs and 167,249 InDels were detected between two parents and 126,900 SNPs and 46,013 InDels were detected between the extreme pools, respectively. The occurrence of the SNPs was 3.5 times more than that of the InDels ( Supplementary Table 2 ; Supplementary Figure 3 ). After filtering, 381,642 and 98,918 high-quality and homozygous SNP and InDel sites were respectively obtained ( Supplementary Table S3 ). Based on the annotations, 72.7% and 55.4% of the SNPs and InDels, respectively, were in the intergenic region between the extreme pools. Approximately 15% of SNPs and 25% of InDels were upstream and downstream of genes, ~10% of variants in introns, and only ~3% of SNPs and 2.6% of InDels were in the coding region of the two bulks. About 34.6% and 54.7% of the SNPs in the CDS region caused synonymous and nonsynonymous coding variants, respectively. Similarly, Approximately 22.0% of the InDels in the CDS region caused frameshift variants ( Supplementary Tables 2 , 3 ).

3.3 Candidate genomic regions for RRS

Using the genome sequences of Arachis hypogaea (Shitouqi) as reference, the Euclidean distance (ED) and SNP index, including the ΔSNP-index, were calculated for each genome-wide high-quality SNPs, from RP and SP ( Figure 2 ; Supplementary Figure 6 ; Supplementary Figure 8 ). Then, candidate genomic regions for RRS were identified based on ED and ΔSNP-index plots through sliding window analysis of deviations from the threshold value at a 99% confidence level. By using an ED association algorithm, a major peak on Chr12 was identified for RRS, spanning 0–15.19 Mb with an ED > 0.29 (P<0.01) for the SNP. A 6.40 Mb (0.77–7.17 Mb) interval on Chr02 was also identified. By SNP-index and ΔSNP-index, only a genomic interval of 5.83 Mb (4.16–9.99 Mb) on Chr12 deviated from the threshold with the confidence level of P<0.01 ( Figure 2 ; Supplementary Figure 7 ; Supplementary Figure 9 ), indicating the interval on Chr12 as the main region controlling the RRS. Moreover, the ED and InDel-indexes (referring to principles of ΔSNP-index) for each identified genomic InDel were calculated for RP and SP. The regions of similarity were confirmed at intervals of 0-7.0 Mb and 0-15 Mb on Chr02 and Chr12, respectively, for ED mapping and 7.49–9.99 Mb on Chr12 for InDel-index association ( Supplementary Figures 6 - 9 ). Once more, the candidate region on Chr12 was robust with a P<0.01 confidence level for both methods. As SNP-indexes enabled fine mapping, the 7.2 Mb (1.8–9.0 Mb) and 5.83 Mb (4.16–9.99 Mb) intervals on Chr12 were collectively identified as candidate region associated with RRS, at 95% and 99% confidence levels, respectively (Figure 3).

Figure 2.

Figure 2

Euclidean distance (ED) value distribution of SNPs/InDels and SNP/InDel-index of R- and S-bulks and Δ(SNP/InDel-index) plots generated by sliding-window analyses of 20 cultivated peanut chromosomes. (A, B) Euclidean distance (ED) value distribution of SNPs and InDels in 20 chromosomes. The x-axis represents the chromosome name, the colored dots represent ED values, the black lines represent the fitted ED values (with 2Mb windows sliding in 10 kb steps), and the red dotted lines represent associated thresholds. (C, D) SNP/InDel-index of R- and S-bulks and Δ(SNP/InDel-index) plots generated by sliding-window analysis of cultivated peanut chromosomes. The physical positions of chromosomes are displayed on the X-axis and the average SNP/InDel-index in each 2-Mb physical interval with a 10-kb sliding window is displayed on the Y-axis. Two candidate genomic regions (marked in yellow) were defined using the criteria: average SNP/InDel-index > 0.9 in the R-bulks and average P < 0.05. The red, blue, and green lines represent the thresholds at confidence levels of 0.99, 0.95, and 0.90, respectively.

Figure 3.

Figure 3

Genome-wide summary of the putative genomic regions associated with resistance to Ralstonia solanacearum infections. (A) Chromosomes of the cultivated peanut reference genome. (B) The genome-wide density of total genes. (C, D) Plots of SNP-index of R- and S-bulks generated by sliding-window analyses of cultivated peanut chromosomes. (E) ΔSNP-index plot generated by using the Shitouqi assembly as a reference genome. Label definitions from outside to inside: upper probability values at 99% (orange) and 95% (green) confidence levels. ΔSNP-index, lower probability values at 95% (green), and 99% (orange) confidence levels. (F, G) InDel-index of R- and S-bulks plots generated by sliding-window analyses of cultivated peanut chromosomes. (H) ΔInDel-index plot generated by using the Shitouqi assembly as a reference genome. Label definitions from outside to inside: upper probability values at 99% (orange) and 95% (green) confidence levels. ΔSNP-index, lower probability values at 95% (green) and 99% (orange) confidence levels.

3.4 Genetic confirmation of candidate genomic region

To confirm the candidate genomic regions associated with RRS by the QTL-seq approach, we remapped the linkage group (LG) of the existing genetic map to the previously published and newly developed SNP markers. The QTL map had two QTLs located in LG1 (ChrB02) and LG10 in F2, which explained 21% and 12% of phenotype variations, and one QTL with two adjoining peaks in LG1 (ChrB02) in F8 (Zhao et al., 2016). The QTL on ChrB02 was located between SNP markers SNP79 and SNP129 in LG1, for which the LOD value was 3.91 and over 6.22, respectively (Zhao et al., 2016). We remapped the SNP markers to the cultivated peanut reference genome. The SNP79 and SNP129 markers were at 1.2 Mb and 9.2 Mb on Chr12, respectively, corroborating identified candidate genomic region through QTL-seq approach ( Supplementary Figure 10 ). Recently, QTL analyses based on SLAF-seq were conducted to detect the candidate QTL region that confers RRS, and the concomitant genotyping and phenotyping data was used for mapping. This resulted in the identification of a consistent region between the SNP marker loci Marker7969064 and Marker7795914 (unpublished data), which explained 45% of the phenotype variations. Marker7969064 and Marke7795914 were located at 6.2 Mb and 8.7 Mb on Chr12, respectively ( Supplementary Figure 10 ). The candidate genomic region associated with RRS as per QTL mapping corroborated that from the QTL-seq method. These results supported QTL-seq results, which revealed the candidate genomic region is associated with RRS.

3.5 Candidate genes associated with RRS

To narrow down the genomic regions and validate effective SNPs associated with RRS on Chr12, we selected a genomic region spanning 7.2 Mb on Chr12 and with 1807 effective SNPs and 629 InDels. Function annotation analysis of the 1807 SNPs revealed 503 intergenic SNPs; 461 intronic; 357 and 225 that were upstream and downstream of genes, respectively; two, six, and eight in 5’ UTR, 3’ UTR, and splice site regions, respectively; and 67 synonymous and 180 nonsynonymous (two resulted in stop codons) ( Supplementary Table 4 ). Notably, 22 genes with nonsynonymous SNPs were predicted to encode for the NBS-LRR type disease resistance proteins, including AH12G01510, AH12G01540, AH12G01550, AH12G01560, AH12G01570, AH12G01600, AH12G01900, AH12G01920, AH12G01980, AH12G02020, AH12G02090, AH12G02120, AH12G02130, AH12G02310, AH12G02330, AH12G02370, AH12G02390, AH12G02410. AH12G02880, AH12G03230, AH12G03600 and AH12G06320 ( Table 2 ). The AH12G01460 and AH12G06300 encode a receptor-like kinase protein and exocyst subunit Exo70 family protein B2 subunit respectively. AH12G03290 and AH12G05320 both encode Serine/threonine-protein phosphatase 7. The other putative candidate genes encoded various kinds of proteins ( Table 3 ). Notably, eight of 22 candidate NBS-LRR resistant genes were identified with high confidence as important candidate genes with the ΔSNP values above 0.60 ( Figure 4 ). Moreover, among the 629 InDels, 152 and 189 were in the intergenic and intronic regions, respectively, 146 and 114 were upstream and downstream of genes, respectively, five and four in 5’ UTR and 3’ UTR regions, respectively, nine and five resulted in frame shifts and codon changes respectively ( Supplementary Table 5 ). The 180 nonsynonymous SNPs affected 75 putative candidate genes associated with RRS ( Table 2 ), whereas 14 InDels affected 11 genes ( Table 3 ). Among them, six in NBS-LRR genes AH12G01920, AH12G01980, AH12G02090, AH12G02390, AH12G02440, AH12G02600 affected the encoded functions as well as ΔSNP-index results ( Table 3 ). Taken together, these results support the hypothesis that the six NBS-LRR resistance genes might act as the candidate genes related to RRS.

Table 2.

Identification of SNPs in putative candidate genes in the genomic region for resistance to on chromosome 12.

Gene ID Chromosome Physical position (bp) Reference Genome Alternative site Resistant bulk (RB) base Number of reads covering the site (X coverage) in resistant bulk (RB) RB Depths of Ref, Alt SNP-index of RB Susceptible bulk (SB) base Number of reads covering the site (X coverage) in susceptible bulk(SB) SB Depths of Ref, Alt SNP-index of SB Delta SNP-index (RB SNP-index-SB SNP-index) SNP substitution effect Amino acid change U95 (95% confidence interval upper side) L95 (95% confidence interval lower side) U99 (99% confidence interval upper side) L99 (99% confidence interval lower side) Gene function
AH12G01450 Chr12 1817271 A G R 25 21,4 0.84 R 10 1,9 0.10 0.74 NON_SYNONYMOUS_CODING Tct/Cct 0.459825 -0.460953 0.585964 -0.588628 AT-rich interactive domain-containing protein 1
AH12G01450 Chr12 1823428 C T Y 29 25,4 0.86 Y 15 3,12 0.20 0.66 NON_SYNONYMOUS_CODING Gaa/Aaa 0.459812 -0.460941 0.585948 -0.588612 AT-rich interactive domain-containing protein 1
AH12G01460 Chr12 1832855 C T Y 19 15,4 0.79 Y 10 1,9 0.10 0.69 NON_SYNONYMOUS_CODING Gaa/Aaa 0.4598 -0.460929 0.585932 -0.588596 Receptor-like protein B6:U6kinase 4
AH12G01510 Chr12 1864236 C G C 19 19,0 1.00 S 8 6,2 0.75 0.25 NON_SYNONYMOUS_CODING Caa/Gaa 0.459761 -0.460891 0.585885 -0.588548 Putative disease resistance RPP13-like protein 1
AH12G01540 Chr12 1888227 G C G 17 16,1 0.94 S 5 3,2 0.60 0.34 NON_SYNONYMOUS_CODING Gga/Cga 0.459735 -0.460866 0.585852 -0.588516 Putative disease resistance RPP13-like protein 1
AH12G01550 Chr12 1889601 G A G 19 19,0 1.00 R 5 2,3 0.40 0.60 NON_SYNONYMOUS_CODING Gaa/Aaa 0.459735 -0.460866 0.585852 -0.588516 Putative disease resistance RPP13-like protein 1
AH12G01550 Chr12 1889607 A C A 20 20,0 1.00 M 6 2,4 0.33 0.67 NON_SYNONYMOUS_CODING Aat/Cat 0.459735 -0.460866 0.585852 -0.588516 Putative disease resistance RPP13-like protein 1
AH12G01550 Chr12 1889737 T A T 22 22,0 1.00 W 5 3,2 0.60 0.40 NON_SYNONYMOUS_CODING gTt/gAt 0.459735 -0.460866 0.585852 -0.588516 Putative disease resistance RPP13-like protein 1
AH12G01560 Chr12 1889759 T A T 17 17,0 1.00 W 5 4,1 0.80 0.20 NON_SYNONYMOUS_CODING gaT/gaA 0.459735 -0.460866 0.585852 -0.588516 Putative disease resistance RPP13-like protein 1
AH12G01570 Chr12 1896280 A G R 21 19,2 0.90 R 5 2,3 0.40 0.50 NON_SYNONYMOUS_CODING gAt/gGt 0.459722 -0.460854 0.585837 -0.5885 Putative disease resistance RPP13-like protein 1
AH12G01570 Chr12 1896290 G A R 22 20,2 0.91 R 5 2,3 0.40 0.51 NON_SYNONYMOUS_CODING atG/atA 0.459722 -0.460854 0.585837 -0.5885 Putative disease resistance RPP13-like protein 1
AH12G01570 Chr12 1896327 G T G 17 16,1 0.94 K 4 1,3 0.25 0.69 NON_SYNONYMOUS_CODING Ggc/Tgc 0.459722 -0.460854 0.585837 -0.5885 Putative disease resistance RPP13-like protein 1
AH12G01570 Chr12 1896685 G A G 14 13,1 0.93 R 5 3,2 0.60 0.33 NON_SYNONYMOUS_CODING cGa/cAa 0.459722 -0.460854 0.585837 -0.5885 Putative disease resistance RPP13-like protein 1
AH12G01570 Chr12 1896707 C A C 16 15,1 0.94 M 5 3,2 0.60 0.34 NON_SYNONYMOUS_CODING ttC/ttA 0.459722 -0.460854 0.585837 -0.5885 Putative disease resistance RPP13-like protein 1
AH12G01600 Chr12 1929770 C G C 23 23,0 1.00 S 11 3,8 0.27 0.73 NON_SYNONYMOUS_CODING Ctt/Gtt 0.459683 -0.460815 0.585788 -0.588452 Putative disease resistance RPP13-like protein 1
AH12G01600 Chr12 1929827 T A T 22 22,0 1.00 W 6 2,4 0.33 0.67 NON_SYNONYMOUS_CODING Tgt/Agt 0.459683 -0.460815 0.585788 -0.588452 Putative disease resistance RPP13-like protein 1
AH12G01600 Chr12 1929839 T G T 20 20,0 1.00 K 6 2,4 0.33 0.67 NON_SYNONYMOUS_CODING Tct/Gct 0.459683 -0.460815 0.585788 -0.588452 Putative disease resistance RPP13-like protein 1
AH12G01600 Chr12 1931628 A T A 15 15,0 1.00 W 5 2,3 0.40 0.60 NON_SYNONYMOUS_CODING aAg/aTg 0.45967 -0.460802 0.585771 -0.588435 Putative disease resistance RPP13-like protein 1
AH12G01600 Chr12 1931686 A C A 12 12,0 1.00 M 11 3,8 0.27 0.73 NON_SYNONYMOUS_CODING ttA/ttC 0.45967 -0.460802 0.585771 -0.588435 Putative disease resistance RPP13-like protein 1
AH12G01600 Chr12 1931802 C T C 13 13,0 1.00 Y 9 3,6 0.33 0.67 NON_SYNONYMOUS_CODING tCg/tTg 0.45967 -0.460802 0.585771 -0.588435 Putative disease resistance RPP13-like protein 1
AH12G01630 Chr12 1962973 T C Y 19 14,5 0.74 Y 14 4,10 0.29 0.45 NON_SYNONYMOUS_CODING aAa/aGa 0.45963 -0.460764 0.585722 -0.588387 Pentatricopeptide repeat-containing protein
AH12G01670 Chr12 2019013 A C A 24 23,1 0.96 M 21 14,7 0.67 0.29 NON_SYNONYMOUS_CODING aaA/aaC 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2019053 A C A 25 24,1 0.96 M 19 13,6 0.68 0.28 NON_SYNONYMOUS_CODING Aca/Cca 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2019086 T C Y 22 20,2 0.91 Y 23 16,7 0.70 0.21 NON_SYNONYMOUS_CODING Ttt/Ctt 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2019242 A G A 16 15,1 0.94 R 20 18,2 0.90 0.04 NON_SYNONYMOUS_CODING Aat/Gat 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2019615 A G A 21 21,0 1.00 R 14 13,1 0.93 0.07 NON_SYNONYMOUS_CODING aAg/aGg 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2019677 A G R 27 25,2 0.93 R 16 11,5 0.69 0.24 NON_SYNONYMOUS_CODING Aat/Gat 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2019736 C G S 24 22,2 0.92 S 20 13,7 0.65 0.27 NON_SYNONYMOUS_CODING ttC/ttG 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2019773 G A G 25 24,1 0.96 R 20 14,6 0.70 0.26 NON_SYNONYMOUS_CODING Gtt/Att 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2019997 T G T 21 21,0 1.00 K 11 6,5 0.55 0.45 NON_SYNONYMOUS_CODING atT/atG 0.459384 -0.460528 0.58544 -0.588095 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020027 G T G 21 21,0 1.00 K 11 9,2 0.82 0.18 NON_SYNONYMOUS_CODING agG/agT 0.459292 -0.46044 0.585336 -0.587987 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020059 G T G 21 21,0 1.00 K 9 7,2 0.78 0.22 NON_SYNONYMOUS_CODING aGa/aTa 0.459292 -0.46044 0.585336 -0.587987 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020110 T C T 22 21,1 0.95 Y 22 15,7 0.68 0.27 NON_SYNONYMOUS_CODING gTa/gCa 0.459292 -0.46044 0.585336 -0.587987 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020205 G A R 27 24,3 0.89 R 31 17,14 0.55 0.34 NON_SYNONYMOUS_CODING Gta/Ata 0.459292 -0.46044 0.585336 -0.587987 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020297 G C S 30 27,3 0.90 S 28 15,13 0.54 0.36 NON_SYNONYMOUS_CODING gaG/gaC 0.459292 -0.46044 0.585336 -0.587987 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020334 A G A 33 30,3 0.91 R 30 19,11 0.63 0.28 NON_SYNONYMOUS_CODING Act/Gct 0.459292 -0.46044 0.585336 -0.587987 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020367 A G A 31 30,1 0.97 R 26 20,6 0.77 0.20 NON_SYNONYMOUS_CODING Atg/Gtg 0.459292 -0.46044 0.585336 -0.587987 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020380 G A G 26 25,1 0.96 R 26 20,6 0.77 0.19 NON_SYNONYMOUS_CODING aGg/aAg 0.459292 -0.46044 0.585336 -0.587987 HXXXD-type acyl-transferase family protein
AH12G01690 Chr12 2054547 T C T 25 24,1 0.96 Y 20 17,3 0.85 0.11 NON_SYNONYMOUS_CODING Ttt/Ctt 0.459047 -0.460203 0.585059 -0.587699 HXXXD-type acyl-transferase family protein
AH12G01720 Chr12 2106320 T C Y 17 13,4 0.76 Y 13 2,11 0.15 0.61 NON_SYNONYMOUS_CODING Agt/Ggt 0.458788 -0.459954 0.584757 -0.58739 Subtilase family protein
AH12G01780 Chr12 2249782 C T C 18 16,2 0.89 Y 17 3,14 0.18 0.71 NON_SYNONYMOUS_CODING aCa/aTa 0.458144 -0.459339 0.584017 -0.586617 Glycerol-3-phosphate 2-O-acyltransferase 6
AH12G01880 Chr12 2427316 C T Y 26 23,3 0.88 Y 13 3,10 0.23 0.65 NON_SYNONYMOUS_CODING tCc/tTc 0.457359 -0.45859 0.583129 -0.585683 UDP-glycosyltransferase 91A1
AH12G01900 Chr12 2432994 A G R 23 20,3 0.87 R 15 2,13 0.13 0.74 NON_SYNONYMOUS_CODING cAc/cGc 0.457315 -0.458548 0.58308 -0.585627 Putative disease resistance RPP13-like protein 1
AH12G01910 Chr12 2448354 A G R 25 22,3 0.88 R 14 1,13 0.07 0.81 NON_SYNONYMOUS_CODING Aga/Gga 0.457272 -0.458507 0.58303 -0.585572 UDP-glycosyltransferase 91A1
AH12G01920 Chr12 2473114 G A R 26 23,3 0.88 R 15 2,13 0.13 0.75 NON_SYNONYMOUS_CODING gGa/gAa 0.457162 -0.458401 0.582905 -0.585432 Putative disease resistance protein At3g14460
AH12G01920 Chr12 2473124 G C S 24 21,3 0.88 S 19 3,16 0.16 0.72 NON_SYNONYMOUS_CODING tgG/tgC 0.457162 -0.458401 0.582905 -0.585432 Putative disease resistance protein At3g14460
AH12G01980 Chr12 2534393 C T Y 19 17,2 0.89 Y 19 17,2 0.89 0.00 NON_SYNONYMOUS_CODING cCa/cTa 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2534405 C T Y 22 20,2 0.91 Y 18 16,2 0.89 0.02 NON_SYNONYMOUS_CODING cCt/cTt 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2534443 A G R 16 15,1 0.94 R 17 15,2 0.88 0.06 NON_SYNONYMOUS_CODING Aga/Gga 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2534503 C T Y 18 16,2 0.89 Y 14 10,4 0.71 0.17 NON_SYNONYMOUS_CODING Ccc/Tcc 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2534516 C T Y 19 16,3 0.84 Y 13 8,5 0.62 0.23 NON_SYNONYMOUS_CODING tCg/tTg 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2534533 C T Y 22 18,4 0.82 Y 14 9,5 0.64 0.18 NON_SYNONYMOUS_CODING Cca/Tca 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2534560 G A R 22 18,4 0.82 R 15 10,5 0.67 0.15 NON_SYNONYMOUS_CODING Gta/Ata 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2539578 T A T 24 24,0 1.00 W 23 20,3 0.87 0.13 NON_SYNONYMOUS_CODING Aca/Tca 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2539652 G C G 20 20,0 1.00 S 20 15,5 0.75 0.25 NON_SYNONYMOUS_CODING Gtc/Ctc 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2539689 C A C 26 26,0 1.00 M 24 15,9 0.63 0.38 NON_SYNONYMOUS_CODING Cca/Aca 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2539742 G C G 27 27,0 1.00 S 29 20,9 0.69 0.31 NON_SYNONYMOUS_CODING tCg/tGg 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2539781 T A T 24 24,0 1.00 W 33 22,11 0.67 0.33 NON_SYNONYMOUS_CODING aAc/aTc 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2539858 A T A 21 20,1 0.95 W 27 18,9 0.67 0.29 NON_SYNONYMOUS_CODING gaT/gaA 0.456951 -0.458197 0.582663 -0.585158 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2540304 C G C 31 31,0 1.00 S 16 12,4 0.75 0.25 NON_SYNONYMOUS_CODING Gat/Cat 0.45693 -0.458177 0.582639 -0.58513 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2540329 G C G 29 29,0 1.00 S 15 11,4 0.73 0.27 NON_SYNONYMOUS_CODING aaC/aaG 0.45693 -0.458177 0.582639 -0.58513 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2540382 T G T 25 25,0 1.00 K 14 11,3 0.79 0.21 NON_SYNONYMOUS_CODING Aac/Cac 0.45693 -0.458177 0.582639 -0.58513 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2545381 A C A 23 22,1 0.96 M 17 14,3 0.82 0.13 NON_SYNONYMOUS_CODING Tcc/Gcc 0.45693 -0.458177 0.582639 -0.58513 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2545481 A G R 23 20,3 0.87 R 18 12,6 0.67 0.20 NON_SYNONYMOUS_CODING gAc/gGc 0.45693 -0.458177 0.582639 -0.58513 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2545502 C G S 26 23,3 0.88 S 15 12,3 0.80 0.08 NON_SYNONYMOUS_CODING aCt/aGt 0.45693 -0.458177 0.582639 -0.58513 Putative disease resistance RPP13-like protein 1
AH12G02020 Chr12 2547669 C T C 13 13,0 1.00 Y 19 15,4 0.79 0.21 NON_SYNONYMOUS_CODING gGa/gAa 0.45693 -0.458177 0.582639 -0.58513 Putative disease resistance RPP13-like protein 1
AH12G02090 Chr12 2620498 C T C 25 25,0 1.00 Y 9 7,2 0.78 0.22 NON_SYNONYMOUS_CODING Gac/Aac 0.456824 -0.458079 0.582535 -0.584984 Putative disease resistance RPP13-like protein 1
AH12G02090 Chr12 2620504 A C A 25 25,0 1.00 M 9 7,2 0.78 0.22 NON_SYNONYMOUS_CODING Tac/Gac 0.456824 -0.458079 0.582535 -0.584984 Putative disease resistance RPP13-like protein 1
AH12G02090 Chr12 2621513 C A M 22 19,3 0.86 M 13 8,5 0.62 0.25 NON_SYNONYMOUS_CODING aGg/aTg 0.456824 -0.458079 0.582535 -0.584984 Putative disease resistance RPP13-like protein 1
AH12G02120 Chr12 2641657 G C S 13 12,1 0.92 S 19 3,16 0.16 0.77 NON_SYNONYMOUS_CODING gCc/gGc 0.456806 -0.458062 0.582519 -0.584957 Putative disease resistance RPP13-like protein 1
AH12G02130 Chr12 2651310 C T Y 13 6,7 0.54 Y 11 8,3 0.27 0.27 NON_SYNONYMOUS_CODING gGt/gAt 0.456798 -0.458054 0.582513 -0.584944 Putative disease resistance RPP13-like protein 1
AH12G02130 Chr12 2651350 A C M 7 4,3 0.43 M 9 7,2 0.22 0.21 NON_SYNONYMOUS_CODING Ttg/Gtg 0.456798 -0.458054 0.582513 -0.584944 Putative disease resistance RPP13-like protein 1
AH12G02130 Chr12 2651430 T A W 9 4,5 0.56 T 10 9,1 0.10 0.46 NON_SYNONYMOUS_CODING aAt/aTt 0.456798 -0.458054 0.582513 -0.584944 Putative disease resistance RPP13-like protein 1
AH12G02310 Chr12 2777261 G T K 11 9,2 0.82 T 14 0,14 0.00 0.82 NON_SYNONYMOUS_CODING agG/agT 0.456652 -0.457914 0.582398 -0.584766 Putative disease resistance RPP13-like protein 1
AH12G02310 Chr12 2816492 T G K 17 13,4 0.76 K 15 2,13 0.13 0.63 STOP_LOST tAa/tCa 0.456653 -0.457913 0.582412 -0.582412 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2820701 G A G 23 23,0 1.00 R 12 11,1 0.92 0.08 NON_SYNONYMOUS_CODING aGg/aAg 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2820718 A C A 24 24,0 1.00 M 13 11,2 0.85 0.15 NON_SYNONYMOUS_CODING Atc/Ctc 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2820776 A G A 28 28,0 1.00 R 15 12,3 0.80 0.20 NON_SYNONYMOUS_CODING gAa/gGa 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2820802 A C A 27 27,0 1.00 M 16 12,4 0.75 0.25 NON_SYNONYMOUS_CODING Att/Ctt 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2820833 G C G 28 28,0 1.00 S 15 11,4 0.73 0.27 NON_SYNONYMOUS_CODING gGt/gCt 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2820846 T A T 26 26,0 1.00 W 14 11,3 0.79 0.21 NON_SYNONYMOUS_CODING agT/agA 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2820944 G A G 22 22,0 1.00 R 11 5,6 0.45 0.55 NON_SYNONYMOUS_CODING cGg/cAg 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2822450 A C M 23 20,3 0.87 M 23 4,19 0.17 0.70 NON_SYNONYMOUS_CODING gAt/gCt 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02330 Chr12 2822465 A G R 21 18,3 0.86 R 22 5,17 0.23 0.63 NON_SYNONYMOUS_CODING cAt/cGt 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02370 Chr12 2823195 T C T 19 19,0 1.00 Y 6 2,4 0.33 0.67 NON_SYNONYMOUS_CODING tAt/tGt 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02370 Chr12 2823222 G A G 20 20,0 1.00 R 7 2,5 0.29 0.71 NON_SYNONYMOUS_CODING Gca/Cca 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02370 Chr12 2823262 G C G 26 26,0 1.00 S 5 1,4 0.20 0.80 NON_SYNONYMOUS_CODING Gaa/Caa 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02370 Chr12 2823268 C A C 24 24,0 1.00 M 6 1,5 0.17 0.83 NON_SYNONYMOUS_CODING Ctg/Atg 0.456665 -0.457925 0.582427 -0.584779 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2845356 C A M 19 14,5 0.74 M 19 4,15 0.21 0.53 NON_SYNONYMOUS_CODING Ctt/Att 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2845498 G A R 27 25,2 0.93 G 25 23,2 0.92 0.01 NON_SYNONYMOUS_CODING cGc/cAc 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2845513 A G R 26 24,2 0.92 A 25 24,1 0.96 -0.04 NON_SYNONYMOUS_CODING aAg/aGg 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2845530 T C Y 27 25,2 0.93 T 25 24,1 0.96 -0.03 NON_SYNONYMOUS_CODING Tat/Cat 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2846684 G T G 22 22,0 1.00 K 18 10,8 0.56 0.44 NON_SYNONYMOUS_CODING agG/agT 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2846808 A G A 17 17,0 1.00 R 25 13,12 0.52 0.48 NON_SYNONYMOUS_CODING Aga/Gga 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2846850 T A T 15 15,0 1.00 W 26 15,11 0.58 0.42 NON_SYNONYMOUS_CODING Tcc/Acc 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2846856 C G C 16 16,0 1.00 S 25 14,11 0.56 0.44 NON_SYNONYMOUS_CODING Caa/Gaa 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2846949 A G A 11 11,0 1.00 R 15 12,3 0.80 0.20 NON_SYNONYMOUS_CODING Aaa/Gaa 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2847652 G T G 15 14,1 0.93 K 6 2,4 0.33 0.60 NON_SYNONYMOUS_CODING cGc/cTc 0.456684 -0.457942 0.582449 -0.5848 Putative disease resistance RPP13-like protein 1
AH12G02410 Chr12 2866827 A G A 21 21,0 1.00 R 4 1,3 0.25 0.75 NON_SYNONYMOUS_CODING Aag/Gag 0.456704 -0.457961 0.582471 -0.584825 Putative disease resistance RPP13-like protein 1
AH12G02410 Chr12 2867664 G C G 18 17,1 0.94 C 19 1,18 0.05 0.89 NON_SYNONYMOUS_CODING Gac/Cac 0.456704 -0.457961 0.582471 -0.584825 Putative disease resistance RPP13-like protein 1
AH12G02410 Chr12 2868121 C G S 25 21,4 0.84 S 17 2,15 0.12 0.72 NON_SYNONYMOUS_CODING cCc/cGc 0.456704 -0.457961 0.582471 -0.584825 Putative disease resistance RPP13-like protein 1
AH12G02410 Chr12 2868129 C G S 27 22,5 0.81 S 17 3,14 0.18 0.64 NON_SYNONYMOUS_CODING Caa/Gaa 0.456704 -0.457961 0.582471 -0.584825 Putative disease resistance RPP13-like protein 1
AH12G02520 Chr12 2952570 C T Y 24 21,3 0.88 Y 18 3,15 0.17 0.71 NON_SYNONYMOUS_CODING Gga/Aga 0.456781 -0.458031 0.582557 -0.584916 1-aminocyclopropane-1-carboxylate synthase-like protein 1
AH12G02650 Chr12 3067519 T C Y 26 21,5 0.81 Y 12 2,10 0.17 0.64 NON_SYNONYMOUS_CODING tTg/tCg 0.456889 -0.458138 0.582693 -0.585057 Reticulon-like protein B1
AH12G02880 Chr12 3276550 G C G 16 15,1 0.94 S 21 3,18 0.14 0.79 NON_SYNONYMOUS_CODING tgG/tgC 0.457055 -0.458315 0.582914 -0.58527 Putative disease resistance RPP13-like protein 1
AH12G02960 Chr12 3347238 C A C 17 17,0 1.00 M 7 4,3 0.57 0.43 NON_SYNONYMOUS_CODING Cgt/Agt 0.457096 -0.458361 0.582977 -0.585315 Transmembrane receptors 3BATP binding
AH12G02960 Chr12 3347384 T A T 27 25,2 0.93 W 8 4,4 0.50 0.43 NON_SYNONYMOUS_CODING ttT/ttA 0.457096 -0.458361 0.582977 -0.585315 Transmembrane receptors 3BATP binding
AH12G02960 Chr12 3348195 C G C 5 5,0 1.00 S 10 1,9 0.10 0.90 NON_SYNONYMOUS_CODING Cat/Gat 0.457096 -0.458361 0.582977 -0.585315 Transmembrane receptors 3BATP binding
AH12G03000 Chr12 3392506 C G C 24 24,0 1.00 S 9 2,7 0.22 0.78 NON_SYNONYMOUS_CODING Ctt/Gtt 0.457119 -0.458386 0.583012 -0.585331 Protein of unknown function (DUF594)
AH12G03000 Chr12 3392515 C A C 22 21,1 0.95 M 9 2,7 0.22 0.73 NON_SYNONYMOUS_CODING Ctg/Atg 0.457119 -0.458386 0.583012 -0.585331 Protein of unknown function (DUF595)
AH12G03230 Chr12 3693638 C G C 13 13,0 1 S 11 1,10 0.09 0.91 NON_SYNONYMOUS_CODING aCt/aGt 0.457106 -0.4584 0.583117 -0.585359 putative disease resistance RPP13-like protein 1
AH12G03240 Chr12 3715337 G C G 13 13,0 1.00 S 22 4,18 0.18 0.82 NON_SYNONYMOUS_CODING Gat/Cat 0.457108 -0.458403 0.583131 -0.585372 BAG family molecular chaperone regulator 6
AH12G03240 Chr12 3715406 T C T 17 17,0 1.00 Y 15 4,11 0.27 0.73 NON_SYNONYMOUS_CODING Tgt/Cgt 0.457108 -0.458403 0.583131 -0.585372 BAG family molecular chaperone regulator 6
AH12G03240 Chr12 3715462 T G T 18 18,0 1.00 K 5 1,4 0.20 0.80 NON_SYNONYMOUS_CODING atT/atG 0.457108 -0.458403 0.583131 -0.585372 BAG family molecular chaperone regulator 6
AH12G03290 Chr12 3745691 G A R 21 18,3 0.86 R 13 2,11 0.15 0.70 NON_SYNONYMOUS_CODING cGt/cAt 0.457108 -0.458406 0.583152 -0.585391 Serine/threonine-protein phosphatase 7
AH12G03300 Chr12 3748516 C T Y 18 14,4 0.78 Y 20 4,16 0.20 0.58 NON_SYNONYMOUS_CODING cGa/cAa 0.457108 -0.458406 0.583152 -0.585391 Aminotransferase-like 2C plant mobile domain family protein
AH12G03500 Chr12 3998818 G A G 20 20,0 1.00 R 14 5,9 0.36 0.64 NON_SYNONYMOUS_CODING Ggt/Agt 0.456817 -0.45814 0.582958 -0.585158 MuDR family transposase
AH12G03500 Chr12 3999460 G T K 25 22,3 0.88 K 17 4,13 0.24 0.64 NON_SYNONYMOUS_CODING aGg/aTg 0.456817 -0.45814 0.582958 -0.585158 MuDR family transposase
AH12G03500 Chr12 3999687 A G R 22 20,2 0.91 G 17 0,17 0.00 0.91 NON_SYNONYMOUS_CODING Aac/Gac 0.46 -0.46 0.58 -0.59 MuDR family transposase
AH12G03560 Chr12 4096307 A T A 15 15,0 1.00 T 5 0,5 0.00 1.00 NON_SYNONYMOUS_CODING gTg/gAg 0.46 -0.46 0.58 -0.59 UDP-glycosyltransferase 72B1
AH12G03600 Chr12 4142557 T G K 17 15,2 0.88 K 7 1,6 0.14 0.74 NON_SYNONYMOUS_CODING Tct/Gct 0.46 -0.46 0.58 -0.59 Disease resistance protein TAO1
AH12G03600 Chr12 4142566 G A R 17 15,2 0.88 A 5 0,5 0.00 0.88 NON_SYNONYMOUS_CODING Gtt/Att 0.46 -0.46 0.58 -0.59 Disease resistance protein TAO1
AH12G03600 Chr12 4142572 G A R 17 15,2 0.88 A 5 0,5 0.00 0.88 NON_SYNONYMOUS_CODING Ggt/Agt 0.46 -0.46 0.58 -0.59 Disease resistance protein TAO1
AH12G03900 Chr12 4633134 C T Y 19 17,2 0.89 Y 15 2,13 0.13 0.76 NON_SYNONYMOUS_CODING Gcg/Acg 0.46 -0.46 0.58 -0.58 Cytochrome b561 and DOMON domain-containing protein
AH12G03980 Chr12 4691788 C T Y 20 16,4 0.8 Y 17 4,13 0.24 0.56 STOP_GAINED Caa/Taa 0.456446 -0.457759 0.582353 -0.585012 homolog of histone chaperone HIRA
AH12G03980 Chr12 4696605 G A G 25 25,0 1.00 R 12 2,10 0.17 0.83 NON_SYNONYMOUS_CODING Gtt/Att 0.456446 -0.457759 0.582353 -0.585012 homolog of histone chaperone HIRA
AH12G04010 Chr12 4718691 G T K 21 16,5 0.76 T 16 1,15 0.06 0.70 NON_SYNONYMOUS_CODING Ctg/Atg 0.456475 -0.457785 0.582373 -0.585056 Eukaryotic aspartyl protease family protein
AH12G04170 Chr12 5007281 T A T 23 23,0 1.00 W 22 19,3 0.86 0.14 NON_SYNONYMOUS_CODING cAc/cTc 0.457503 -0.45874 0.58321 -0.586473 Endosomal targeting BRO1-like domain-containing protein
AH12G04170 Chr12 5007411 A C A 26 26,0 1.00 M 22 17,5 0.77 0.23 NON_SYNONYMOUS_CODING Tca/Gca 0.457503 -0.45874 0.58321 -0.586473 Endosomal targeting BRO1-like domain-containing protein
AH12G04170 Chr12 5007427 G C G 27 27,0 1.00 S 22 17,5 0.77 0.23 NON_SYNONYMOUS_CODING ttC/ttG 0.457503 -0.45874 0.58321 -0.586473 Endosomal targeting BRO1-like domain-containing protein
AH12G04170 Chr12 5007448 C G C 24 24,0 1.00 S 18 15,3 0.83 0.17 NON_SYNONYMOUS_CODING tgG/tgC 0.457503 -0.45874 0.58321 -0.586473 Endosomal targeting BRO1-like domain-containing protein
AH12G04170 Chr12 5007454 C G C 27 27,0 1.00 S 17 14,3 0.82 0.18 NON_SYNONYMOUS_CODING ttG/ttC 0.457503 -0.45874 0.58321 -0.586473 Endosomal targeting BRO1-like domain-containing protein
AH12G04330 Chr12 5187080 C T C 20 18,2 0.90 Y 10 3,7 0.30 0.60 NON_SYNONYMOUS_CODING Gag/Aag 0.458456 -0.459622 0.584098 -0.587787 P-loop containing nucleoside triphosphate hydrolases superfamily protein
AH12G04490 Chr12 5526242 C T Y 25 19,6 0.76 Y 14 4,10 0.29 0.47 NON_SYNONYMOUS_CODING gGa/gAa 0.460031 -0.461049 0.585491 -0.5901 Uncharacterized protein
AH12G04580 Chr12 5765500 G T G 18 17,1 0.94 K 6 1,5 0.17 0.78 NON_SYNONYMOUS_CODING aaC/aaA 0.460793 -0.461707 0.58614 -0.591388 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
AH12G04670 Chr12 5864398 G T K 21 17,4 0.81 K 14 3,11 0.21 0.60 NON_SYNONYMOUS_CODING Ggt/Tgt 0.46102 -0.461893 0.586301 -0.591789 Uncharacterized protein
AH12G04700 Chr12 5911414 G A G 18 17,1 0.94 R 13 1,12 0.08 0.87 NON_SYNONYMOUS_CODING Gtg/Atg 0.461224 -0.462076 0.586503 -0.592101 Uncharacterized protein
AH12G04740 Chr12 6018424 T C Y 24 17,7 0.71 Y 16 5,11 0.31 0.40 NON_SYNONYMOUS_CODING Tcc/Ccc 0.461787 -0.462593 0.587129 -0.59291 3-ketoacyl-CoA synthase 1
AH12G04980 Chr12 6321518 C T Y 22 17,5 0.77 Y 14 3,11 0.21 0.56 NON_SYNONYMOUS_CODING cCc/cTc 0.462862 -0.46355 0.588336 -0.594617 Uncharacterized protein
AH12G05040 Chr12 6391830 A G R 19 15,4 0.79 R 18 3,15 0.17 0.62 NON_SYNONYMOUS_CODING cAg/cGg 0.463056 -0.463716 0.588597 -0.594957 Pyruvate dehydrogenase E1 component subunit alpha-3/2C chloroplastic
AH12G05080 Chr12 6517918 T C T 12 12,0 1.00 Y 9 8,1 0.89 0.11 NON_SYNONYMOUS_CODING Ttc/Ctc 0.463369 -0.463988 0.589041 -0.595523 Probably inactive leucine-rich repeat receptor-like protein kinase
AH12G05080 Chr12 6517937 A T A 14 14,0 1.00 W 12 10,2 0.83 0.17 NON_SYNONYMOUS_CODING gAc/gTc 0.463369 -0.463988 0.589041 -0.595523 Probably inactive leucine-rich repeat receptor-like protein kinase
AH12G05080 Chr12 6517943 C A C 15 15,0 1.00 M 12 10,2 0.83 0.17 NON_SYNONYMOUS_CODING tCt/tAt 0.463369 -0.463988 0.589041 -0.595523 Probably inactive leucine-rich repeat receptor-like protein kinase
AH12G05080 Chr12 6518088 T A T 18 18,0 1.00 W 7 5,2 0.71 0.29 NON_SYNONYMOUS_CODING ttT/ttA 0.463369 -0.463988 0.589041 -0.595523 Probably inactive leucine-rich repeat receptor-like protein kinase
AH12G05100 Chr12 6594841 G A R 17 13,4 0.76 R 21 3,18 0.14 0.62 NON_SYNONYMOUS_CODING gCg/gTg 0.463457 -0.464051 0.589192 -0.595747 Probably inactive leucine-rich repeat receptor-like protein kinase
AH12G05120 Chr12 6605230 G A R 22 17,5 0.77 A 13 0,13 0.00 0.77 NON_SYNONYMOUS_CODING aCa/aTa 0.463458 -0.46405 0.589199 -0.595763 Flavone 3’-O-methyltransferase 1
AH12G05120 Chr12 6606476 T A T 20 20,0 1.00 W 13 10,3 0.77 0.23 NON_SYNONYMOUS_CODING Atc/Ttc 0.463458 -0.46405 0.589199 -0.595763 Flavone 3’-O-methyltransferase 1
AH12G05120 Chr12 6607843 G C G 25 23,2 0.92 S 14 10,4 0.71 0.21 NON_SYNONYMOUS_CODING aCt/aGt 0.463458 -0.46405 0.589199 -0.595763 Flavone 3’-O-methyltransferase 1
AH12G05140 Chr12 6655924 G A R 15 13,2 0.87 R 10 3,7 0.30 0.57 NON_SYNONYMOUS_CODING gCt/gTt 0.463453 -0.464034 0.58922 -0.595823 Flavone 3’-O-methyltransferase 1
AH12G05250 Chr12 6843052 T G K 14 13,1 0.93 G 9 0,9 0.00 0.93 NON_SYNONYMOUS_CODING Tcc/Gcc 0.463323 -0.463869 0.589187 -0.59586 B3 domain-containing mRNAion factor NGA1
AH12G05320 Chr12 6989102 A G R 10 9,1 0.90 R 12 2,10 0.17 0.73 NON_SYNONYMOUS_CODING Tcc/Ccc 0.462905 -0.463448 0.588882 -0.5955 Serine/threonine-protein phosphatase 7
AH12G05420 Chr12 7082034 T C T 16 16,0 1.00 Y 15 1,14 0.07 0.93 NON_SYNONYMOUS_CODING Aca/Gca 0.462547 -0.463075 0.588567 -0.595158 Probable inactive purple acid phosphatase 29
AH12G05820 Chr12 7671331 C G C 23 22,1 0.96 S 7 1,6 0.14 0.81 NON_SYNONYMOUS_CODING caC/caG 0.460651 -0.461098 0.586887 -0.593277 FRIGIDA-like protein 3
AH12G05970 Chr12 7992939 G A R 12 11,1 0.92 R 15 2,13 0.13 0.78 NON_SYNONYMOUS_CODING Cgc/Tgc 0.459751 -0.460171 0.585875 -0.592182 Aminotransferase-like 2C plant mobile domain family protein
AH12G06150 Chr12 8202579 C T T 21 0,21 1.00 Y 17 13,4 0.24 0.76 NON_SYNONYMOUS_CODING Gaa/Aaa 0.459288 -0.459699 0.585408 -0.591564 AT-rich interactive domain-containing protein 4
AH12G06180 Chr12 8256014 C A C 21 20,1 0.95 M 21 3,18 0.14 0.81 NON_SYNONYMOUS_CODING Cat/Aat 0.45923 -0.45964 0.585372 -0.591479 RING/U-box superfamily protein
AH12G06180 Chr12 8260084 G A G 22 22,0 1.00 R 9 6,3 0.67 0.33 NON_SYNONYMOUS_CODING aGg/aAg 0.459218 -0.459627 0.585364 -0.591462 RING/U-box superfamily protein
AH12G06180 Chr12 8260159 T C T 16 16,0 1.00 Y 14 4,10 0.29 0.71 NON_SYNONYMOUS_CODING tTt/tCt 0.459218 -0.459627 0.585364 -0.591462 RING/U-box superfamily protein
AH12G06180 Chr12 8260203 G A G 18 18,0 1.00 R 24 15,9 0.63 0.38 NON_SYNONYMOUS_CODING Gtt/Att 0.459218 -0.459627 0.585364 -0.591462 RING/U-box superfamily protein
AH12G06180 Chr12 8271833 A G A 20 19,1 0.95 R 18 6,12 0.33 0.62 NON_SYNONYMOUS_CODING tAt/tGt 0.459205 -0.459615 0.585355 -0.591445 RING/U-box superfamily protein
AH12G06180 Chr12 8271850 G C G 22 21,1 0.95 S 18 6,12 0.33 0.62 NON_SYNONYMOUS_CODING Gca/Cca 0.459205 -0.459615 0.585355 -0.591445 RING/U-box superfamily protein
AH12G06210 Chr12 8303749 A G A 26 26,0 1.00 R 6 5,1 0.83 0.17 NON_SYNONYMOUS_CODING Aca/Gca 0.459187 -0.459596 0.585344 -0.591416 RING/U-box superfamily protein
AH12G06210 Chr12 8303776 A G A 23 23,0 1.00 R 6 3,3 0.50 0.50 NON_SYNONYMOUS_CODING Aaa/Gaa 0.459187 -0.459596 0.585344 -0.591416 RING/U-box superfamily protein
AH12G06250 Chr12 8416831 T G T 16 16,0 1.00 K 6 1,5 0.17 0.83 NON_SYNONYMOUS_CODING Tgt/Ggt 0.459105 -0.459511 0.585247 -0.591281 RING/U-box superfamily protein
AH12G06300 Chr12 8578649 C T Y 16 13,3 0.81 Y 16 3,13 0.19 0.63 NON_SYNONYMOUS_CODING gCt/gTt 0.458995 -0.459395 0.585101 -0.591125 Exocyst subunit exo70 family protein B2
AH12G06300 Chr12 8579347 C T C 12 12,0 1.00 Y 18 3,15 0.17 0.83 NON_SYNONYMOUS_CODING Cgg/Tgg 0.458995 -0.459395 0.585101 -0.591125 Exocyst subunit exo70 family protein B2
AH12G06320 Chr12 8636540 G T G 18 18,0 1.00 T 9 0,9 0.00 1.00 NON_SYNONYMOUS_CODING aaC/aaA 0.458954 -0.459351 0.585052 -0.591055 Putative disease resistance RPP13-like protein 1
AH12G06320 Chr12 8636563 C A C 18 18,0 1.00 A 8 0,8 0.00 1.00 NON_SYNONYMOUS_CODING Gat/Tat 0.458954 -0.459351 0.585052 -0.591055 Putative disease resistance RPP13-like protein 1
AH12G06320 Chr12 8636575 G A G 13 13,0 1.00 A 7 0,7 0.00 1.00 NON_SYNONYMOUS_CODING Cac/Tac 0.458954 -0.459351 0.585052 -0.591055 Putative disease resistance RPP13-like protein 1
AH12G06430 Chr12 8714663 C A M 12 11,1 0.92 M 19 3,16 0.16 0.76 NON_SYNONYMOUS_CODING Cta/Ata 0.45886 -0.459253 0.584957 -0.590896 Duplicated homeodomain-like superfamily protein
AH12G06450 Chr12 8735310 C T C 14 14,0 1.00 Y 11 2,9 0.18 0.82 NON_SYNONYMOUS_CODING aGa/aAa 0.458829 -0.459221 0.584923 -0.590847 Endosomal targeting BRO1-like domain-containing protein
AH12G06480 Chr12 8758727 G T G 16 15,1 0.94 K 9 4,5 0.44 0.49 NON_SYNONYMOUS_CODING aCa/aAa 0.458799 -0.45919 0.58489 -0.5908 GDSL esterase/lipase 5
AH12G06480 Chr12 8767570 C G C 18 18,0 1.00 S 9 2,7 0.22 0.78 NON_SYNONYMOUS_CODING caG/caC 0.458783 -0.459174 0.584873 -0.590776 GDSL esterase/lipase 5
AH12G06490 Chr12 8792582 T G T 21 21,0 1.00 K 13 7,6 0.54 0.46 NON_SYNONYMOUS_CODING Tta/Gta 0.458733 -0.459123 0.584819 -0.590701 GDSL esterase/lipase 3
AH12G06560 Chr12 8898415 T G G 20 2,18 0.90 K 26 23,3 0.12 0.78 NON_SYNONYMOUS_CODING gAt/gCt 0.458603 -0.458987 0.584691 -0.590474 UDP-glycosyltransferase 72B3
AH12G06950 Chr12 9324156 C G C 20 19,1 0.95 S 12 8,4 0.67 0.28 NON_SYNONYMOUS_CODING tGg/tCg 0.458109 -0.458489 0.584069 -0.589328 Pentatricopeptide repeat-containing protein
AH12G06950 Chr12 9324470 T C T 16 15,1 0.94 Y 18 11,7 0.61 0.33 NON_SYNONYMOUS_CODING aAt/aGt 0.458109 -0.458489 0.584069 -0.589328 Pentatricopeptide repeat-containing protein
AH12G07020 Chr12 9478950 G A R 8 1,7 0.88 R 6 5,1 0.17 0.71 NON_SYNONYMOUS_CODING tGc/tAc 0.458059 -0.458444 0.583973 -0.589016 Squamosa promoter-binding-like protein 8
AH12G07090 Chr12 9663318 G T K 24 21,3 0.88 K 29 8,21 0.28 0.60 NON_SYNONYMOUS_CODING Gca/Tca 0.457966 -0.458357 0.58382 -0.588646 mRNAion regulators

Table 3.

Identification of InDels in putative candidate genes in the genomic region for resistance to on chromosome 12.

Gene Chromosome Physical position (bp) Reference Genome Alternative site Resistant bulk (RB) base Number of reads covering the site (X coverage) in resistant bulk (RB) RB Depths of Ref, Alt SNP-index of RB Susceptible bulk(SB)base Number of reads covering the site (X coverage) in susceptible bulk(SB) SB Depths of Ref, Alt SNP-index of SB delta SNP-index (RB SNP-index-SB SNP-index) SNP substitution effect U95 (95% confidence interval upper side) L95 (95% confidence interval lower side) U99 (99% confidence interval upper side) L99 (99% confidence interval lower side) Gene Function
AH12G01550 Chr12 1888286 TCC T TCC 23 22,1 0.96 TCC,T 9 7,2 0.78 0.18 FRAME_SHIFT 0.499429 -0.498581 0.630045 -0.613463 putative disease resistance protein At3g14460 isoform X2 [Arachis ipaensis]
AH12G01670 Chr12 2019127 CCTATTCTACG
CCTCACAAAATCT
C CCTATTCTACG
CCTCACAAAATCT
28 26,2 0.93 CCTATTCTACGCCTCACAAAATCT,C 22 17,5 0.77 0.16 FRAME_SHIFT 0.499034 -0.498174 0.629563 -0.613179 HXXXD-type acyl-transferase family protein
AH12G01670 Chr12 2020084 T TGGTGAAACA T 21 21,0 1.00 T,TGGTGAAACA 15 10,5 0.67 0.33 CODON_INSERTION 0.498917 -0.498054 0.629416 -0.613083 HXXXD-type acyl-transferase family protein
AH12G01920 Chr12 2473096 A ACGTTT A,ACGTTT 22 19,3 0.86 A,ACGTTT 16 2,14 0.13 0.74 FRAME_SHIFT 0.496175 -0.495264 0.626054 -0.611224 Putative disease resistance protein At3g14460
AH12G01980 Chr12 2534345 CTCCGTACCAAG C C,CTCCGTACCAAG 24 22,2 0.92 C,CTCCGTACCAAG 20 18,2 0.90 0.02 FRAME_SHIFT 0.495902 -0.494987 0.625693 -0.611031 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2539604 TA T TA 24 24,0 1.00 TA,T 20 17,3 0.85 0.15 FRAME_SHIFT 0.495902 -0.494987 0.625693 -0.611031 Putative disease resistance RPP13-like protein 1
AH12G01980 Chr12 2539716 C CCA C 25 25,0 1.00 CCA,C 25 15,10 0.60 0.40 FRAME_SHIFT 0.495902 -0.494987 0.625693 -0.611031 Putative disease resistance RPP13-like protein 1
AH12G02090 Chr12 2620516 TGG T TGG 24 24,0 1.00 T,TGG 9 8,1 0.89 0.11 FRAME_SHIFT 0.495698 -0.494779 0.625463 -0.610928 Putative disease resistance RPP13-like protein 1
AH12G02390 Chr12 2847658 T TCAAA T 16 15,1 0.94 T,TCAAA 6 2,4 0.33 0.60 FRAME_SHIFT 0.495495 -0.494571 0.625259 -0.610874 Putative disease resistance RPP13-like protein 1
AH12G02440 Chr12 2879448 T TGAG T 11 11,0 1.00 T,TGAG 6 5,1 0.83 0.17 CODON_CHANGE_PLUS_CODON_INSERTION 0.495507 -0.494586 0.625287 -0.610914 Putative disease resistance RPP13-like protein 1
AH12G02600 Chr12 3030085 T TGATGGTGAGA
CTTTGAAGAGCA
ACCAGTCCTTC
TCTTGGAAATGAC
ACAAATGAGTTGCAGTGATG
TGATGGTGAGACTTT
GAAGAGCAACCAGTC
CTTCTCTTGGAAATGA
CACAAATGAGTTGCAGTGATG,T
8 7,1 0.88 T,TGATGGTGAG
ACTTTGAAGAGCA
ACCAGTCCTTCTC
TTGGAAATGACAC
AAATGAGTTGCAGTGATG
13 2,11 0.15 0.72 CODON_INSERTION 0.495575 -0.494661 0.625474 -0.61112 Putative disease resistance RPP13-like protein 1
AH12G03240 Chr12 3715392 ATCG A ATCG 17 17,0 1.00 A,ATCG 17 4,13 0.24 0.76 CODON_DELETION 0.496363 -0.495453 0.627006 -0.612884 BAG family molecular chaperone regulator 6
AH12G06110 Chr12 8165877 G GGATTAGTGGTGCAGCAGCTTGT G 20 20,0 1.00 G,GGATTAGTGGTGCAGCAGCTTGT 10 3,7 0.30 0.70 FRAME_SHIFT 0.502752 -0.502787 0.64146 -0.630466 hypothetical protein MTR_5g086360
AH12G06180 Chr12 8289562 CTAA C CTAA 10 10,0 1.00 CTAA,C 21 19,2 0.90 0.10 CODON_DELETION 0.502481 -0.502506 0.641028 -0.630118 E3 ubiquitin-protein ligase RNF144A-like

Figure 4.

Figure 4

The putative resistance-related proteins associated with resistance to Ralstonia solanacearum infections. CC: Coil coiled. NB-ARC: Nucleotide-binding adapter shared by APAF-1 R proteins and CED-4. LRR: Leucine-rich repeat domain. The positions of amino acid changes caused by nonsynonymous SNPs are shown in yellow.

3.6 Allele-specific marker development and validation

To evaluate the specificity of the allele marker of the resistant and susceptible peanut cultivars, we targeted 44 SNPs from candidate NBS-LRR genes for RRS for the development of allele-specific markers ( Supplementary Table 6 ). Allele-specific primers for 44 SNPs were successfully generated. All 44 allele-specific markers were checked for polymorphisms between parental genotypes of the RIL population (YY92 and XHXL). Of the 44 markers, 30 allele markers had good amplification, whereas 14 markers did not yield amplicons with clear bands from samples of parental genotypes. Of the 30 amplified markers, two markers (qRRS18 and qRRS19) in AH12G03230 and AH12G06320 genes co-segregated with RRS and may thus be deployed for RRS breeding ( Figure 5 ). These two polymorphic markers were validated on a panel of diverse genotypes containing the resistant parent (Yueyou 92), 18 introgression-resistant RIL lines (YX131, YX189, YX284, YX303, YX636, YX712, YX759, YX905, YX962, YX540, YX544, YX793, YX802, YX875, R160, R201, R215 and R739), the susceptible parent (Xinhuixiaoli), and 18 susceptible RIL lines (YX32, YX68, YX160, YX211, YX293, YX554, YX622, YX840, YX178, R123, R592, YX57, YX80, YX95, YX299, YX469, YX707 and YX939). The primers for the diagnostic marker ‘qRRS18’ amplified a 302-bp fragment in the susceptible parent and different susceptible RIL lines, but none in the resistant genotypes ( Figure 5A ). In contrast, primers for another diagnostic marker ‘qRRS19’ amplified 217-bp fragment in the resistant genotypes and none in susceptible lines ( Figure 5G ). Most importantly, these two diagnostic markers (qRRS18 + qRRS19) could be further developed and used to distinguish between homozygotes and heterozygotes in the segregating population; i.e., susceptible lines will have a 302-bp allele from the marker ‘qRRS18’ and resistant lines will have a 217-bp allele from the marker ‘qRRS19’. These two markers can be used as diagnostic marks for breeding resistant bacterial wilt varieties via MAS approach.

Figure 5.

Figure 5

Validation of putative candidate gene-based markers of bacterial wilt resistance. (A) The SNP marker validation of candidate gene AH12G03230 using a validation set comprising the resistant parent YY92, susceptible parent XHXL, and susceptible and resistant RIL lines). (B) SNP variation in the AH12G03230 gene. (C)The AH12G03230 gene is predicted to encode the CC-NBS-LRR resistance protein. (D) Putative genomic region on Chromosome 12 of Arachis hypogaea that encodes resistance to Ralstonia solanacearum infections (E) The AH12G06320 gene is predicted to encode the NBS-LRR resistant protein (E1 to E5 refer to exon numbers while I1 to I4 refer to intron numbers), (F) SNP variation in the AH12G06000 gene and (G) marker validation on a validation set comprising resistant parent YY92, susceptible parent XHXL, susceptible RIL lines (YX32, YX68, YX160, YX211, YX293, YX554, YX622, YX840 and YX178, R123, R592, YX57, YX80, YX95, YX299, YX469, YX707 andYX939), and resistant RIL lines (YX131, YX189, YX284, YX303, YX636, YX712, YX759, YX905, YX962, YX540, YX544, YX793, YX802, YX875, R160, R201, R215 and R739).

4 Discussion

With the advent of complete genome sequencing of diploid progenitor species and cultivated tetraploid variants, the QTL-seq approach is an increasingly popular sequencing-based method for the identification of candidate genomic regions associated with target traits in peanut (Varshney et al., 2019; Pandey et al., 2020). As it only requires whole genome sequences of parents and extreme trait bulks from the mapping population, it is economical, efficient, fast, and cost-effective (Takagi et al., 2013). Traditional QTL mapping methods are limited in the fine mapping of target genes and QTLs because they lack both high-density genetic maps and a series of near-isogenic lines (Pandey et al., 2017). Despite not having a large segregation population as a prerequisite, the QTL-seq approach was successful in identifying candidate genes for many crop traits (Das et al., 2014; Lu et al., 2014; Illa et al., 2015; Singh et al., 2016; Wang et al., 2016; Pandey et al., 2017; Srivastava et al., 2017; Chen et al., 2018; Clevenger et al., 2018; Luo et al., 2019; Bommisetty et al., 2020; Kumar et al., 2020; Lei et al., 2020; Tudor et al., 2020; Zhao et al., 2020; Cao et al., 2021; Dong et al., 2021; Topcu et al., 2021; Wang et al., 2021; Yang et al., 2021; Zhang et al., 2021). In the present study, a QTL-seq approach was successfully applied to identify genomic regions and candidate genes for RRS using resequencing data of both parental genotypes and pooled samples of the RIL population (Yueyou 92×Xinhuixiaoli) ( Supplementary Figure 1 ), which corroborated our previously reported QTL mapping findings (Zhao et al., 2016).

The use of a common reference genome that is associated with deep sequencing and large bulks should result in highly accurate maps. As per the original QTL-seq approach (Takagi et al., 2013), the genome assemblies of either one or both parents were used as reference to analyze the SNP variants in the two extreme bulks based on diploid reference genomes due to the unavailability of the cultivated peanut genome (Pandey et al., 2017; Luo et al., 2019; Kumar et al., 2020; Chen et al., 2021). Candidate genomic regions were then associated with target traits by the ΔSNP index method (Takagi et al., 2013). The choice of the parental reference genome possibly affects this association of candidate genomic regions due to differing levels of alignment errors (Luo et al., 2019). Moreover, the algorithm uses the reference genomes to replace the parental genomes in bigger diversity areas, which may cause erroneous assemblies of the parent genomes, especially for wild diploid ancestors (unpublished data). To increase the reliability of identified genomic regions and candidate genes, we used the Arachis hypogaea Shitouqi genome as a reference. Shitouqi (A. h. fastigiata var. vulgaris), belongs to the subsp. fastigiata, as does the parents of the population, and its high-quality genome sequence was recently reported (Zhuang et al., 2019). Based on a large RIL population of 581 individual lines from the cross of resistant YY92 and susceptible Xinhuixiaoli, 30 resistant and 30 susceptible lines were selected to respectively construct the extreme R and S-bulks ( Figure 1 and Supplementary Table 1 ). We generated 108.38 and 96.92 Gb of sequence reads at a sequencing depth of 38× and 34× for the R- and S-bulks, respectively ( Table 1 ). Nearly 98% of these reads were correctly mapped onto the reference genome. High densities of homozygous SNPs (381,642) and InDels (98,918) between parents were identified by resequencing for RRS mapping ( Supplementary Tables 2, 3 ). The candidate region of 5.73 Mb on Chr12 was identified by combining the ED and ΔSNP/InDel index algorithms for both SNPs and InDels ( Figures 2 , 5 ; Table 2 ; Supplementary Tables 2, 3 ) at a P<0.01 confidence level. These aided the precise and accurate discovery of candidate genomic regions, genes, and SNPs/Indels markers associated with RRS.

The clear extreme phenotypic differences between parents as well as those of the pooled population were the crucial prerequisite for candidate gene mapping via the QTL-seq approach (Zhao et al., 2020; Chen et al., 2021). An R2R3-MYB transcription factor gene named AhTc1 was mapped and characterized as associated with purple testa via the QTL-seq approach. Allele-specific markers were developed, which demonstrated that the marker pTesta1089 was closely linked with purple testa (Zhao et al., 2020). Chen et al. identified AhRt1 bHLH transcriptional factor as the candidate gene that regulates the red testa color of peanut via QTL-sequencing analyses. An AhRt1 diagnostic marker was then developed for validating and distinguishing different populations and peanut varieties (Chen et al., 2021). The phenotype evaluation of plant disease resistance traits is a challenge for map-based gene cloning. Unlike the testa color phenotype, disease resistance traits are complicated and affected by the environment, especially those for resistance to peanut bacterial wilt. As usual, the identification method in the disease nursery was used for the resistant evaluation. The survival rate was calculated from the number of dead plants until the point of harvesting for QTL mapping of BWR (Luo et al., 2019). However, the natural identification method was affected by the temperature, the soil environment, and anthropogenic effects. In our previous study, artificial inoculation by the leaf-cutting method was successfully used to evaluate the resistance to bacterial wilt via high throughput sequencing for QTL mapping of the cultivated peanut (Zhao et al., 2016). The resistance phenotyping in this study validated the accuracy of our previous findings (Zhao et al., 2016). The disease symptoms were classified into six disease severity ratings, and the resistance level of different lines was calculated by the disease index ( Figure 1 and Supplementary Table 1 ). The phenotype of different lines was truly reflective of the disease resistance as per the DI method and the candidate genomic region was then accurately identified by the QTL-seq approach ( Figure 2 and Supplementary Figures 6 - 9 ). This method is clearly valuable in the phenotyping of RRS for large populations in a cost-effective and practicable manner.

Hitherto, the main stable QTLs of RRS in the peanut were successfully identified through the original QTL method and QTL-seq approach (Luo et al., 2020). We previously reported SSR and SNP marker-based genetic linkage maps obtained through the classical QTL mapping (Zhao et al., 2016). Two major QTLs (qBW-1 and qBW-2) were identified for RRS, which were in the LG1 and LG10 linkage groups based on RAD- and BSA-seq techniques in F2 plants. One QTL linked to two QTL peaks on ChrB02 was identified in an F8 RIL population (Zhao et al., 2016). Luo et al. reported one QTL named qBWRB02.1 that possibly spanned a 5.14 Mb (0.81–5.95 Mb) interval on chromosome B02 based on its flanking SSR markers (Luo et al., 2020). Via the QTL-seq approach, they then identified a 2.07 Mb genomic region on ChrB02 associated with RRS across three environments (Luo et al., 2020). Two adjacent genomic regions (2.81–4.24 Mb and 6.54–8.75 Mb) on chromosome B02 were identified within the confidential interval of qBWRB02-1 and thus designated as qBWRB02-1-1 and qBWRB02-1-2 based on two diploids reference genomes (Luo et al., 2019). In the present study, by using the QTL-seq approach ( Supplementary Figure 1 ), a major peak on Chr12 spanning a 7.2 Mb (1.8–9.0 Mb) interval with a confidence level of P<0.05, 5.73 Mb of this peak had a confidence level of P<0.01 was identified as the candidate genomic region for RRS, corroborating RAD-seq findings (Zhao et al., 2016) and SLAF-seq techniques ( Figure 3 and Supplementary Figure 10 , unpublished). These revealed the precise identification of the candidate genomic region via the QTL-seq approach. In China, peanut cultivars that are resistant to bacterial wilt, originate from Xiekangqing, Taishan Zhenzhu, and the wildtype species (A.diogoi). Two major QTLs that were both named qBWRB02.1, were identified from the cross of Yuanza 9102 × Xuzhou 68-4. Yuanza 9102 is a popular resistant cultivar whose resistance stemmed from A.diogoi (Luo et al., 2020). Two major QTLs, qBWRB02-1-1 and qBWRB02-1-2, were fine-mapped from the cross of Zhonghua 6 × Xuhua 13. The resistance phenotype of Zhonghua 6 stemmed from the Chinese landrace Taishan Zhenzhu (Luo et al., 2019) whereas that of Yueyou92 stemmed from the Chinese landrace Xiekangqing, which is the parental type for many RRS breeding programs in South China (Janila et al., 2016; Luo et al., 2020). These candidate genomic regions associated with RRS were also mapped onto an interval of 10 Mb on chromosome 12.

QTL-seq approach was demonstrated as an effective method for the identification of putative SNPs associated with RRS. These could be developed into allele markers by using either different genotypes or diagnostic markers after the validation (Luo et al., 2019). Allele-specific markers that can be identified via agarose gel electrophoresis are the most cost-effective assays for genotyping a breeding population to select plants with the desired allele (Pandey et al., 2017). Here, 1807 effective SNPs and 629 InDels were identified. They span a 7.2 Mb genomic region on chromosome 12 that is associated with RRS. A total of 180 nonsynonymous SNPs and 14 InDels respectively affected 75 and 11 candidate genes that encode RRS ( Tables 2 , 3 , Supplementary Tables 4 and 5 ). The putative RRS-encoding NBS-LRR gene had 44 SNPs, which were targeted for the development of allele-specific markers. Despite designing primers for both alleles of each SNP, amplification of markers was often observed for only one of the allele pairs. Nonamplification of a few markers may be due to DNA template-primer mismatches (You et al., 2008; Pandey et al., 2017). In this study, polymorphic SNP markers were selected as diagnostic markers. Of the 30 amplified markers, two markers (qRRS18 and qRRS19) were robust and co-segregated with RRS ( Figure 5 ). These two polymorphic markers were then validated on a panel of diverse genotypes containing naturally resistant parental types (Yueyou 92) of the RIL population, 18 introgression lines, susceptible parental types (Xinhuixiaoli), and 18 susceptible RIL lines. The ‘qRRS18’ marker amplified susceptible alleles, whereas the ‘qRRS19’ marker amplified resistant alleles. Thus, these diagnostic allele markers can be applied in MAS for RRS in peanut breeding programs.

In plants, R genes play an important role in defending against pathogens through activation of the innate immune system (Jones and Dangl, 2006; Zhang et al., 2017; Sun et al., 2020; Chang et al., 2022). Most of them belong to the NBS-LRR type, which has been identified in many crops by map-based cloning (Takken and Joosten, 2000; Hulbert et al., 2001; McDowell and Woffenden, 2003; Meyers et al., 2005). The function of the NBS-LRR genes was correlated with either protein length or SNP variants. RRS1-R was the first reported Tir-NBS-LRR gene that conferred resistance to bacterial wilt in Arabidopsis species (Deslandes et al., 2003). RRS1-S, the allele of RRS1-R found in susceptible species, encode a protein without the WRKY domain. The two genes encoded contrasting phenotypes after R. solanacearum infections (Deslandes et al., 1998; Deslandes et al., 2003). Deng et al. identified an NBS-LRR gene named PigmR. It conferred resistance to the fungus Magnaporthe oryzae in rice and its encoded protein lacked four amino acids in the leucine-rich repeat (LRR) domain when compared to the R4 gene that conferred a susceptible phenotype (Deng et al., 2017). In the present study, the predicted products of 22 of the 180 candidate genes with nonsynonymous mutations in the 7.2 Mb region, were NBS-LRR type disease resistance proteins ( Table 2 and Figure 4 ). Notably, eight of the 22 candidate NBS-LRR genes were identified at a high confidence level as associated with RRS ( Figure 4 ). Moreover, seven NBS-LRR genes had SNP variant sites in the LRR domain ( Figure 4 ). The diagnostic SNP markers (qRRS18 and qRRS19) of the candidate AH12G03230 and AH12G06320 NBS-LRR genes were validated in the RIL lines ( Figure 5 ). This indicates that AH12G03230 and AH12G06320 might be the candidate resistant genes for RRS in cultivated peanut. Therefore, based on these findings, these putative resistance genes possibly significantly contribute to RRS in peanut and should thus be targeted as candidates for fine mapping and function validation.

5 Conclusion

In this study, the QTL-seq approach was proven as a powerful method for the successful identification of genomic regions and candidate genes of major and robust QTLs that are associated with RRS. We not only identified a 7.2 Mb genomic region on chromosome 12 containing eight candidate NBS-LRR resistance genes but also availed validated allele-specific diagnostic markers and key candidate genes for RRS breeding. The genomic information (genes) and tools (markers) could be used in genomics-assisted breeding programs to accelerate the development of peanut varieties with enhanced RRS as well as to increase insights into RRS molecular mechanisms.

Data availability statement

The original contributions presented in the study are publicly available. This data can be found here: NCBI, PRJNA851221.

Author contributions

WZ and RV conceived the original research plan and designed the experiment. CZ, WX, HF, YC, HC, TC, QY, YZ, KC, and XZ performed the experiments and analyzed the data. CZ and WX wrote the manuscript, while WZ, MP, and RV reviewed and edit the manuscript. All authors analyzed the data and approved the submitted version.

Acknowledgments

We would like to thank MogoEdit (https://www.mogoedit.com) for its English editing during the preparation of this manuscript.

Funding

This work was supported by National Science Foundation (NSF) of China (Grant No. 32072103 and 31701463 to CZ, Grant No. U1705233 to WZ), the Science and Technology Foundation of Fujian Province of China (Grant No. 2018N0004 to CZ), the Opening Grant of Guangdong Province Key Laboratory of Plant Molecular Breeding (Grant No. GPKLPMB202203 to CZ), the Special Fund for Scientific and Technological Innovation of Fujian Agriculture and Forestry University (Grant No. KFb22011XA to CZ).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2022.1048168/full#supplementary-material

References

  1. Arikit S., Wanchana S., Khanthong S., Saensuk C., Thianthavon T., Vanavichit A., et al. (2019). QTL-seq identifies cooked grain elongation QTLs near soluble starch synthase and starch branching enzymes in rice (Oryza sativa L.). Sci. Rep. 9, 1–10. doi: 10.1038/s41598-019-44856-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ben C., Debellé F., Berges H., Bellec A., Jardinaud M.-F., Anson P., et al. (2013). MtQRRS1, an R-locus required for Medicago truncatula quantitative resistance to Ralstonia solanacearum . New Phytol. 199, 758–772. doi: 10.1111/nph.12299 [DOI] [PubMed] [Google Scholar]
  3. Bommisetty R., Chakravartty N., Bodanapu R., Naik J. B., Panda S. K., Lekkala S. P., et al. (2020). Discovery of genomic regions and candidate genes for grain weight employing next generation sequencing based QTL-seq approach in rice (Oryza sativa L.). mol. Biol. Rep. 47, 8615–8627. doi: 10.1007/s11033-020-05904-7 [DOI] [PubMed] [Google Scholar]
  4. Cao M., Li S., Deng Q., Wang H., Yang R. (2021). Identification of a major-effect QTL associated with pre-harvest sprouting in cucumber (Cucumis sativus L.) using the QTL-seq method. BMC Genomics 22, 1–11. doi: 10.1186/s12864-021-07548-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Carmeille A., Caranta C., Dintinger J., Prior P., Luisetti J., Besse P. (2006). Identification of QTLs for Ralstonia solanacearum race 3-phylotype II resistance in tomato. theor. Appl. Genet. 113, 110–121. doi: 10.1007/s00122-006-0277-3 [DOI] [PubMed] [Google Scholar]
  6. Chang M., Chen H., Liu F., Fu Z. Q. (2022). PTI and ETI: convergent pathways with diverse elicitors. Trends Plant Sci. 27, 113–115. doi: 10.1016/j.tplants.2021.11.013 [DOI] [PubMed] [Google Scholar]
  7. Chen H., Chen X., Xu R., Liu W., Liu N., Huang L., et al. (2021). Fine-mapping and gene candidate analysis for AhRt1, a major dominant locus responsible for testa color in cultivated peanut. theor. Appl. Genet. 134, 3721–3730. doi: 10.1007/s00122-021-03924-w [DOI] [PubMed] [Google Scholar]
  8. Chen Q., Song J., Du W. P., Xu L. Y., Jiang Y., Zhang J., et al. (2018). Identification and genetic mapping for rht-DM, a dominant dwarfing gene in mutant semi-dwarf maize using QTL-seq approach. Genes Genomics 40, 1091–1099. doi: 10.1007/s13258-018-0716-y [DOI] [PubMed] [Google Scholar]
  9. Cingolani P., Platts A., Wang L. L., Coon M., Nguyen T., Wang L., et al. (2012). A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of drosophila melanogaster strain w1118; iso-2; iso-3. Fly (Austin) 6, 80–92. doi: 10.4161/fly.19695 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Clevenger J., Chu Y., Chavarro C., Botton S., Culbreath A., Isleib T. G., et al. (2018). Mapping late leaf spot resistance in peanut (Arachis hypogaea) using QTL-seq reveals markers for marker-assisted selection. front. Plant Sci. 9, 1–10. doi: 10.3389/fpls.2018.00083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Das S., Upadhyaya H. D., Bajaj D., Kujur A., Badoni S., Gowda C. L. L., et al. (2014). Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea. DNA Res. 22, 193–203. doi: 10.1093/dnares/dsv004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Deng Y., Zhai K., Xie Z., Yang D., Zhu X., Liu J., et al. (2017). Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science 355, 962–965. doi: 10.1126/science.aai8898 [DOI] [PubMed] [Google Scholar]
  13. Deslandes L., Olivier J., Peeters N., Feng D. X., Khounlotham M., Boucher C., et al. (2003). Physical interaction between RRS1-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proc. Natl. Acad. Sci. U.S.A. 100, 8024–8029. doi: 10.1073/pnas.1230660100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Deslandes L., Pileur F., Liaubet L., Camut S., Beynon J., Arlat M., et al. (1998). “Identification and mapping of RRS1, a single recessive locus in arabidopsis thaliana that confers resistance to Ralstonia solanacearum ,” in Bacterial wilt disease Springer, Berlin, Heidelberg., 250–254. doi:  10.1007/978-3-662-03592-4_36 [DOI] [Google Scholar]
  15. Dong Z., Alam M. K., Xie M., Yang L., Liu J., Helal M. M. U., et al. (2021). Mapping of a major QTL controlling plant height using a high-density genetic map and QTL-seq methods based on whole-genome resequencing in Brassica napus . G3 (Bethesda) 11, jkab118. doi: 10.1093/g3journal/jkab118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Du H., Wen C., Zhang X., Xu X., Yang J., Chen B., et al. (2019). Identification of a major QTL (qRRs-10.1) that confers resistance to Ralstonia solanacearum in pepper (Capsicum annuum) using SLAF-BSA and QTL mapping. int. J. Mol. Sci. 20, 5887. doi: 10.3390/ijms20235887 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Genin S., Boucher C. (2004). Lessons learned from the genome analysis of Ralstonia solanacearum . Annu. Rev. Phytopathol. 42, 107–134. doi: 10.1146/annurev.phyto.42.011204.104301 [DOI] [PubMed] [Google Scholar]
  18. Godiard L., Sauviac L., Torii K. U., Grenon O., Mangin B., Grimsley N. H., et al. (2003). ERECTA, an LRR receptor-like kinase protein controlling development pleiotropically affects resistance to bacterial wilt. Plant J. 36, 353–365. doi: 10.1046/j.1365-313X.2003.01877.x [DOI] [PubMed] [Google Scholar]
  19. Habe I., Miyatake K., Nunome T., Yamasaki M., Hayashi T. (2019). QTL analysis of resistance to bacterial wilt caused by Ralstonia solanacearum in potato. Breed. Sci. 69, 592–600. doi: 10.1270/jsbbs.19059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hulbert S. H., Webb C. A., Smith S. M., Sun Q. (2001). Resistance gene complexes: evolution and utilization. Annu. Rev. Phytopathol. 39, 285–312. doi: 10.1146/annurev.phyto.39.1.285 [DOI] [PubMed] [Google Scholar]
  21. Illa E., Jason B., Huang Z. (2015). Rapid and reliable identification of tomato fruit weight and locule number loci by QTL-seq. Theor. Appl. Genet., 128, 1329–1342. doi: 10.1007/s00122-015-2509-x [DOI] [PubMed] [Google Scholar]
  22. Janila P., Variath M. T., Pandey M. K., Desmae H., Motagi B. N., Okori P., et al. (2016). Genomic tools in groundnut breeding program: Status and perspectives. Front. Plant Sci. 7, 289. doi: 10.3389/fpls.2016.00289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jones J. D. G., Dangl J. L. (2006). The plant immune system. Nature 444, 323–329. doi: 10.1038/nature05286 [DOI] [PubMed] [Google Scholar]
  24. Kumar R., Janila P., Vishwakarma M. K., Khan A. W., Manohar S. S., Gangurde S. S., et al. (2020). Whole-genome resequencing-based QTL-seq identified candidate genes and molecular markers for fresh seed dormancy in groundnut. Plant Biotechnol. J. 18, 992–1003. doi: 10.1111/pbi.13266 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lebeau A., Gouy M., Daunay M. C., Wicker E., Chiroleu F., Prior P., et al. (2013). Genetic mapping of a major dominant gene for resistance to Ralstonia solanacearum in eggplant. Theor. Appl. Genet. 126, 143–158. doi: 10.1007/s00122-012-1969-5 [DOI] [PubMed] [Google Scholar]
  26. Lei L., Zheng H., Bi Y., Yang L., Liu H., Wang J., et al. (2020). Identification of a major QTL and candidate gene analysis of salt tolerance at the bud burst stage in rice (Oryza sativa L.) using QTL-seq and RNA-seq. Rice 13, 1–14. doi: 10.1186/s12284-020-00416-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li H., Durbin R. (2009). Fast and accurate short read alignment with burrows-wheeler transform. Bioinformatics 25, 1754–1760. doi: 10.1093/bioinformatics/btp324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lu H., Lin T., Klein J., Wang S., Qi J., Zhou Q., et al. (2014). QTL-seq identifies an early flowering QTL located near Flowering Locus T in cucumber. Theor. Appl. Genet. 127, 1491–1499. doi: 10.1007/s00122-014-2313-z [DOI] [PubMed] [Google Scholar]
  29. Luo H., Pandey M. K., Khan A. W., Guo J., Wu B., Cai Y., et al. (2019). Discovery of genomic regions and candidate genes controlling shelling percentage using QTL-seq approach in cultivated peanut (Arachis hypogaea L.). Plant Biotechnol. J. 17, 1248–1260. doi: 10.1111/pbi.13050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Luo H., Pandey M. K., Khan A. W., Wu B., Guo J., Ren X., et al. (2019). Next-generation sequencing identified genomic region and diagnostic markers for resistance to bacterial wilt on chromosome B02 in peanut (Arachis hypogaea L.). Plant Biotechnol. J. 17, 2356–2369. doi: 10.1111/pbi.13153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Luo H., Pandey M. K., Zhi Y., Zhang H., Xu S., Guo J., et al. (2020). Discovery of two novel and adjacent QTLs on chromosome B02 controlling resistance against bacterial wilt in peanut variety zhonghua 6. Theor. Appl. Genet. 133, 1133–1148. doi: 10.1007/s00122-020-03537-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. McDowell J. M., Woffenden B. J. (2003). Plant disease resistance genes: recent insights and potential applications. Trends Biotechnol. 21, 178–183. doi: 10.1016/S0167-7799(03)00053-2 [DOI] [PubMed] [Google Scholar]
  33. Meyers B. C., Kaushik S., Nandety R. S. (2005). Evolving disease resistance genes. Curr. Opin. Plant Biol. 8, 129–134. doi: 10.1016/j.pbi.2005.01.002 [DOI] [PubMed] [Google Scholar]
  34. Mimura Y., Kageyama T., Minamiyama Y., Hirai M. (2009). QTL analysis for resistance to Ralstonia solanacearum in Capsicum accession ‘LS2341.’ J. Japanese Soc Hortic. Sci. 78, 307–313. doi: 10.2503/jjshs1.78.307 [DOI] [Google Scholar]
  35. Narusaka M., Hatakeyama K., Shirasu K., Narusaka Y., Narusaka M., Hatakeyama K., et al. (2014). Arabidopsis dual resistance proteins, both RPS4 and RRS1, are required for resistance to bacterial wilt in transgenic Brassica crops. Plant Signaling & Behav. 9, e29130. doi: 10.4161/psb.29130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Narusaka M., Shirasu K., Noutoshi Y., Kubo Y., Shiraishi T., Iwabuchi M., et al. (2009). RRS1 and RPS4 provide a dual resistance-gene system against fungal and bacterial pathogens. Plant J. 60, 218–226. doi: 10.1111/j.1365-313X.2009.03949.x [DOI] [PubMed] [Google Scholar]
  37. Pandey M. K., Khan A. W., Singh V. K., Vishwakarma M. K., Shasidhar Y., Kumar V., et al. (2017). QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.). Plant Biotechnol. J. 15, 927–941. doi: 10.1111/pbi.12686 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Pandey M. K., Pandey A. K., Kumar R., Nwosu C. V., Guo B., Wright G. C., et al. (2020). Translational genomics for achieving higher genetic gains in groundnut. Theor. Appl. Genet. 133, 1679–1702. doi: 10.1007/s00122-020-03592-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Reddy P. P. (2016). “Viral diseases and their management,” in Sustainable Crop Protection under Protected Cultivation (Singapore: Springer press; ), 161–176. [Google Scholar]
  40. Reumers J., De Rijk P., Zhao H., Liekens A., Smeets D., Cleary J., et al. (2012). Optimized filtering reduces the error rate in detecting genomic variants by short-read sequencing. Nat. Biotechnol. 30, 61–68. doi: 10.1038/nbt.2053 [DOI] [PubMed] [Google Scholar]
  41. Salanoubat M., Genin S., Artiguenave F., Gouzy J., Mangenot S., Arlat M., et al. (2002). Genome sequence Plant pathogen Ralstonia solanacearum . Nature 415, 497–502. doi: 10.1038/415497a [DOI] [PubMed] [Google Scholar]
  42. Salgon S., Jourda C., Sauvage C., Daunay M. C., Reynaud B., Wicker E., et al. (2017). Eggplant resistance to the Ralstonia solanacearum species complex involves both broad-spectrum and strain-specific quantitative trait loci. Front. Plant Sci. 8, 828. doi: 10.3389/fpls.2017.00828 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Schell M. A. (2000). Control of virulence and pathogenicity genes of Ralstonia solanacearum by an elaborate sensory network. Annu. Rev. Phytopathol. 38, 263–292. doi: 10.1146/annurev.phyto.38.1.263 [DOI] [PubMed] [Google Scholar]
  44. Shin I. S., Hsu J. C., Huang S. M., Chen J. R., Wang J. F., Hanson P., et al. (2020). Construction of a single nucleotide polymorphism marker based QTL map and validation of resistance loci to bacterial wilt caused by Ralstonia solanacearum species complex in tomato. Euphytica 216, 54. doi: 10.1007/s10681-020-2576-1 [DOI] [Google Scholar]
  45. Singh V. K., Khan A. W., Jaganathan D., Thudi M., Roorkiwal M., Takagi H., et al. (2016). QTL-seq for rapid identification of candidate genes for 100-seed weight and root/total plant dry weight ratio under rainfed conditions in chickpea. Plant Biotechnol. J. 14, 2110–2119. doi: 10.1111/pbi.12567 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Srivastava R., Upadhyaya H. D., Kumar R., Daware A., Basu U., Shimray P. W., et al. (2017). A multiple QTL-seq strategy delineates potential genomic loci governing flowering time in chickpea. Front. Plant Sci. 8, 1105. doi: 10.3389/fpls.2017.01105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sunkara S., Bhatnagar-Mathur P., Sharma K. K. (2014). “Transgenic interventions in peanut crop improvement: Progress and prospects,” in Genetics, genomics and breeding of crop plants (Boca Raton, FL: CRC Press; ), 178–215. [Google Scholar]
  48. Sun Y., Zhu Y. X., Balint-Kurti P. J., Wang G. F. (2020). Fine-tuning immunity: Players and regulators for plant NLRs. Trends Plant Sci. 25, 695–713. doi: 10.1016/j.tplants.2020.02.008 [DOI] [PubMed] [Google Scholar]
  49. Takagi H., Abe A., Yoshida K., Kosugi S., Natsume S., Mitsuoka C., et al. (2013). QTL-seq: Rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations. Plant J. 74, 174–183. doi: 10.1111/tpj.12105 [DOI] [PubMed] [Google Scholar]
  50. Takken F. L. W., Joosten M. H. A. J. (2000). Plant resistance genes: their structure, function and evolution. Eur. J. Plant Pathol. 106, 699–713. doi: 10.1023/A:1026571130477 [DOI] [Google Scholar]
  51. Thoquet P., Olivier J., Sperisen C., Rogowsky P., Laterrot H., Grimsley N. (1996). Quantitative trait loci determining resistance to bacterial wilt in tomato cultivar Hawaii7996. MPMI-Molecular Plant Microbe Interact. 9, 826–836. doi: 10.1094/MPMI-9-0826 [DOI] [Google Scholar]
  52. Topcu Y., Sapkota M., Illa E., Savithri B., Esther U. N. (2021). Identification of blossom-end rot loci using joint QTL−seq and linkage−based QTL mapping in tomato. Theor. Appl. Genet. 134, 2931–2945. doi: 10.1007/s00122-021-03869-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Tudor E. H., Jones D. M., He Z., Bancroft I., Trick M., Wells R., et al. (2020). QTL-seq identifies BnaFT.A02 and BnaFLC.A02 as candidates for variation in vernalization requirement and response in winter oilseed rape (Brassica napus). Plant Biotechnol. J. 18, 2466–2481. doi: 10.1111/pbi.13421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Varshney R. K., Pandey M. K., Bohra A., Singh V. K., Thudi M., Saxena R. K. (2019). Toward the sequence-based breeding in legumes in the post-genome sequencing era. Theor. Appl. Genet. 132, 797–816. doi: 10.1007/s00122-018-3252-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wang H., Cheng H., Wang W., Liu J., Hao M., Mei D., et al. (2016). Identification of BnaYUCCA6 as a candidate gene for branch angle in Brassica napus by QTL-seq. Sci. Rep. 6, 38493. doi: 10.1038/srep38493 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Wang J.-F., Ho F.-I., Truong H. T. H., Huang S.-M., Balatero C. H., Dittapongpitch V., et al. (2013). Identification of major QTLs associated with stable resistance of tomato cultivar ‘Hawaii 7996’ to Ralstonia solanacearum . Euphytica 190, 241–252. doi: 10.1007/s10681-012-0830-x [DOI] [Google Scholar]
  57. Wang Y., Sun H., Wang H., Yang X., Xu Y., Yang Z., et al. (2021). Integrating transcriptome, co-expression and QTL-seq analysis reveals that primary root growth in maize is regulated via flavonoid biosynthesis and auxin signal transduction. J. Exp. Bot. 72, 4773–4795. doi: 10.1093/jxb/erab177 [DOI] [PubMed] [Google Scholar]
  58. Yang L., Wang J., Han Z., Lei L., Liu H. L., Zheng H., et al. (2021). Combining QTL-seq and linkage mapping to fine map a candidate gene in qCTS6 for cold tolerance at the seedling stage in rice. BMC Plant Biol. 21, 1–14. doi: 10.1186/s12870-021-03076-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. You F. M., Huo N., Gu Y. Q., Luo M. C., Ma Y., Hane D., et al. (2008). BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinf. 9, 253. doi: 10.1186/1471-2105-9-253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Yu S. L., Wang C. T., Yang Q. L., Zhang D. X., Zhang X. Y., Cao Y. L., et al. (2011). Peanut genetics and breeding in China Vol. 565 (Shanghai: Shanghai Sci. Technol. Press; ). [Google Scholar]
  61. Zhang C., Badri Anarjan M., Win K. T., Begum S., Lee S. (2021). QTL-seq analysis of powdery mildew resistance in a Korean cucumber inbred line. Theor. Appl. Genet. 134, 435–451. doi: 10.1007/s00122-020-03705-x [DOI] [PubMed] [Google Scholar]
  62. Zhang C., Chen H., Cai T., Deng Y., Zhuang R., Zhang N., et al. (2017). Overexpression of a novel peanut NBS-LRR gene AhRRS5 enhances disease resistance to Ralstonia solanacearum in tobacco. Plant Biotechnol. J. 15, 39–55. doi: 10.1111/pbi.12589 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Zhang C., Chen H., Zhuang R. R., Chen Y. T., Deng Y., Cai T. C., et al. (2019). Overexpression of the peanut CLAVATA1-like leucine-rich repeat receptor-like kinase AhRLK1 confers increased resistance to bacterial wilt in tobacco. J. Exp. Bot. 70, 5407–5421. doi: 10.1093/jxb/erz274 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zhao Y., Ma J., Li M., Deng L., Li G., Xia H., et al. (2020). Whole-genome resequencing-based QTL-seq identified AhTc1 gene encoding a R2R3-MYB transcription factor controlling peanut purple testa colour. Plant Biotechnol. J. 18, 96–105. doi: 10.1111/pbi.13175 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhao Y., Zhang C., Chen H., Yuan M., Nipper R., Prakash C. S., et al. (2016). QTL mapping for bacterial wilt resistance in peanut (Arachis hypogaea L.). Mol. Breed 36, 1–11. doi: 10.1007/s11032-015-0432-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Zhuang W., Chen H., Yang M., Wang J., Pandey M. K., Zhang C., et al. (2019). The genome of cultivated peanut provides insight into legume karyotypes, polyploid evolution and crop domestication. Nat. Genet. 51, 865–876. doi: 10.1038/s41588-019-0402-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The original contributions presented in the study are publicly available. This data can be found here: NCBI, PRJNA851221.


Articles from Frontiers in Plant Science are provided here courtesy of Frontiers Media SA

RESOURCES