Abstract
We studied the physicochemical characteristics and mycobiota associated to five key historic documents from Costa Rica, including the Independence Act of Costa Rica from 1821. We used nondestructive techniques (i.e., ATR-FTIR and XRF) to determine paper and ink composition. Results show that some documents are composed of cotton-based paper, whereas others were made of wood cellulose with an increased lignin content. We also determined that the ink employed in some of the documents is ferrogallic. Cultivation and molecular techniques were used to characterize the fungi inhabiting the documents. In total, 22 fungal isolates were obtained: 15 from the wood-cellulose-based documents and seven from the other three cotton-based. We also tested the cellulolytic activity of the recovered fungi; 95% of the fungi presented cellulolytic activity correlated to their ability to cause deterioration of the paper. Results suggest that cotton-based paper is the most resistant to fungal colonization and that most of the isolates have cellulolytic activity. This work increases the knowledge of the fungal diversity that inhabits historic documents and its relationship with paper composition and provides valuable information to develop strategies to conserve and restore these invaluable documents.
Introduction
Because biodeterioration can lead to the damage of historic documents, artwork, monuments, or buildings, its study is fundamental for the conservation of cultural heritage [1–5]. The prevention of biodeterioration and development of adequate conservation and restoration strategies cannot be an unscripted process; it is necessary to undertake diagnoses of these valuable pieces of our history and art, which include chemical characterization and the study of microbial diversity together with the physiological characteristics of biodeteriogens [1,6].
Valuable cultural and historic objects, such as relevant paintings, ancient sculptures, and historic documents, can be seen as substrates on which microorganisms can thrive and cause damage. Specifically, paper-based documents contain biodegradable organic constituents that fungi can use as a substrate [7,8]. The term “paper” is a general concept that encompasses all thinly laminated material that is produced with plant-based fiber pulp or other materials ground and mixed with water, dried, and hardened. Historically, these plant-based fibers have been extracted from natural sources, such as straw, silk, hemp, flax, cotton, and the bark of different trees, among others. The content of cellulose and other components of paper can vary depending on its origin, generating papers that are more or less resistant to biodegradation as a consequence. For example, it is well known that cellulose fibers have high purity in cotton and linen papers, which results in papers with greater durability and resistance to biodeterioration [9,10].
Damage produced by fungi that is normally present on paper—including staining, material weakening, and partial or complete destruction of documents—can occur in the long term [11]. Besides the alterations caused to the documents, the health of curators and people involved in archives or museums can also be threatened if the spore production is elevated or mycotoxins are produced [4]. The study of fungi responsible for the biodegradation of paper began in 1818 with the pioneering work of Christian Gottfried Ehrenberg [4]. To date, diverse fungi have been identified in old paperwork, such as Aspergillus, Chaetomium, Cladosporium, Penicillium, and Trichoderma; occasionally, new species can even be found [11–13]. Mesquita et al. [14] isolated, identified, and characterized the microbiota from historic documents dated between 1860–1939 in the archive of the University of Coimbra and found fourteen fungal genera, of which Aspergillus, Cladosporium, and Penicillium were the most common. Our research group recently isolated nineteen fungi from a nineteenth-century French collection of drawings and lithographs in the custody of Universidad de Costa Rica [13]. The fungi were molecularly identified as Arthrinium, Aspergillus, Chaetomium, Cladosporium, Colletotrichum, Penicillium, and Trichoderma; a great majority of them showed cellulolytic activity. Many fungal species found in historic paper-based documents contain enzymatic activity related to biodeterioration, which allows fungi to use these surfaces as a source of carbon [5,12]. The enzymatic machinery to take advantage of paper as a source of carbon has been reported in fungi isolated from historic documents and includes the presence of exoenzymes with cellulase activity [14–16] lignocellulolytic [17] glucanase, and laccase [4].
The National Archive of Costa Rica (NACR)—called Archivos Nacionales (National Archives) before 1948—is where the most treasured documents in Costa Rica are preserved; these include the Cloudy Days Act (Acta de los Nublados, September 28, 1821), in which authorities of the Municipality of León, in the Captaincy General of Guatemala, expressed their position on Central American Independence; the Political Constitution with all historic changes, including the abolition of the Costa Rican army [18,19]; and perhaps the most important historic document in the country: the Costa Rican Independence Act (Acta de Independencia, October 29, 1821). These invaluable documents are in addition to more than 20,000 linear meters of other paper-based documents that contain the history of Costa Rica and that are in the custody of NACR. Due to the tropical peculiarities of the country—such as high humidity, heat, long rainy seasons, and sometimes inadequate storage conditions—documents and artworks are constantly threatened and come under continuous biodeterioration, making the conservation of the country’s cultural heritage a challenge [20].
The aim of this work was to characterize the paper composition and evaluate the presence and cellulolytic activity of culturable fungi in historic documents from the National Archive of Costa Rica, including invaluable documents such as the Independence Act of Costa Rica. This information would enable restorers to establish guidelines for the preservation and restoration of paper-based historic documents.
Materials and methods
Sampling of documents
Permits to sample the historic documents were obtained from the Institutional Commission of Biodiversity of the University of Costa Rica (resolution N°186) and authorities of the NACR. Historic documents stored at NACR were sampled between March and September 2019. The documents were: (i) Political Constitution redacted in 1949 (1991 replica), (ii) Cloudy Days Act from 1821 (Acta de los Nublados), (iii) Independence Act of Costa Rica from 1821, and (iv) two documents from the Guatemalan Series from 1539 and 1549 (Fig 1). For fungal isolation, careful rubbing with sterile cotton swabs over the surface of the documents was performed, especially seeking signs of biodeterioration such as dark spots. The swabs were then saved inside Falcon tubes for transport to the laboratory.
Fig 1. Historic documents from Costa Rica analyzed for chemical and substrate characterization.
A,B. Independence Act. C. Signs of deterioration on the Independence Act, including yellow spots around the letters. D. Cloudy Days Act. E. Humidity mark on Cloudy Days Act. F. Oxidation signs around the ink from Cloudy Days Act. G. 1949 Political Constitution (1991 reproduction). H. Signs of microbiological contamination on 1949 Political Constitution (1991 reproduction). I. Yellow spots on 1949 Political Constitution (1991 reproduction). J. Fragment of the 1539 Guatemalan Series. K. Fragment of the 1549 Guatemalan Series. L,M. Signs of leakage and humidity on 1539–1549 Guatemalan Series.
Material characterization by attenuated-total-reflection Fourier-transform infrared spectra (ATR-FTIR)
ATR-FTIR was used to determine functional groups and distinguish cellulosic materials. These ATR-FTIR spectra were recorded using a portable spectrophotometer (Bruker Alpha II, Canada) with platinum ATR mode and monolithic diamond crystal. The spectral resolution was 4 cm-1, in wavenumber range 400–4,000 cm-1 with 99 scans. To carry out the identification, the “Database of ATR-FT-IR spectra of various materials” [21–25] was used (see S1 Table).
Material characterization by X-ray fluorescence (XRF)
X-ray fluorescence (XRF) was used to determine the elemental composition of the material, especially the presence of metallic ions, such as iron and calcium, among others. This technique is especially important in the characterization of inks. The XRF spectra were recorded with a portable XRF spectrophotometer (Elio, XGLab; Bruker, Italy) measured at the Kα line of manganese (resolution 140 eV), a SDD detector (active area 25 mm2, fluorescence angle 63°, incident angle 90°) and a distance of 14 mm from the detector to the sample. The electric current was adjusted to 80 μA, with a voltage of 50 kV and a measuring duration of 300 s. Software XRS-FP2 (CrossRoads Scientific, USA) was used for data analysis, maintaining a noise signal of 0.5.
Fungal cultivation strategy
Samples were processed in the laboratory 2–4 hours after sampling. Cotton swabs were immersed into sterile phosphate-buffered saline solution (PBS; 400 μL, 1X; Thermo Fisher Scientific, USA) and homogenized using a vortex (40 s). Each sample (100 μL) was then cultured in plates of potato dextrose agar (1% Difco PDA; BD company, France) and carboxymethyl cellulose (1% CMC; Sigma Aldrich, USA, with 0.8% agar; BD company, France) with kanamycin (50 μg/mL; Sigma-Aldrich, USA) and incubated (25°C) until growth was observed. Colonies exhibiting varied morphologies were purified and transferred onto PDA plates; photographs were taken after incubation (15 days, 30°C).
Molecular identification of the isolated fungi
Genomic DNA was extracted from the isolated fungi using the method described by Lodhi et al. [26] with modifications. First, two agar disks (diameter 8 mm) from each fungus were added to a centrifuge tube (2 mL) and were ground with sterile micro-pestles. Extraction buffer (750 μL, sodium EDTA 20 mM, tris-HCl 100 mM, NaCl 1.4 M, CTAB 2% [w/v], PVP 2% [w/v] and ß-mercaptoethanol 0.2%) was added; the tubes were vortexed and incubated (20 min, 65°C). For DNA separation, trichloromethane-octanol (750 μL, 24:1) was added to the mixture and centrifuged (25°C, 14,000 rpm). DNA from the top aqueous phase (600 μL) was precipitated by the addition of 2-propanol (600 μL; Sigma-Aldrich, USA). Then, ethanol (70%, 500 μL; Sigma-Aldrich, USA) was used to wash the precipitated DNA. Finally, DNA was resuspended in Tris-EDTA buffer (50 μL) with RNAse (1 μL, 10 mg/mL; Thermo Fisher Scientific, USA).
To obtain a preliminary identification of the isolates, ca. 525 bp of the nrDNA internal transcribed spacers (ITS) were amplified with primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) [27]. Depending on the results from ITS, secondary markers were used to refine the identifications for some isolates, i.e., ca. 250 bp of the translation elongation factor 1-alpha (TEF1; primers CATCGAGAAGTTCGAGAAGG and TACTTGAAGGAACCCTTACC) [28] and ca. 600 bp of the beta-tubulin (TUB2; primers AACATGCGTGAGATTGTAAGT and TAGTGACCCTTGGCCCAGTTG) [29] genes. Each reaction (total volume 20 μL) consisted of Master Mix (10 μL, 2X; Thermo Fisher Scientific, USA), bovine serum albumin (BSA, 0.5 μL, 20 mg/mL; Sigma Aldrich, USA), dimethyl sulfoxide (DMSO, 1.5 μL; Sigma Aldrich, USA), and primers (0.5 μL each, 10 μM) and DNA (2 μL, 50 ng/μL). PCR reactions were implemented in a thermal cycler (9902 Veriti, Applied Biosystem, Norwalk, USA), according to conditions described by Schoch [30] for ITS, Carbone and Kohn [28] for TEF1 (ca. 300 bp), and O’Donnell and Cigelnik [29] for TUB2. Sanger sequencing of PCR products was performed with Psomagen (USA); the raw sequences were edited and assembled in Bioedit v.7.2. Identification was performed by comparing the consensus sequences and running the BLAST search tool against the UNITE v. 2020 database for ITS sequences [31], and NCBI-GenBank Nucleotide Collection (nr/nt) database. For the latter, the search was first limited to “sequences from type material.” If the query sequence was <98% similar to type material, then the search was expanded to include the entire database but excluding “uncultured/environmental sample sequences.” A 98% and 90–98% similarity thresholds were used to call species or genera, respectively. Then, a cladogram was constructed using the ITS sequences. For this, the two closest matches, with type material prioritized, were retrieved/downloaded from the BLAST analysis and aligned using MUSCLE [32]. The resulting alignment in Phylip format was submitted to Bayesian Inference analysis with Exabayes [33]. MCMC was run in parallel and 15 million generations were done with 25% burn-in. All analyses were run in the Kabré supercomputer (CNCA-CONARE, Costa Rica). A consensus tree was visualized and edited with FigTree v.1.4.3. Newly generated sequences were deposited and publicly available in GenBank under accession numbers ON479855–ON479876 (ITS), ON720280–ON720285 (TEF1), and ON734081–ON734096 (TUB2).
Screening of cellulolytic activity
The screening of cellulase-producing fungi was undertaken on carboxymethyl cellulose plates (CMC, 1%; Sigma Aldrich, USA) as the sole carbon source, supplemented with agar (0.8%, Sigma Aldrich, USA) [34–36]. For this purpose, agar disks (diameter ~0.8 mm) of each fungus were placed in the center of CMC plates and incubated (7 days, 30°C). After incubation, each plate was flooded with Gram’s iodine stain (10 mL; Sigma-Aldrich, USA) [35,36] and washed with water for 10 min. Because Gram’s iodine dye is held only by integral cellulose polymers, cellulase activity is revealed by the clear zones appearing as pale halos [37]. Photographs were taken before and after staining the plates; software ImageJ v.1.52k [38] was used to measure fungal growth (as the diameter of the colony) and the halo diameter for a subsequent calculation of the enzymatic index (EI), a semiquantitative estimate of enzyme activity according to the following formula [37]:
The experiments were performed in triplicate; Pleurotus ostreatus served as a positive control [39,40]. This test reveals that the expression of enzymes capable of degrading carboxymethylcellulose occurs in the isolates, and that due to the composition of the paper (cellulose and lignin) the degradative capacity of the fungi in this matrix may be different. However, this assay is a good first approximation to assess whether these fungi may be affecting these historical documents.
Results
Material characterization by infrared spectra (ATR-FTIR) and X-ray fluorescence (XRF)
Macroscopically all documents analyzed showed detailed damage as observed in Fig 1, in which signs of humidity and possible leakage are visible in several areas. Particularly, in the Independence Act surface, orangish spots were present. When observed under UV light, those areas are fluorescent and appear as dark spots in UV reflectance photographs (S1 Fig).
The chemical composition of historic documents (both inks and paper) was studied through nondestructive and portable techniques (See Materials and Methods). The composition of each document is shown in Table 1. The composition of the organic substrate was determined by comparing the IR spectra with databases; the elements present in the ink and additives were resolved with X-ray fluorescence. The results showed that the paper in the documents from 1500–1900 was handmade mainly from cotton with watermark presence (excepting the second page from the Cloudy Days Act, which was cellulose-based). In the Political Constitution (1991 replica), modern paper was used, characterized by shorter fibers and greater lignin content; this indicates that this paper was made from wood cellulose.
Table 1. Chemical, substrate, and ink characterization of the historic documents from Costa Rica.
See S2 Table for measurements of iron and calcium percentages.
| Document | Sections analyzed for chemical characterization |
Sections analyzed for fungal isolation | Paper composition | Ink chemical elements detected |
|---|---|---|---|---|
| Independence Act, 1821 | Pages 1–3 | Pages 1–3 | Cotton | Fe, Ca, Zn, K |
| Cloudy Days Act, 1821 | Page 1 Page 2 |
Full document | Cotton Cellulose acetate |
Fe, Ca, Zn, K, S, Cl, Pb Fe, Ca, Zn |
| Political Constitution, 1949 (1991 replica) | Full document | Cover and Slavery Abolition page | Wood cellulose | Not determined |
| Guatemalan Series 1539 | Full document | Pages 1,8,3,17 | Cotton | Not determined |
| Guatemalan Series 1549 | Full document | Pages 2,5,9,10 | Cotton | Not determined |
The results showed that the ink employed in the documents from 1821 was ferrogallic, formed by iron sulfate salts in combination with gallic and tannic acids (Tables 1 and S2, and S1 Fig). S2 Table shows the average concentrations of iron and calcium in the inked areas of the documents, along with their standard deviation, maximum and minimum values. The other elements were detectable, but not quantifiable.
Isolation and identification of fungi
In total, 22 fungal isolates (S2 Fig) were recovered from the Costa Rican historic documents, being the Political Constitution (1991 replica) that with the most isolates (15 in total). The taxonomic identification provided by BLAST and ITS phylogenetic analyses are shown in Table 2 and Fig 2, respectively. The fungi recovered belong to 14 genera and eight orders. Two taxa were obtained from the Independence Act, two from the Cloudy Days Act, two from the document from 1549, and only one fungal isolate from the oldest document (Guatemalan Series 1539). The phylogenetic placement of the isolates corresponded to eight orders, as shown in the ITS cladogram (Fig 2). The phylogenetic analysis supports the identifications performed with the BLAST tool, at least at the genus level. TEF1 and TUB2 sequences refined the identification for some of the isolates (Table 2).
Table 2. Identification (ID); BLAST results using ITS, TEF1 and TUB2; and origin of documents.
Names in bold indicate the assigned/selected classification.
| Isolate number | Origin | Closest match and accession number / % similarity * | ||
|---|---|---|---|---|
| ID with ITS | ID with TEF1 | ID with TUB2 | ||
| 1539-A1P | Guatemalan series, 1539 | Purpureocillium lilacinum MZ359582 / 99.3 | Purpureocillium lilacinum MH613753 / 100 | Purpureocillium lilacinum JQ965112 / 99.8 |
| 1549-1A1P | Guatemalan series, 1549 | Penicillium sp. FJ752622 / 99.81 | - | Penicillium compactum KM973202 / 98.6 |
| 1549-4A1C | Unidentified Herpotrichiellaceae KJ612089 / 90.48 | no match | no match | |
| AI1-A1C | Independence Act, 1821 | Cladosporium sp. OK274323 / 100 | - | Cladosporium oxysporum EF101455 / 95.5 |
| AI3-A1P | Aspergillus hiratsukae MN347034 / 100 | - | Aspergillus hiratsukae MH644026 / 100 | |
| CP1-A1C | Political Constitution, 1949 (1991 reproduction) | Periconia sp. KP128003 / 99.80 | no match | no match |
| CP1-A1P | Cladosporium sp. OK274323 / 92.48 | - | Cladosporium sp. JQ217373 / 97 | |
| CP1-A2C | Pestalotiopsis microspora OK254042 / 100 | - | Neopestalotiopsis clavispora OM328818 / 98.2 | |
| CP1-A2P | Cladosporium sp. EF504401 / 100 | - | - | |
| CP1-A3C | Trametes hirsuta GQ280373 / 100 | - | - | |
| CP1-A3P | Unidentified Psathyrellaceae JQ922137 / 100 | - | no match | |
| CP2-A1C | Unidentified Pleosporales KP263091 / 92.42 | - | Biatriospora sp. MF588919 / 86 | |
| CP2-A1P | Purpureocillium lilacinum MZ359582 / 99.88 | - | Purpureocillium lilacinum GU968702 / 100% | |
| CP2-A2C | Pestalotiopsis trachycarpicola MZ453106 / 99.82 | Neopestalotiopsis sp. KR493607 / 100 | Pestalotiopsis kenyana KX895360 / 100 | |
| CP2-A2P | Coprinellus sp. MK307658 / 99.84 | - | - | |
| CP2-A3C | Acremonium persicinum JQ599382 / 99.42 | - | - | |
| CP2-A3P | Beauveria bassiana MZ618707 / 100 | - | Xenoacremonium recifei KM232105 / 89 | |
| CP2-A4C | Acremonium persicinum JQ599382 / 100 | - | - | |
| CP2-A4P | Cyphellophora aff. pluriseptata MH063042.1 / 91.7 | - | Cyphellophora sp. LR814116 / 80% | |
| CP2-A5C | Penicillium sumatraense MH864547 / 100 | - | - | |
| ND1-A1P | Cloudy Days Act, 1821 | Penicillium steckii MZ568311 / 100 | - | Penicillium steckii MW196656 / 100 |
| ND2-A1P | Cladosporium sp. OK242741 / 100 | - | Cladosporium oxysporum KU216745 / 99.7 | |
*If the percent identity is less than 80% and query coverage less than 50%, then the result is indicated as “no match.” The query cover is defined as a percentage that describes how much of the query sequence is covered by the target sequence.
Fig 2. Bayesian inference consensus cladogram based on nrDNA ITS sequences.
Posterior probabilities are indicated at branches. LnL = -13564.21.
Most of the fungi found belong in the Ascomycota (86%), followed by Basidiomycota (14%). Among the resulting orders, the majority belong in Hypocreales (23%; Acremonium, Beauveria, and Purpureocillium), Eurotiales (18%; Aspergillus and Penicillium), and Capnodiales (18%; Cladosporium). The Basidiomycota was represented by Coprinellus, Trametes and an unidentified species of Psathyrellaceae.
Cellulolytic activity
The results from cellulolytic activity are shown in Table 3. For the 22 isolates tested, the Enzymatic Index (EI) average was 2.45, with Cyphellophora aff. pluriseptata CP2-A4P isolated from the Political Constitution being the fungus with the greatest cellulolytic activity (4.0 ± 0.3), followed by Penicillium steckii ND1-A1P (3.3 ± 0.3), and Cladosporium sp. CP1-A2P (3.3 ± 0.1). In contrast, Purpureocillium lilacinum 1539-A1P —from the 1539 Guatemalan Series—was the only isolate without cellulolytic activity. The other fungal isolates showed cellulolytic activity above the levels of the control (Pleurotus ostreatus), except for Trametes CP1-A3C.
Table 3. Enzymatic index (EI) registered by fungal isolates (± indicates standard deviation based on three replicates).
| Isolate code | Taxonomy | Enzymatic Index (EI) |
|---|---|---|
| CP2-A4P | Cyphellophora aff. pluriseptata | 4.0 ± 0.3 |
| ND1-A1P | Penicillium steckii | 3.3 ± 0.3 |
| CP1-A2P | Cladosporium sp. | 3.3 ± 0.1 |
| CP2-A1P | Purpureocillium lilacinum | 3.2 ± 0.0 |
| 1549-4A1C | Herpotrichiellaceae | 3.1 ± 0.4 |
| CP2-A2C | Pestalotiopsis kenyana | 3.1 ± 0.5 |
| CP2-A3P | Beauveria bassiana | 3.1 ± 0.3 |
| CP1-A1P | Cladosporium sp. | 3.0 ± 0.1 |
| CP2-A5C | Penicillium sumatraense | 2.9 ± 0.7 |
| CP2-A1C | Pleosporales | 2.8 ± 0.2 |
| AI3-A1P | Aspergillus hiratsukae | 2.8 ± 0.0 |
| 1549-1A1P | Penicillium compactum | 2.6 ± 0.9 |
| AI1-A1C | Cladosporium sp. | 2.6 ± 0.1 |
| CP1-A1C | Periconia sp. | 2.5 ± 0.3 |
| ND2-A1P | Cladosporium oxysporum | 2.5 ± 0.2 |
| CP1-A3P | Psathyrellaceae | 2.2 ± 0.2 |
| CP2-A2P | Coprinellus sp. | 2.0 ± 0.3 |
| CP2-A4C | Acremonium persicinum | 1.8 ± 0.1 |
| CP1-A2C | Neopestalotiopsis clavispora | 1.7 ± 0.1 |
| CP2-A3C | Acremonium persicinum | 1.6 ± 0.2 |
| Control | Pleurotus ostreatus | 1.3 ± 0.1 |
| CP1-A3C | Trametes hirsuta | 1.1 ± 0.0 |
| 1539-A1P | Purpureocillium lilacinum | 0 |
Discussion
In this work we determined the chemical and microbiological composition of five important historic documents of Costa Rica, including the Independence Act of 1821. Through spectral techniques, we determined that for the documents dated between 1500 and 1900 (i.e., the Cloudy Days Act, the Independence Act of Costa Rica of 1821, and two documents from the Guatemalan Series of 1539 and 1549), the composition of the paper was cotton (i.e., approximately 90% cellulose [41], except the second page of the Cloudy Days Act, which is composed of cellulose acetate. The 1991 replica of the Political Constitution of 1949 contained cellulose and lignin; this paper presented the greatest amount of lignin, which indicates a modern paper made from wood (hereafter referred to as wood cellulose-based paper).
Despite that modern paper is relatively stable, deterioration is common with increased levels of humidity and acidification produced by oxidation and the presence of microorganisms [42]. Although the 1991 replica of the Political Constitution from 1949 is the most recent, 15 fungal isolates were obtained, whereas from all the oldest documents (made mainly of cotton), seven in total were obtained. These data suggest that wood-cellulose-based paper possesses characteristics that are more suitable for fungal colonization than cotton-based documents. These observations make sense if we consider the differences between the chemical composition of cotton and paper obtained from other plant fibers such as wood. Cotton contains approximately 90% cellulose (hence it is sometimes referred to as highly pure cellulose), whereas other natural fibers, such as wood, contain 40–55% cellulose combined with other constituents such as lignin and hemicelluloses [42]. Cellulose is considered a two-phase material, having both crystalline and amorphous phases [43]. Cotton cellulose fibers are reported to have a greater degree of polymerization and crystallinity, which generates stronger fibers and greater resistance to hydrolysis and biodegradation [44]. Therefore, these two characteristics (higher cellulose content and higher crystallinity) make cotton a substrate that is less prone to microbial colonization than a material such as wood-based paper, which is the case of the paper of the 1991 replica of the Political Constitution of 1949. Enzymatically, the reduced ability for microbial colonization of cotton-based papers is related to the more limited access of the cellulase enzyme complex to the substrate due to the orderly and compact architecture of the crystalline cellulose present in cotton [45].
In Fig 1C, the orangish spots over the Independence Act surface indicate oxidation from cellulose and iron, probably caused by both abiotic and biotic factors [46]. Those areas are fluorescent under UV light and appear as dark spots in UV reflectance photographs (S1 Fig). Although excessive humidity can itself trigger oxidation, contributing to the damage of important documents, the inks used can also be affected by this abiotic factor, producing the migration of metal ions of common ink components such as iron and copper, compromising the preservation of historic and cultural heritage due to weakened paper [47]. Our work determined that the ink employed in the documents from 1821 was ferrogallic, formed by iron sulfate salts in combination with gallic and tannic acids. The last was confirmed from the XRF and multispectral photography (see S1 Fig). Ink of this kind is visible under infrared and, in darkness, under UV light [48]. The implementation of optical spectroscopy techniques, such as those used in this work, have been shown to help identify the early stages of document damage by microorganisms such as fungi, relating changes in the spectral composition to the active presence of fungi [49].
In the historic documents, we obtained a total of 22 fungi belonging to 14 genera, of which five (35%) were previously identified in paper-based historic documents [50–53]. The presence of two Chaetothyriales members (isolates 1549-4A1C and CP2-A4P) is interesting because they are inhabitants of environments with limited resources, such as rocks, insects, and ant nests; some species in the order can even become pathogenic for humans, especially in tropical regions [54,55]. Cyphellophora, also Chaetothyriales, is closely related to Phialophora [56], which includes species that grow in extremely acidic conditions and have been reported to produce ß-mannanase and ß -glucanase enzymes [57,58]. Our isolate CP2-A4P had the greatest enzymatic index value (4.0 ± 0.3), for which further analysis involving enzyme identification could yield intriguing results. Isolate Penicillium steckii ND1-A1P originated from a cotton-based substrate and presented an enzymatic index of 3.3 ± 0.3. This corresponds to what is commonly observed because Aspergillus and Penicillium species are registered continuously in paper biodeterioration and are known to break the hydrogen bonds, which translates into a weakening of the documents, regardless of their composition [49]. In total, three isolates corresponding to Penicillium were obtained from the Cloudy Days Act, the Political Constitution, and the 1549 Guatemalan Series. We registered only a single isolate corresponding to Aspergillus hiratsukae (AI3-A1P), which was recovered from the Independence Act of 1821. This was unexpected because Aspergillus spp. are frequent biodeteriogens in cultural heritage objects and spaces in which historic documents are preserved, such as the National Archive of Cuba, in which Aspergillus, Cladosporium, and Penicillium were the most frequent airborne genera reported [59]. In this work, Cladosporium isolates were present in the Cloudy Days Act (isolate ND2-A1P), the Independence Act (isolate AI1-A1C), and the Political Constitution (isolates CP1-A1P and CP1-A2P), corresponding to cellulose acetate, cotton, and wood cellulose substrates. Cladosporium spp. are reported as colonizers in agricultural waste [60], artworks [13], repositories of historic documents [59], and as extremophiles in high-altitude tropical glaciers [61].
Neopestalotiopsis clavispora (CP1-A2C) and Pestalotiopsis kenyana (CP2-A2C) (Xylariales), both obtained from the Political Constitution, belong to a genus known as a common endophyte, saprotroph, and phytopathogen in diverse plants and climates [62]. Because of the various ecological relationships this genus has with plants, it has attracted attention for its cellulolytic abilities, with over 400 possible enzymes found through the study of a Pestalotiopsis isolated from a mangrove [63]. So far, there are some cellulolytic enzymes known from this genus that have been studied, such as the xylanase [64] or the cellulases [65]. Another single isolate obtained from the Political Constitution was Periconia CP1-A1C, which belongs to the dark septate fungi Pleosporales, with some isolates reported with thermostable β-Glucosidases suitable for biotechnological processes [66]. Periconia species have been encountered in extreme environments, such as deserts, seas, tropical glaciers [61], and even a new species growing over lithographs from the 19th century [13], among others.
Hypocreales isolates were only found in the Political Constitution. Intriguing were two isolates known as insect pathogens, i.e., Beauveria (CP2-A3P) and Purpureocillium (1539-A1P and CP2-A1P) [67]. The cellulolytic activity recorded for our Beauveria isolate was 3.1± 0.3, which is consistent with reports of cellulolytic activity driven by a thermally stable β-Glucosidase in Beauveria bassiana [68]. Screening for cellulolytic activity in this entomopathogenic species is not commonly done because it is mainly studied for its biological control abilities in multiple agricultural crops [69–71]. Beauveria has also been found as an endophyte, along with Purpureocillium [72]. An isolate of Purpureocillium lilacinum has been reported as a biodeteriogen of indoor materials able to grow in alkaline materials, producing damage in limestones and plasters of cultural heritage in Russia [73]. The tolerance to extreme conditions by some Purpureocillium spp. results in the ability to become pathogenic to humans and resistant to fungicides [61]. Although one isolate recovered from the 1539 Guatemalan Series (cotton-based) was unable to grow in the carboxymethyl cellulose media, isolate CP2-A1P from the Political Constitution (wood cellulose-based) attained EI of 3.2. Acremonium isolates CP2-A3C and ND2-A1P registered enzymatic indexes < 3. Previous researchers reported a xylanase produced by Acremonium cellulolyticus [74]; another group subsequently revised the taxonomy and concluded a misidentification of an Acremonium species, reidentifying isolate Y-94 from Japan as Talaromyces (Eurotiales) [75]. Apart from the latter, only a xylanase has been reported for A. alcalophilum [76].
Small enzymatic indexes also occurred for three basidiomycetes recovered from the Political Constitution (CP1-A3C, CP1-A3P, and CP2-A2P). These were identified as belonging to Psathyrellaceae, including Coprinellus (CP2-A2P). From these, only one report exists of a xylanase produced by Coprinellus disseminatus, which was tolerant to varied pH and temperatures [77]. Isolate Trametes CP1-A3C registered an EI less than the control (Pleurotus ostreatus). Species with tough fruiting bodies, such as Trametes maxima, are reported to possess laccase activity, even when exposed to herbicides [78]; an isolate of T. versicolor is reported to cause the effective degradation of fungicides [79].
Conclusions
We conclude that regardless of the material of a document of origin—cotton or wood cellulose—, most recovered fungal isolates presented cellulolytic activity. From the historic documents sampled, the Political Constitution had the greatest number of isolates, which suggests that wood cellulose-based paper possesses characteristics more suitable for fungal colonization than the oldest cotton-based documents (i.e., documents from 1500–1900). Cotton contains 90% cellulose and has great crystallinity, which makes it more difficult for the enzymatic machinery of microorganisms to degrade it and use its components for their nutritional requirements. Even though the oldest documents (e.g., Independence Act and the Cloudy Days Act) yielded few isolates, restoration and improvement of the conditions they are stored in should be implemented to avoid oxidation and weakening of their fibers which could then increase microbiological contamination. Determining the chemical composition of the paper and the composition of the inks, as well as the microbiological load, allows for identification of the most appropriate strategies and treatments to preserve documents as important to Costa Rica as the Independence Act itself. Because historic documents can be considered microhabitats with limited resources, the screening of species with novel biotechnological applications in such environments is a promising and fascinating field. The study of how best to conserve historic documents is vital to preserve, in a satisfactory condition, important sources and records of human history.
Supporting information
A. Reflectance ultraviolet photograph. B. Fluorescence ultraviolet photograph. C. Visible photograph. Surface indicate an oxidation process from the cellulose and iron, probably caused by both abiotic and biotic factors.
(PDF)
Attenuated total reflectance Fourier transform infrared spectra (ATR-FTIR) of the (A) Independence Act; (B) Political Constitution, 1949 (1991 replica); (C) Cloudy Days Act (folio 2); (D) Cloudy Days Act (folio 1); (E) Guatemalan Series 1539; and (F) Guatemalan Series 1549. Also see S1 Table.
(PDF)
A. 1539-A1P, Purpureocillium lilacinum B. 1549-1A1P, Penicillium compactum. C. 1549-4A1C, Herpotrichiellaceae. D. AI1-A1C, Cladosporium sp. E. AI3-A1P, Aspergillus hiratsukae F. CP1-A1C, Periconia sp. G. CP1-A1P, Cladosporium sp. H. CP1-A2C, Pestalotiopsis microspora I. CP1-A2P, Cladosporium sp. J. CP1-A3C, Trametes hirsuta K. CP1-A3P, Unidentified Psathyrellaceae. L. CP2-A1C, Unidentified Pleosporales. M. CP2-A1P, Purpureocillium lilacinum N. CP2-A2C, Pestalotiopsis trachycarpicola O. CP2-A2P, Coprinellus sp. P. CP2-A3C, Acremonium persicinum Q. CP2-A3P, Beauveria bassiana R. CP2-A4C, Acremonium persicinum S. CP2-A4P, Cyphellophora aff. pluriseptata. T. CP2-A5C, Penicillium sumatraense U. ND1-A1P, Penicillium steckii V. ND2-A1P, Cladosporium sp.
(PDF)
(PDF)
Measurements shown are average ± standard deviation, and minimum and maximum in parentheses.
(PDF)
Data Availability
DNA sequences are deposited in GenBank under accession numbers ON479855–ON479876 (ITS), ON720280–ON720285 (TEF1), and ON734081–ON734096 (TUB2) and will be publicly available upon acceptance of manuscript. All other raw data has been deposited in GitHub: https://github.com/EEscuderoL/Fungi-with-history-Unveiling-the-mycobiota-of-historic-documents-of-Costa-Rica-Supplementary-data- and is publicly available.
Funding Statement
M.L.M: Vice-rectory of Research of Universidad de Costa Rica, grant C0741, https://vinv.ucr.ac.cr/ M.C., P.C.: The Vice-rectory of Research of Universidad de Costa Rica, grant VI 809-C0-471, https://vinv.ucr.ac.cr/ M.C.: National Center of Biotechnological Innovations (CENIBiot), no grant number, https://www.cenibiot.ac.cr/ The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Palla F, Barresi G. Biotechnology and conservation of cultural heritage. 2nd ed. Springer, Cham; 2022. [Google Scholar]
- 2.Ranalli G, Alfano G, Belli C, Lustrato G, Colombini M.P., Bonaduce I, et al. Biotechnology applied to cultural heritage: biorestoration of frescoes using viable bacterial cells and enzymes. J. Appl. Microbiol. 2005; 98:73–83. doi: 10.1111/j.1365-2672.2004.02429.x [DOI] [PubMed] [Google Scholar]
- 3.Ranalli G, Zanardini E. Biocleaning on cultural heritage: new frontiers of microbial biotechnologies. J. Appl. Microbiol. 2021; 131:583–603. doi: 10.1111/jam.14993 [DOI] [PubMed] [Google Scholar]
- 4.Sterflinger K, Pinzari F. The revenge of time: Fungal deterioration of cultural heritage with particular reference to books, paper and parchment. Environ Microbiol. 2012; 14:559–566. doi: 10.1111/j.1462-2920.2011.02584.x [DOI] [PubMed] [Google Scholar]
- 5.Vieto S, Escudero-Leyva E, Avendaño R, Rechnitzer N, Barrantes-Madrigal MD, Conejo-Barboza G, et al. Biodeterioration and cellulolytic activity by fungi isolated from a nineteenth-century painting at the National Theatre of Costa Rica. Fungal Biol. 2021; 126: 101–112. doi: 10.1016/j.funbio.2021.11.001 [DOI] [PubMed] [Google Scholar]
- 6.Negi A, Sarethy IP. Microbial biodeterioration of cultural heritage: events, colonization, and analyses. Microb Ecol. 2019; 78:1014–1029. doi: 10.1007/s00248-019-01366-y [DOI] [PubMed] [Google Scholar]
- 7.Jia Y, Yin L, Zhang F, Wang M, Sun M, Hu C, et al. Fungal community analysis and biodeterioration of waterlogged wooden lacquerware from the Nanhai no. 1 shipwreck. Appl Sci. 2020; 10:e3797. [Google Scholar]
- 8.Pyzik A, Ciuchcinski K, Dziurzynski M, Dziewit L. The bad and the good-microorganisms in cultural heritage environments-an update on biodeterioration and biotreatment approaches. Materials. 2021; 14:1–15. doi: 10.3390/ma14010177 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Daria M, Krzysztof L, Jakub M. Characteristics of biodegradable textiles used in environmental engineering: A comprehensive review. J Clean Prod. 2020; 268:e122129. [Google Scholar]
- 10.Negulescu I, Hyojung K, Collier BJ, Collier JR, Pends A. Recycling cotton from cotton/ polyester fabrics. Text Chem Color. 1998; 30:31–35. [Google Scholar]
- 11.Sequeira SO, De Carvalho HP, Mesquita N, Portugal, Macedo MF. Fungal stains on paper: Is what you see what you get? Conservar Patrimonio. 2019; 32:18–27. [Google Scholar]
- 12.Sterflinger K. Fungi: Their role in deterioration of cultural heritage. Fungal Biol Rev. 2010; 24:47–55. [Google Scholar]
- 13.Coronado-Ruiz C, Avendaño R, Escudero-Leyva E, Conejo-Barboza G, Chaverri P, Chavarría M. Two new cellulolytic fungal species isolated from a 19th-century art collection. Sci Rep. 2018; 10: e7492. doi: 10.1038/s41598-018-24934-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Mesquita N, Portugal A, Videira S, Rodríguez-Echeverría S, Bandeira AML, Santos MJA, et al. Fungal diversity in ancient documents. A case study on the Archive of the University of Coimbra. Int Biodeterior Biodegradation. 2009; 63: 626–629. [Google Scholar]
- 15.El Bergadi F, Laachari F, Elabed S, Mohammed IH, Ibnsouda SK. Cellulolytic potential and filter paper activity of fungi isolated from ancients manuscripts from the Medina of Fez. Ann Microbiol, 2014; 64: 815–822. [Google Scholar]
- 16.Puškárová A, Bučková M, Habalová B, Kraková L, Maková A, Pangallo D. Microbial communities affecting albumen photography heritage: a methodological survey. Sci Rep. 2016; 6: e20810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Mazzoli R, Giuffrida MG, Pessione E. Back to the past: “find the guilty bug—microorganisms involved in the biodeterioration of archeological and historical artifacts”. Appl Microbiol Biotechnol. 2018; 102: 6393–6407. [DOI] [PubMed] [Google Scholar]
- 18.Chacón León LA. El bicentenario de la independencia de Costa Rica. Revista del Archivo Nacional de Costa Rica. 2021; 85:1–13. [Google Scholar]
- 19.Jaén García LF. José Luis Coto Conde y la transformación del Archivo Nacional de Costa Rica. Revista del Archivo Nacional de Costa Rica. 2019; 83: 54–72. [Google Scholar]
- 20.Silva AG. The difficulty for conserving cultural heritage in tropical countries: the experience of Rio de Janeiro City. Int Preserv News. 2011; 54: 40–43. [Google Scholar]
- 21.Boukir A, Fellak S, Doumenq P. Structural characterization of Argania spinosa Moroccan wooden artifacts during natural degradation progress using infrared spectroscopy (ATR-FTIR) and X-Ray diffraction (XRD). Heliyon. 2019; 5:e02477. doi: 10.1016/j.heliyon.2019.e02477 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Hajji L, Boukir A, Assouik J, Kerbal A, Kajjout M, Doumenq P, et al. A Multi-analytical approach for the evaluation of the efficiency of the conservation-restoration treatment of Moroccan historical manuscripts dating to the 16th, 17th, and 18th centuries. Appl Spectrosc. 2015; 69:920–938. doi: 10.1366/14-07688 [DOI] [PubMed] [Google Scholar]
- 23.Hajji L, Boukir A, Assouik J, Lakhiari H, Kerbal A, Doumenq P, et al. Conservation of Moroccan manuscript papers aged 150, 200 and 800 years. Analysis by infrared spectroscopy (ATR-FTIR), X-ray diffraction (XRD), and scanning electron microscopy energy dispersive spectrometry (SEM–EDS). Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy. 2015; 136:1038–1046. doi: 10.1016/j.saa.2014.09.127 [DOI] [PubMed] [Google Scholar]
- 24.Peets P, Kaupmees K, Vahur S, Leito I. Reflectance FT-IR spectroscopy as a viable option for textile fiber identification. Heritage Sci. 2019; 7:1–10. [Google Scholar]
- 25.Vahur S, Teearu A, Peets P, Joosu L, Leito I. ATR-FT-IR spectral collection of conservation materials in the extended region of 4000–80 cm–1. Anal Bioanal Chem. 2016; 408:3373–3379. [DOI] [PubMed] [Google Scholar]
- 26.Lodhi MA, Ye GN, Weeden NF, Reisch BI. A simple and efficient method for DNA extraction from grapevine cultivars and Vitis species. Plant Mol Biol Rep. 1994; 12:6–13. [Google Scholar]
- 27.White TJ, Bruns T, Lee S, and Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, PCR Protocols. 1990; Academic Press, Inc. [Google Scholar]
- 28.Carbone I, Kohn LM. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia. 1999; 91:553–556. [Google Scholar]
- 29.O’Donnell K, Cigelnik E.bTwo divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the Fungus Fusarium are nonorthologous. Mol Phylogenetics Evol. 1997; 7:103–116. [DOI] [PubMed] [Google Scholar]
- 30.Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA. 2012; 109:6241–6246. doi: 10.1073/pnas.1117018109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Abarenkov K, Nilsson RH, Larsson KH, Alexander IJ, Eberhardt U, Erland S, et al. The UNITE database for molecular identification of fungi—recent updates and future perspectives. New Phytol. 2010; 186:281–285. doi: 10.1111/j.1469-8137.2009.03160.x [DOI] [PubMed] [Google Scholar]
- 32.Edgar RC. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinform. 2004; 5:1–19. doi: 10.1186/1471-2105-5-113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Aberer AJ, Kobert K, Stamatakis A. ExaBayes: massively parallel Bayesian tree inference for the whole-genome era. Mol Biol Evol. 2014; 31:2553–2556. doi: 10.1093/molbev/msu236 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Johnsen HR, Krause K. Cellulase activity screening using pure carboxymethylcellulose: Application to soluble cellulolytic samples and to plant tissue prints. Int J Mol Sci. 2014; 15:830–838. doi: 10.3390/ijms15010830 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Gohel HR, Contractor CN, Ghosh SK, Braganza VJ.A comparative study of various staining techniques for determination of extra cellular cellulase activity on Carboxy Methyl Cellulose (CMC) agar plates. Int J Curr Microbiol Appl Sci. 2014; 3:261–266. [Google Scholar]
- 36.Kasana RC, Salwan R, Dhar H, Dutt S, Gulati A. A rapid and easy method for the detection of microbial cellulases on agar plates using Gram’s iodine. Curr Microbiol. 2008; 57: 503–507. doi: 10.1007/s00284-008-9276-8 [DOI] [PubMed] [Google Scholar]
- 37.Florencio C, Couri S, Farinas CS. Correlation between agar plate screening and solid-state fermentation for the prediction of cellulase production by Trichoderma strains. Enzyme Research, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Bourne R, Bourne R. ImageJ. Fundamentals of Digital Imaging in Medicine. 2010; 9(7), 185–188. [Google Scholar]
- 39.Garzlllo AMV, Di Paolo S, Ruzzi M, Buonocore V. Hydrolytic properties of extracellular cellulases from Pleurotus ostreatus. Applied Microbiology and Biotechnology, 1994; 42(2–3), 476–481. [Google Scholar]
- 40.Valášková V, Baldrian P. Estimation of bound and free fractions of lignocellulose-degrading enzymes of wood-rotting fungi Pleurotus ostreatus, Trametes versicolor and Piptoporus betulinus. Research in Microbiol. 2006; 157(2), 119–124. [DOI] [PubMed] [Google Scholar]
- 41.Felgueiras C, Azoia NG, Gonçalves C, Gama M, Dourado F. Trends on the cellulose-based textiles: raw materials and technologies. Front Bioeng Biotechnol. 2021; 9:e608826. doi: 10.3389/fbioe.2021.608826 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Proniewicz LM, Paluszkiewicz C, Wesełucha-Birczyńska A, Majcherczyk H, Barański A, Konieczna A. FT-IR and FT-Raman study of hydrothermally degradated cellulose. J Mol Struct. 2001; 596:163–169. [Google Scholar]
- 43.Ling Z, Wang T, Makarem M, Cheng HN, Kang X, Bacher M, et al. Effects of ball milling on the structure of cotton cellulose. Cellulose. 2019; 26:305–328 [Google Scholar]
- 44.Itävaara M, Siika-aho M, Viikari L. Enzymatic degradation of cellulose-based materials. J Polym Environ. 1999; 7:67–73. [Google Scholar]
- 45.Arantes V, Saddler JN. Access to cellulose limits the efficiency of enzymatic hydrolysis: the role of amorphogenesis. Biotechnol Biofuels. 2010; 3:e4. doi: 10.1186/1754-6834-3-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Choi S. Foxing on paper: a literature review. J Am Inst Conserv. 2007; 46:137–152. [Google Scholar]
- 47.Henniges U, Prohaska T, Banik G, Potthast A. A fluorescence labeling approach to assess the deterioration state of aged papers. Cellulose. 2006; 13:421–428. [Google Scholar]
- 48.Havermans J, Aziz HA, Scholten H. Non destructive detection of iron gall inks by means of multispectral imaging part 1: Development of the detection system. Restaurator. 2003; 24:55–60 [Google Scholar]
- 49.Povolotckaia AV, Pankin DV, Sazanova KV, Petrov YV, Kurganov NS, Mikhailova A, et al. Biodamage to paper by micromycetes under experimental conditions: a study by vibrational spectroscopy methods. Opt Spectrosc. 2019; 126:354–359. [Google Scholar]
- 50.Bensch K, Groenewald JZ, Meijer M, Dijksterhuis J, Jurjević Ž, Andersen B, et al. Cladosporium species in indoor environments. Stud Mycol. 2018; 89:177–301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Romero SM, Giudicessi SL, Vitale RG. Is the fungus Aspergillus a threat to cultural heritage? J Cult Her. 2021; 51:107–124. [Google Scholar]
- 52.Pinheiro AC, Sequeira SO, Macedo MF. Fungi in archives, libraries, and museums: a review on paper conservation and human health. Crit Rev Microbiol. 2019; 45(5–6), 686–700. doi: 10.1080/1040841X.2019.1690420 [DOI] [PubMed] [Google Scholar]
- 53.Trovão J, Portugal A. Current knowledge on the fungal degradation abilities profiled through biodeteriorative plate essays. Appl Sci. 2021; 11: e4196. [Google Scholar]
- 54.Ahmed SA, Bonifaz A, González GM, Moreno LF, Menezes da Silva N, Vicente VA, et al. Chromoblastomycosis caused by Phialophora-proven cases from Mexico. J Fungi. 2021. 7:e95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Attili-Angelis D, Duarte APM, Pagnocca FC, Nagamoto NS, De Vries M, Stielow JB, et al. Novel Phialophora species from leaf-cutting ants (tribe Attini). Fungal Divers. 2014; 65:65–75. [Google Scholar]
- 56.Feng P, Lu Q, Najafzadeh MJ, van den Ende AHGG, Sun J, Li R, et al. Cyphellophora and its relatives in Phialophora: biodiversity and possible role in human infection. Fungal Divers. 2014; 65:17–45. [Google Scholar]
- 57.Zhao J, Shi P, Luo H, Yang P, Zhao H, Bai Y, et al. An acidophilic and acid-stable β-mannanase from Phialophora sp. P13 with high mannan hydrolysis activity under simulated gastric conditions. J Agric Food Chem. 2010; 58:3184–3190. [DOI] [PubMed] [Google Scholar]
- 58.Zhao J, Shi P, Huang H, Li Z, Yuan T, Yang P, et al. (2012) A novel thermoacidophilic and thermostable endo-β-1,4-glucanase from Phialophora sp. G5: Its thermostability influenced by a distinct β-sheet and the carbohydrate-binding module. Appl Microbiol Biotechnol. 2012; 95:947–955. [DOI] [PubMed] [Google Scholar]
- 59.Borrego S, Perdomo I. Airborne microorganisms cultivable on naturally ventilated document repositories of the National Archive of Cuba. Environ Sci Pollut Res. 2016; 23:3747–3757. doi: 10.1007/s11356-015-5585-1 [DOI] [PubMed] [Google Scholar]
- 60.Herculano PN, Lima DMM, Fernandes MJS, Neves RP, Souza-Motta CM, Porto ALF. Isolation of cellulolytic fungi from waste of castor (Ricinus communis L.). Curr Microbiol. 2011; 62:1416–1422. [DOI] [PubMed] [Google Scholar]
- 61.Calvillo-Medina RP, Gunde-Cimerman N, Escudero-Leyva E, Barba-Escoto L, Fernández-Tellez EI, Medina-Tellez AA, et al. Richness and metallo-tolerance of cultivable fungi recovered from three high altitude glaciers from Citlaltépetl and Iztaccíhuatl volcanoes (Mexico). Extremophiles. 2020; 24, 625–636. [DOI] [PubMed] [Google Scholar]
- 62.Reddy MS, Murali TS, Suryanarayanan TS, Govinda Rajulu MB, Thirunavukkarasu N. Pestalotiopsis species occur as generalist endophytes in trees of Western Ghats forests of southern India. Fungal Ecol. 2016; 24:70–75. [Google Scholar]
- 63.Arfi Y, Chevret D, Henrissat B, Berrin JG, Levasseur A, Record E. Characterization of salt-adapted secreted lignocellulolytic enzymes from the mangrove fungus Pestalotiopsis sp. Nat Commun. 2013; 4:1810–1819. [DOI] [PubMed] [Google Scholar]
- 64.Koh S, Mizuno M, Izuoka Y, Fujino N, Hamada-Sato N, Amano Y. Xylanase from marine filamentous fungus Pestalotiopsis sp. AN-7 was activated with diluted salt solution like brackish water. J Appl Glycosci. 2021; 68:11–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Goukanapalle PKR, Kanderi DK, Rajoji G, Shanthi Kumari BS, Bontha RR. Optimization of cellulase production by a novel endophytic fungus Pestalotiopsis microspora TKBRR isolated from Thalakona forest. Cellulose. 2020; 27:6299–6316. [Google Scholar]
- 66.Harnpicharnchai P, Champreda V, Sornlake W, Eurwilaichitr L. A thermotolerant β-glucosidase isolated from an endophytic fungi, Periconia sp., with a possible use for biomass conversion to sugars. Protein Expr Purif. 2009; 67:61–69. [DOI] [PubMed] [Google Scholar]
- 67.Shrestha B, Kubátová A, Tanaka E, Oh J, Yoon DH, Sung JM, et al. Spider-pathogenic fungi within Hypocreales (Ascomycota): their current nomenclature, diversity, and distribution. Mycol Prog. 2019; 18:983–1003. [Google Scholar]
- 68.Borgi I, Gargouri A. A novel high molecular weight thermo-acidoactive β-glucosidase from Beauveria bassiana. Appl Biochem Microbiol. 2016; 52:602–607. [Google Scholar]
- 69.Mwamburi LA. Endophytic fungi, Beauveria bassiana and Metarhizium anisopliae, confer control of the fall armyworm, Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae), in two tomato varieties. Egypt J Biol Pest Control. 2021. 31:e7. [Google Scholar]
- 70.Sanjuan T, Tabima J, Restrepo S, Læssøe T, Spatafora JW, Franco-Molano AE. Entomopathogens of Amazonian stick insects and locusts are members of the Beauveria species complex (Cordyceps sensu stricto). Mycologia. 2014; 106:260–275. [DOI] [PubMed] [Google Scholar]
- 71.Posada F, Vega FE. Inoculation and colonization of coffee seedlings (Coffea arabica L.) with the fungal entomopathogen Beauveria bassiana (Ascomycota: Hypocreales). Mycoscience. 2006; 47: 284–289. [Google Scholar]
- 72.Kepler R, Ban S, Nakagiri A, Bischoff J, Hywel-Jones N, Owensby CA, et al. The phylogenetic placement of hypocrealean insect pathogens in the genus Polycephalomyces: An application of One Fungus One Name. Fungal Biol. 2013; 117:611–622. [DOI] [PubMed] [Google Scholar]
- 73.Ponizovskaya VB, Rebrikova NL, Kachalkin AV, Antropova AB, Bilanenko EN, Mokeeva VL. Micromycetes as colonizers of mineral building materials in historic monuments and museums. Fungal Biol. 2019; 123: 290–306. doi: 10.1016/j.funbio.2019.01.002 [DOI] [PubMed] [Google Scholar]
- 74.Watanabe M, Inoue H, Inoue B, Yoshimi M, Fujii T, Ishikawa K. Xylanase (GH11) from Acremonium cellulolyticus: Homologous expression and characterization. AMB Express. 2014; 4:1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Fujii T, Hoshino T, Inoue H, Yano S. Taxonomic revision of the cellulose-degrading fungus Acremonium cellulolyticus nomen nudum to Talaromyces based on phylogenetic analysis. FEMS Microbiol Lett. 2014; 351:32–41. [DOI] [PubMed] [Google Scholar]
- 76.Šuchová K, Puchart V, Spodsberg N, Mørkeberg Krogh KBR, Biel P. A novel GH30 xylobiohydrolase from Acremonium alcalophilum releasing xylobiose from the non-reducing end. Enzyme Microb Technol. 2020. 134: e109484. [DOI] [PubMed] [Google Scholar]
- 77.Agnihotri S, Dutt D, Tyagi CH, Kumar A, Upadhyaya JS. Production and biochemical characterization of a novel cellulase-poor alkali-thermo-tolerant xylanase from Coprinellus disseminatus SW-1 NTCC 1165. World J Microbiol Biotechnol. 2010; 26:1349–1359. [Google Scholar]
- 78.Cupul WC, Abarca GH, Vázquez RR, Salmones D, Hernández RG, Gutiérrez EA. Response of ligninolytic macrofungi to the herbicide atrazine: dose-response bioassays. Rev Argent Microbiol. 2014; 46:348–357. doi: 10.1016/S0325-7541(14)70094-X [DOI] [PubMed] [Google Scholar]
- 79.Rodríguez-Rodríguez CE, García-Galán J, Blánquez P, Díaz-Cruz MS, Barceló D, Caminal G, et al. Continuous degradation of a mixture of sulfonamides by Trametes versicolor and identification of metabolites from sulfapyridine and sulfathiazole. J Hazard Mater. 2012; 213–214:347–354. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
A. Reflectance ultraviolet photograph. B. Fluorescence ultraviolet photograph. C. Visible photograph. Surface indicate an oxidation process from the cellulose and iron, probably caused by both abiotic and biotic factors.
(PDF)
Attenuated total reflectance Fourier transform infrared spectra (ATR-FTIR) of the (A) Independence Act; (B) Political Constitution, 1949 (1991 replica); (C) Cloudy Days Act (folio 2); (D) Cloudy Days Act (folio 1); (E) Guatemalan Series 1539; and (F) Guatemalan Series 1549. Also see S1 Table.
(PDF)
A. 1539-A1P, Purpureocillium lilacinum B. 1549-1A1P, Penicillium compactum. C. 1549-4A1C, Herpotrichiellaceae. D. AI1-A1C, Cladosporium sp. E. AI3-A1P, Aspergillus hiratsukae F. CP1-A1C, Periconia sp. G. CP1-A1P, Cladosporium sp. H. CP1-A2C, Pestalotiopsis microspora I. CP1-A2P, Cladosporium sp. J. CP1-A3C, Trametes hirsuta K. CP1-A3P, Unidentified Psathyrellaceae. L. CP2-A1C, Unidentified Pleosporales. M. CP2-A1P, Purpureocillium lilacinum N. CP2-A2C, Pestalotiopsis trachycarpicola O. CP2-A2P, Coprinellus sp. P. CP2-A3C, Acremonium persicinum Q. CP2-A3P, Beauveria bassiana R. CP2-A4C, Acremonium persicinum S. CP2-A4P, Cyphellophora aff. pluriseptata. T. CP2-A5C, Penicillium sumatraense U. ND1-A1P, Penicillium steckii V. ND2-A1P, Cladosporium sp.
(PDF)
(PDF)
Measurements shown are average ± standard deviation, and minimum and maximum in parentheses.
(PDF)
Data Availability Statement
DNA sequences are deposited in GenBank under accession numbers ON479855–ON479876 (ITS), ON720280–ON720285 (TEF1), and ON734081–ON734096 (TUB2) and will be publicly available upon acceptance of manuscript. All other raw data has been deposited in GitHub: https://github.com/EEscuderoL/Fungi-with-history-Unveiling-the-mycobiota-of-historic-documents-of-Costa-Rica-Supplementary-data- and is publicly available.


