Skip to main content
ZooKeys logoLink to ZooKeys
. 2022 Sep 15;1121:175–210. doi: 10.3897/zookeys.1121.89539

Leaving no stone unturned: three additional new species of Atractus ground snakes (Serpentes, Colubridae) from Ecuador discovered using a biogeographical approach

Alejandro Arteaga 1,, Amanda Quezada 1, Jose Vieira 2, Juan M Guayasamin 3
PMCID: PMC9848674  PMID: 36760760

Abstract

The genus Atractus includes 146 species of cryptozoic snakes occurring from Panama to northeastern Argentina. Here, a molecular phylogeny of this genus is presented, which encompasses 29% (= 42; six are included here for the first time) of the species currently recognized. Morphological and phylogenetic support is found for three new species of ground snakes, which are described here based on their unique combination of molecular, meristic, and color pattern characteristics. The name A.arangoi Prado, 1939 is revalidated for a Colombian snake species previously subsumed under A.major Boulenger, 1894 based on new material collected in Ecuador. Reidentifications are provided for Atractus voucher specimens and sequences deposited in GenBank. With these changes, the number of Atractus reported in Ecuador increases from 27 to 31 species. Finally, attention is given to the importance of using a biogeographical framework that includes molecular data and a comprehensive geographic sampling when proposing species limits in complex taxonomic groups.

Keywords: Biodiversity, biogeography, Colubridae, fossorial, phylogeny, new species, taxonomy

Introduction

Atractus Wagler, 1828 is the most speciose snake genus in the world (Uetz et al. 2022). There are 146 known species, and these numbers are likely to rise with the exploration of remote mountain ranges, the use of molecular tools in Atractus systematics, and the application of a biogeographical framework when establishing limits between species.

In Ecuador, the exploration of remote mountain ranges (e.g., the Cordillera de Guacamayos, Sumaco Volcano, and the Cordillera del Cóndor) within the last two decades has resulted in the discovery of at least six species of Atractus, including the most heavy-bodied and strikingly colored in the genus (Myers and Schargel 2006; Schargel et al. 2013; Arteaga et al. 2017; Passos et al. 2018; Melo-Sampaio et al. 2021). Unlike other snake genera inhabiting the same mountain ranges (e.g., Dipsas; see Arteaga et al. 2018), snakes in the genus Atractus inhabiting remote cloud forests and inter-Andean valleys are generally considered rare. Some are known only from their type localities (e.g., A.cerberusArteaga et al., 2017) whereas for some species the males (e.g., A.atlasPassos et al., 2018) or juveniles (e.g., A.touzetiSchargel et al., 2013) have not yet been reported. All of this suggests that Atractus in general, with the exception of some locally abundant species (e.g., A.marthae Meneses-Pelayo & Passos, 2019), are difficult to find. Thus, species inhabiting poorly visited areas may remain undetected without long-term projects focused on cryptozoic herpetofauna (Myers 2003).

The use of molecular tools in Atractus systematics is also likely to increase the rate at which new species in this genus are detected and described. Only seven species of Atractus have been described using molecular data in addition to meristic and color pattern characteristics (Arteaga et al. 2017; Melo-Sampaio et al. 2019; Melo-Sampaio et al. 2021). Some of these new species were previously considered to be widespread, polychromatic, and difficult to diagnose (Savage 1960). Therefore, they probably would have never been detected using meristics and other morphological data alone. Furthermore, only approximately 30% of the current known diversity of the genus has been included in published phylogenetic analyses (i.e., Arteaga et al. 2017; Passos et al. 2022), and even a smaller percentage of the included species have been thoroughly sampled throughout their range. This lack of information presents both a challenge and an opportunity to uncover further cryptic diversity within the genus.

Finally, a mention should be made about the importance of using a biogeographical framework that includes molecular data and species distribution models (when the number and quality of locality records is sufficient for these analyses; see van Proosdij et al. 2015) when defining species limits within Atractus. Finding ground snakes along the Andes has showed us (Arteaga et al. 2013, 2017) and other authors (Savage 1955, 1960; Cisneros-Heredia 2005; Salazar-Valenzuela et al. 2014) that snakes in this genus have lower dispersal capacity than other colubrids and many species are endemic to a single mountain range or restricted to an isolated inter-Andean valley. Thus, the presence of the same Atractus species in two geographically isolated areas that are climatically and floristically distinct and are separated from each other by tens or even hundreds of kilometers of discontinuous habitat is unlikely. An example of this scenario is A.gigas Myers & Schargel, 2006, a species previously considered to be endemic to the Pacific slopes of the Andes in Ecuador (Myers and Schargel 2006; Tolhurst et al. 2010; Arteaga et al. 2013), but later reported on the Amazonian slopes of the Andes in Peru (Passos et al. 2010). Although specimens from both localities may resemble each other in lepidosis, they differ in coloration, ecological requirements, and phylogenetic affinities. More recently, without explanation, but probably based on similarities in meristics, Passos et al. (2022) proposed the reidentification of 15 specimens of Atractus having sequences deposited in GenBank. Given that some of these reidentifications involve type series and the majority of them were done without providing an explanation, their validity is evaluated in this work.

To help clear the waters of Atractus taxonomy, in this work we present a curated phylogeny of the genus, reidentify Atractus sequences in GenBank, present the description of three new species, and provide the revalidation of a taxon previously subsumed under A.major.

Materials and methods

Ethics statement

This study was carried out in strict accordance with the guidelines for use of live amphibians and reptiles in field research (Beaupre et al. 2004) compiled by the American Society of Ichthyologists and Herpetologists (ASIH), the Herpetologists’ League (HL) and the Society for the Study of Amphibians and Reptiles (SSAR). All procedures with animals (see below) were reviewed by the Ministerio del Ambiente, Agua y Transición Ecológica (MAATE) and specifically approved as part of obtaining the following field permits for research and collection: MAE-DNB-CM-2015-0017 (granted to Universidad Tecnológica Indoamérica), MAE-DNB-CM-2018-0105 and MAATE-DBI-CM-2022-0245 (granted to Universidad San Francisco de Quito), and 004-AIC-DPC-B-MAE-18 (granted to Universidad del Azuay). Specimens were euthanized with 20% benzocaine, fixed in 10% formalin or 90% ethanol, and stored in 70% ethanol. Museum vouchers were deposited at Museo de Zoología de la Universidad Tecnológica Indoamérica (MZUTI), Museo de Zoología de la Universidad San Francisco de Quito (ZSFQ), Museo de Zoología de la Universidad del Azuay (MZUA), and the herpetology collection at Bioparque Amaru (AMARU). Specimens labeled JMG were also deposited at ZSFQ.

Common names

Criteria for common name designation are as proposed by Caramaschi et al. (2006) and Coloma and Guayasamin (2011–2017), reviewed by Arteaga et al. (2019). These are as follows (in order of importance): (i) the etymological intention (implicit or explicit) that the authors used when naming the species (specific epithet); (ii) a common name that is already widely used in the scientific literature; (iii) a common name that has an important ancestral or cultural meaning; (iv) a common name based on any distinctive aspect of the species (distribution, morphology, behavior, etc.).

Morphological data

Our terminology for Atractus cephalic shields follows Savage (1960), diagnoses and descriptions generally follow Passos et al. (2009a), and ventral and subcaudal counts follow Dowling (1951). We examined comparative alcohol-preserved specimens from the herpetology collections at MZUTI, MZUA, ZSFQ, American Museum of Natural History (AMNH), Museo de Zoología de la Pontificia Universidad Católica del Ecuador (QCAZ), and Muséum National d’Histoire Naturelle (MNHN) (Table 1). Morphological measurements were taken with measuring tapes to the nearest 1 mm, or with digital calipers to the nearest 0.1 mm. Abbreviations are as follows: snout-vent length (SVL); tail length (TL). Sex was determined by establishing the presence/absence of hemipenes through a subcaudal incision at the base of the tail unless hemipenes were everted.

Table 1.

Locality data for specimens examined in this study. Coordinates represent actual GPS readings taken at the locality of collection or georeferencing attempts from gazetteers under standard guidelines, although some variation from the exact collecting locality will be present. Similarly, elevations are taken from Google Earth and may not exactly match the elevations as originally reported.

Species Voucher Country Province Locality Latitude, Longitude Elev. (m)
A.arangoi DHMECN 8343 Ecuador Sucumbíos Bloque 27 0.32271, -76.19300 264
A.arangoi ZSFQ 4947 Ecuador Napo Jatun Sacha Biological Station -1.06633, -77.61640 423
A.arangoi ZSFQ 4948 Ecuador Napo Jatun Sacha Biological Station -1.06633, -77.61640 423
A.discovery sp. nov. MZUA.RE.0466 Ecuador Morona Santiago Campamento Arenales -2.59253, -78.56507 2057
A.discovery sp. nov. ZSFQ 4936 Ecuador Azuay Amaluza -2.61583, -78.56538 2002
A.discovery sp. nov. ZSFQ 4937 Ecuador Azuay Amaluza -2.61583, -78.56538 2002
A.major MNHN 0.6149 Ecuador
A.major QCAZ 11565 Ecuador Orellana Tambococha -0.97839, -75.42569 194
A.major QCAZ 11587 Ecuador Orellana Tambococha -1.03981, -75.44849 210
A.major QCAZ 11596 Ecuador Orellana Tambococha -0.97839, -75.42569 194
A.major QCAZ 11809 Ecuador Pastaza Campo Villano B -1.45745, -77.44455 331
A.major QCAZ 4691 Ecuador Pastaza Río Sarayakillo -1.72754, -77.48048 434
A.major QCAZ 4895 Ecuador Orellana Vía Pompeya Sur-Iro -0.99307, -76.24904 246
A.major QCAZ 7881 Ecuador Sucumbíos Pañacocha -0.44791, -76.07097 240
A.major QCAZ 7896 Ecuador Orellana Vía Pompeya Sur-Iro -0.99320, -76.24907 246
A.major QCAZ 8040 Ecuador Napo Comunidad Gareno -1.04856, -77.37742 334
A.major QCAZR 11744 Ecuador Pastaza Lorocachi -1.65567, -75.96886 212
A.major ZSFQ 4955 Ecuador Morona Santiago Macas-Riobamba -2.25674, -78.16797 1148
A.michaelsabini sp. nov. AMNH 18325 Ecuador El Oro El Chiral -3.63825, -79.59723 1841
A.michaelsabini sp. nov. AMNH 22110 Ecuador El Oro La Chonta -3.56585, -79.85144 1025
A.michaelsabini sp. nov. AMNH 22111 Ecuador El Oro La Chonta -3.56585, -79.85144 1025
A.michaelsabini sp. nov. DHMECN 7644 Ecuador Azuay Reserva Yunguilla -3.22684, -79.27520 1748
A.michaelsabini sp. nov. DHMECN 7645 Ecuador Azuay Reserva Yunguilla -3.22684, -79.27520 1748
A.michaelsabini sp. nov. QCAZ 7887 Ecuador El Oro Guanazán -3.44139, -79.49417 2596
A.michaelsabini sp. nov. QCAZ 7902 Ecuador El Oro Guanazán -3.44668, -79.49051 2663
A.michaelsabini sp. nov. QCAZ 9643 Ecuador El Oro El Panecillo -3.46753, -79.48248 2775
A.michaelsabini sp. nov. QCAZ 9652 Ecuador El Oro El Panecillo -3.46753, -79.48248 2775
A.michaelsabini sp. nov. ZSFQ 4938 Ecuador Azuay Corraleja -3.38740, -79.22785 2660
A.michaelsabini sp. nov. ZSFQ 4939 Ecuador El Oro Guanazán -3.46753, -79.48248 2750
A.pachacamac ZSFQ 4954 Ecuador Morona Santiago Macas-Riobamba -2.24087, -78.27632 1644
A.resplendens ZSFQ 4953 Ecuador Tungurahua Montañas de San Antonio -1.43413, -78.40726 2655
A.resplendens ZSFQ 4952 Ecuador Tungurahua Montañas de San Antonio -1.43413, -78.40726 2655
A.resplendens ZSFQ 4951 Ecuador Tungurahua Montañas de San Antonio -1.43413, -78.40726 2655
A.roulei MNHN 1906.0243 Ecuador Chimborazo Alausí -2.20636, -78.84611 2400
A.roulei MZUA.RE.0080 Ecuador Azuay Miguir, 10 km E of -2.78771, -79.37132 2596
A.roulei MZUTI 5107 Ecuador Bolívar Above Balzapamba -1.83601, -79.13322 2026
A.roulei QCAZ 6256 Ecuador Azuay Hierba Mala -2.70430, -79.43367 2427
A.roulei ZSFQ 4943 Ecuador Chimborazo Tixán -2.16174, -78.81227 2892
A.roulei ZSFQ 4944 Ecuador Chimborazo Tixán -2.16174, -78.81227 2892
A.roulei ZSFQ 4942 Ecuador Chimborazo Tixán -2.16174, -78.81227 2892
A.roulei ZSFQ 4941 Ecuador Chimborazo Tixán -2.16174, -78.81227 2892
A.roulei ZSFQ 4940 Ecuador Chimborazo Tixán -2.16174, -78.81227 2892
A.roulei ZSFQ 4945 Ecuador Chimborazo Tixán -2.16174, -78.81227 2892
A.zgap sp. nov. ZSFQ 4946 Ecuador Napo Santa Rosa -0.31004, -77.78591 1500
A.zgap sp. nov. QCAZ 12666 Ecuador Napo Borja, 1 km NE of -0.40954, -77.84005 1703
A.zgap sp. nov. QCAZ 5183 Ecuador Napo Bosque La Cascada -0.14572, -77.49593 1460

Sampling

Tissue samples from 12 individuals representing seven species (including the three new species described here) were obtained in Ecuador. All specimens included in the genetic analyses were morphologically identified according to Savage (1960), Arteaga et al. (2017), Melo-Sampaio et al. (2021), and Arteaga et al. (2022). We generated sequence data for samples marked with an asterisk under Appendix I, which includes museum vouchers at MZUTI, MZUA, and ZSFQ.

Laboratory techniques

Genomic DNA was extracted from 96% ethanol-preserved tissue samples (liver, muscle tissue, or scales) using either a guanidinium isothiocyanate extraction protocol (Peñafiel et al. 2020), or a modified salt precipitation method based on the Puregene DNA purification kit (Gentra Systems). The nucleotide sequences of the primers and the PCR conditions applied to each primer pair are detailed in Appendix II. PCR products were cleaned with either ExoSAP-IT (Affymetrix, Cleveland, OH), or Exonuclease I and Alkaline Phosphatase (Illustra ExoProStar by GE Healthcare) before they were sent to Macrogen Inc (Seoul, South Korea) for sequencing. All PCR products were sequenced in both forward and reverse directions with the same primers that were used for amplification. The edited sequences were deposited in GenBank (Appendix I).

DNA phylogenetic analyses

A total of 274 DNA sequences were used to build a phylogenetic tree of the genus Atractus, of which 32 were generated during this work and 242 were downloaded from GenBank, most of which were produced by Arteaga et al. (2017), Melo-Sampaio et al. (2021), and Passos et al. (2022). Of these, 85 sequences are 367–516 bp long fragments of the 16S gene, 66 are 578–1,079 bp long fragments of the CYTB gene, 69 are 567–849 bp long fragments of the ND4 gene, 18 are 513–573 bp long fragments of the C-MOS gene, 19 are 386–516 bp long fragments of the NT3 gene, and 17 are 736 bp long fragments of the RAG-1 gene. New sequences were edited and assembled using the program Geneious ProTM 2021.1.1 (Drummond et al. 2021) and aligned with those downloaded from GenBank (Appendix I) using MAFFT v.7 (Katoh and Standley 2013) under the default parameters in Geneious ProTM 2021.1.1. Genes were combined into a single matrix with 16 partitions, one per non-coding gene and three per protein coding gene corresponding to each codon position. The best partition strategies along with the best-fit models of evolution were obtained in PartitionFinder 2.1.1 (Lanfear et al. 2016) under the Bayesian information criterion.

Phylogenetic relationships were assessed under both a Bayesian inference (BI) approach in MrBayes 3.2.0 (Ronquist and Huelsenbeck 2013) and a maximum likelihood (ML) approach in RAxML-NG v. 1.1.0 (Kozlov et al. 2019). For the ML analysis, nodal support was assessed using the standard bootstrapping algorithm with 1000 non-parametric bootstraps. For the BI analysis, four independent analyses were performed to reduce the chance of converging on a local optimum. Each analysis consisted of 6,666,667 generations and four Markov chains with default heating settings. Trees were sampled every 1,000 generations and 25% of them were arbitrarily discarded as ‘‘burn-in.” The resulting 5,000 saved trees per analysis were used to calculate posterior probabilities (PP) for each bipartition in a 50% majority-rule consensus tree. We used Tracer 1.7.2 (Rambaut et al. 2022) to assess convergence and effective sample sizes (ESS) for all parameters. Additionally, we verified that the average standard deviation of split frequencies between chains and the potential scale reduction factor (PSRF) of all the estimated parameters approached values of ≤ 0.01 and 1, respectively. Genetic distances between Atractusroulei Despax, 1910 and its sister species were calculated using the uncorrected distance matrix in Geneious ProTM 2021.1.1. GenBank accession numbers are listed in Appendix I.

Distribution maps and ecological niche models

We present ranges of occurrence for five species of Atractus, including the three new species described here. Presence localities are derived from museum vouchers (Table 1), photographic records (iNaturalist), and the literature (all summarized under Suppl. material 1: Table S1). For three of the five species, a binary environmental niche model (ENM) accompanies the dot maps. These models estimate potential areas of distribution on the basis of observed presences and a set of environmental predictors (Elith and Leathwick 2009). To delimit the occupancy areas and the potential species distribution, we used the BAM diagram proposal (Soberón and Peterson 2005; Peterson et al. 2011). To create the models, we used presence localities listed under Suppl. material 1: Table S1, 19 bioclimatic variables from Worldclim 1.4 (Hijmans et al. 2005), and Maxent 3.4.1k, an algorithm based on the principle of maximum entropy (Phillips et al. 2006; Elith et al. 2011; Renner and Warton 2013).

For the first explorative exercise, we used the 19 climate layers from the WorldClim project and assessed which variables were the most important for the model, according to the Jackknife test calculated in MaxEnt (Royle et al. 2012). Correlated environmental variables (r < 0.8) were identified using the PEARSON correlation test of PAST 3. In a second modelling exercise, we used the locality records for each species (Suppl. material 1: Table S1) and the variables identified in the first approach to generate the species distribution. 5,000 iterations were specified to the program with clamping and no extrapolation. All other parameters in MaxEnt were maintained at default settings. To create the binary environmental niche models, suitable areas were distinguished from unsuitable areas by setting a minimum training presence threshold value. The logistic format was used to obtain the values for habitat suitability (continuous probability from 0 to 1), which were subsequently converted to binary presence-absence values on the basis of the established threshold value, defined herein as the minimum training presence. The convergence threshold was set to 10-5, maximum iterations to 500, and the regularization parameter to “auto”.

Results

Molecular phylogeny and taxonomic consequences

Selected partitions and models of evolution are presented in Table 2. We consider strong support for a clade when Bayesian analyses yield posterior probability values > 95%, following Felsenstein (2004), or when bootstrap values are greater than 70%. The overall topology and support of the BI (Fig. 1) and ML (Suppl. material 2: Figure S1) analyses are similar to that of Arteaga et al. (2017) and Passos et al. (2022). Species of the Atractusroulei species group are sister to all other sampled Atractus in the BI analysis, a view contrary to the ML analysis and to Murphy et al. (2019), in which A.trilineatus Wagler, 1928 and A.boimirimPassos et al., 2016, respectively are recovered as sister to all other Atractus. Below, we outline some differences between our analysis and those published in Murphy et al. (2019) and Passos et al. (2022).

Table 2.

Partition scheme and models of evolution used in phylogenetic analyses. Numbers in parentheses indicate codon position.

Partition Best model Gene regions Number of aligned sites
1 GTR+I+G 16S, cytb(3), ND4(1), NT3(1) 1202
2 HKY+I+G cytb(1), ND4(2) 631
3 GTR+I+G cytb(2), ND4(3) 630
4 JC CMOS(1), NT3(3) 305
5 K80+I CMOS(2), NT3(2), RAG1(2), RAG1(3) 794
6 HKY CMOS(3), RAG1(1) 423

Figure 1.

Figure 1.

Phylogenetic relationships within Atractus inferred using a Bayesian inference and derived from analysis of 3,985 bp of DNA (gene fragments 16S, CYTB, ND4, C-MOS, NT3, and RAG1). Support values on intra-specific branches are not shown for clarity. Voucher numbers for sequences are indicated for each terminal. Black dots indicate clades with posterior probability values from 95–100%. Grey dots indicate values from 70–94%. White dots indicate values from 50–69% (values < 50% not shown). Colored clades correspond to the species’ distribution presented in the map of Fig. 2. New or resurrected species are indicated in bold type.

Atractusroulei is the strongly supported sister species of A.carrioni Parker, 1930, a relationship recovered in previous studies, but we found additional geographically structured genetic divergence within the former species (Figs 1, 2). We found moderate support for the placement of A.trilineatus as sister to A.major sensu Schargel et al. (2013), but strong support for the reciprocal monophyly between snakes assignable to A.arangoi, previously subsumed under A.major, and all other samples of A.major, including samples from throughout the species’ area of distribution. Samples labeled A.arangoi in our phylogeny are not closely related to A.torquatus (Duméril, Bibron, & Duméril, 1854), a name that has been applied to Ecuadorian specimens of the former (see Maynard et al. 2017). Our sample of A.touzetiSchargel et al., 2013 from the type locality is strongly supported as sister to the sample of A.atlasPassos et al., 2018. We found strong support for the relationship between A.resplendens Werner, 1901 from near the type locality and a new species from southeastern Ecuador. Our included samples of A.orcesi Savage, 1955 form a strongly supported sister clade to A.duboisi (Boulenger, 1880). A new species previously confused with A.ecuadorensis Savage, 1955, A.orcesi, and A.resplendens is not closely related to any of these species, but is recovered as the strongly supported sister species to a clade that contains A.ukupachaMelo-Sampaio et al., 2021, A.pachacamacMelo-Sampaio et al., 2021, A.snethlageae da Cunha & do Nascimento, 1983, A.dapsilisMelo-Sampaio et al., 2019, A.schach (Boie, 1827), and A.trefautiMelo-Sampaio et al., 2019. The latter two are sister species and their topological distance is smaller than intraspecific distances in other Atractus species sampled.

Figure 2.

Figure 2.

Distribution of Atractusarangoi, A.roulei, A.michaelsabini sp. nov., A.zgap sp. nov., and A.discovery sp. nov. in Ecuador and adjacent Colombia. White dots represent localities listed under Suppl. material 1. Each colored area is a geographic representation of the suitable environmental conditions for one of the clades recovered in the phylogeny of Fig. 1.

We find strong support for the relationship between members of the Atractusiridescens species group, which mirrors the results of Arteaga et al. (2017) and Murphy et al. (2019), and even those of Passos et al. (2022), although in the latter work some the terminals have been renamed. However, in the ML analysis (Suppl. material 2: Figure S1), A.dunni Savage, 1955 is weakly nested within A.microrhynchus Cope, 1868. Finally, we excluded A.imperfectus Myers, 2003 (voucher CH 9399) from the analyses as the short sequence available for comparison in GenBank (gene fragment 16S) represented a rogue taxon that assumed varying phylogenetic positions in the tree collection used to build the consensus tree.

Systematic accounts

We name or provide redescriptions only for species that are monophyletic in our molecular phylogeny and share diagnostic features of their coloration pattern and lepidosis. Based on these species’ delimitation criteria, which follow the general species concept of de Queiroz (2007), we describe three new species of Atractus.

. Atractus discovery sp. nov.

B4E06A0D-FC6B-5164-9B85-3AEBD85F1CE6

https://zoobank.org/0343A95C-BC4B-4654-8333-55D8A34CD2EF

Figs 3 , 4 , 5d Proposed standard english name: Discovery Ground Snake. Proposed standard spanish name: Culebra tierrera de Discovery.

Figure 3.

Figure 3.

Adult male holotype of Atractusdiscovery sp. nov. ZSFQ 4937 in a dorsal and b ventral view.

Figure 4.

Figure 4.

Head of the adult male holotype of Atractusdiscovery sp. nov. ZSFQ 4937 in a dorsal b ventral c lateral right, and d lateral left view.

Figure 5.

Figure 5.

Photographs of living specimens of brown-colored Atractus occurring along the Amazonian slopes of the Andes in Ecuador aA.arangoiZSFQ 4948 from Jatun Sacha Biological Reserve, Napo province, Ecuador bA.resplendensZSFQ 4953 from Montañas de San Antonio, Tungurahua province, Ecuador cA.duboisi from Orito Yacu, Napo province, Ecuador dA.discovery sp. nov. ZSFQ 4936 from Amaluza, Azuay province, Ecuador eA.orcesiZSFQ 2234 from El Higuerón, Sucumbíos province, Ecuador fA.pachacamac from Nangaritza, Zamora Chinchipe province, Ecuador gA.zgap sp. nov. ZSFQ 4946 from Santa Rosa, Napo province, Ecuador hA.occipitoalbus JMG-2077 from Macas, Morona Santiago province, Ecuador iA.major from Jatun Sacha Biological Reserve, Napo province, Ecuador; and jA.major from Reserva Natural Palmarí, Amazonas state, Brazil (photo by Sebastián Di Doménico).

Holotype.

ZSFQ 4937 (Figs 3, 4), adult male collected by Alejandro Arteaga and Amanda Quezada at Amaluza, Azuay province, Ecuador (S2.61582, W78.56537; 2002 m).

Paratypes.

ZSFQ 4936 (Fig. 5d), adult female collected by Alejandro Arteaga and Amanda Quezada at the type locality. MZUA.Re.466, adult female collected on 16 November 2018 at Campamento Arenales, Morona Santiago province, Ecuador (S2.59253, W78.56507; 2057 m).

Diagnosis.

Atractusdiscovery sp. nov. is placed in the genus Atractus, as diagnosed by Savage (1960), based on phylogenetic evidence (Fig. 1). The species is diagnosed based on the following combination of characters: (1) 17/17/17 smooth dorsals; (2) one postocular; (3) loreal 2.5–3 × longer than high; (4) temporals 1+2; (5) eight supralabials, fourth and fifth contacting orbit; (6) seven infralabials, first four contacting chinshields; (7) six or seven maxillary teeth; (8) one row of gular scales; (9) three preventrals; (10) 168 ventrals in the male holotype (Fig. 3b) and 170–172 ventrals in females; (11) 27 subcaudals in the male holotype and 17–18 subcaudals in females; (12) dorsal ground color light brown with faint stippling of a darker shade (Figs 3a, 5d); (13) venter yellow with a brown ventral stripe (Fig. 3b); (14) 284 mm SVL in the male holotype and 308–328 mm SVL in females; (15) 28 mm TL in the male holotype and 19–24 mm TL in females.

Comparisons.

Atractusdiscovery sp. nov. differs from most of its congeners by having a bright yellow belly with a conspicuous dark brown longitudinal stripe. This species is compared to other small brownish congeneric ground snakes distributed along the Amazonian slopes of the Andes (most of these are pictured in Fig. 5): AtractusavernusPassos et al., 2009b, A.duboisi, A.ecuadorensis, A.zgap sp. nov., A.occipitoalbus (Jan, 1862), A.orcesi, and A.resplendens. From A.avernus, A.duboisi, A.occipitoalbus, and A.orcesi, the new species differs in having 17/17/17 (instead of 15/15/15) dorsal scale rows. From A.ecuadorensis, A.zgap sp. nov., and A.resplendens, it differs in having a bright yellow belly with a conspicuous dark brown longitudinal stripe. From A.ecuadorensis and A.zgap sp. nov., it further differs by having one (instead of two) postocular scale (Fig. 4c).

Description of holotype.

Adult male, SVL 284 mm, tail length 28 mm (9.9% SVL); body diameter 7.8 mm; head length 8.8 mm (3.1% SVL); head width 5.6 mm (2.0% SVL); interocular distance 3.4 mm; head slightly distinct from body; snout-orbit distance 3.4 mm; rostral 1.6 mm wide, ca. as broad as high; internasals 0.9 mm wide; prefrontals 2.1 mm wide; frontal 2.9 mm wide, with a curvilinear triangular shape in dorsal view; parietals 2.2 mm wide, ~ 2 × as long as wide; nasal divided; loreal 2.0 mm long, ~ 3 × longer than high; eye diameter 1.1 mm; pupil round; supraoculars 1.3 mm wide; one postocular; temporals 1+2, upper posterior temporal elongate; eight supralabials, fourth and fifth contacting orbit; symphysial 1.0 mm wide, ~ 2 × as broad as long and separated from chinshields by first pair of infralabials; seven infralabials, first four contacting chinshields; chinshields ~ 2 × as long as broad, posterior chinshields absent; four rows of gular scales; dorsal scales arranged in 17/17/17 rows, smooth without apical pits; two preventrals; ventrals 168; anal plate single; 27 paired subcaudals.

Natural history.

The three known specimens of Atractusdiscovery sp. nov. were found in open areas adjacent to cloud forest border. MZUA.Re.466 was crawling at ground level at around 7:30 pm. It was crossing a series of cement stairs. ZSFQ 4936 and ZSFQ 4937 were found during a cloudy day, buried 15–40 cm under soft soil at the border between the clearing of a graveyard, pastures, and remnants of native vegetation.

Distribution.

Atractusdiscovery sp. nov. is known only from two localities (Arena­les and Amaluza, listed under Suppl. material 1: Table S1) on each side of the Río Paute, in the Ecuadorian provinces Azuay and Morona Santiago, at elevations 2002–2057 m a.s.l. The airline distance between the two localities is 2.6 km (Fig. 2).

Etymology.

The specific epithet discovery is used as a noun in apposition and honors ‘The Explorers Club Discovery Expedition Grants’ (https://www.explorers.org/grants) initiative, a program seeking to foster scientific understanding for the betterment of humanity and all life on Earth and beyond. The grant program supports researchers and explorers from around the world in their quest to mitigate climate change, prevent the extinction of species and cultures, and ensure the health of the Earth and its inhabitants. ‘The Explorers Club Discovery Expedition Grants’ program funded the expedition that resulted in the discovery of this new species of snake.

Conservation status.

We consider Atractusdiscovery sp. nov. to be Data Deficient, following IUCN Red List criteria, because the species belongs to a poorly studied genus of snakes and is known only from three specimens collected recently in a single river valley (Río Paute) in the Amazonian slopes of the Ecuadorian Andes. In addition to the presence of a system of major hydroelectric dams in this valley, most of the native cloud forest habitat in the segment between Amaluza and Arenales has been converted to pastures. However, we consider there is insufficient data to estimate whether this new snake species is restricted to the immediate environs of the type locality or if it is widely distributed along the unexplored cloud forests of the adjacent Sangay National Park.

. Atractus zgap sp. nov.

A21843AD-A6ED-5B1E-8FE0-46349F312062

https://zoobank.org/A9A58D40-CF58-4267-A691-B5E776B43C1B

Figs 5g , 6 , 7 Proposed standard English name: ZGAP Ground Snake. Proposed standard Spanish name: Culebra tierrera de ZGAP.

Figure 6.

Figure 6.

Adult female holotype of Atractuszgap sp. nov. ZSFQ 4946 in a dorsal and b ventral view.

Figure 7.

Figure 7.

Head of the adult female holotype of Atractuszgap sp. nov. ZSFQ 4946 in a dorsal b ventral c lateral right, and d lateral left view.

Holotype.

ZSFQ 4946 (Figs 5g, 6, 7), adult female collected by Diego Piñán at Santa Rosa, Napo province, Ecuador (S0.31004, W77.78591; 1500 m).

Paratypes.

MZUTI 5311, adult female collected by Diego Piñán in February 2017 at El Chaco, Napo Province, Ecuador (S0.31004, W77.78591; 1500 m). QCAZ 12666, a juvenile collected by Pablo Medrano on 16 May 2014 at San Francisco de Borja, Napo province, Ecuador (S0.40953, W77.84005; 1703 m). QCAZ 5183, a juvenile collected by Patricia Bejarano on 13 November 2011 at Bosque Protector “La Cascada,” Napo province, Ecuador (S0.14572, W77.49593; 1460 m).

Diagnosis.

Atractuszgap sp. nov. is placed in the genus Atractus, as diagnosed by Savage (1960), based on phylogenetic evidence (Fig. 1). The species is diagnosed based on the following combination of characters: (1) 17/17/17 smooth dorsals; (2) two postoculars; (3) loreal 2 × longer than high; (4) temporals 1+2; (5) seven supralabials, third and fourth contacting orbit; (6) seven infralabials, first three contacting chinshields; (7) seven maxillary teeth; (8) three rows of gular scales; (9) two or three preventrals; (10) 173–177 ventrals in females; (11) 31 subcaudals in an uncollected male and 25–27 subcaudals in females; (12) dorsal ground color brown with faint dark longitudinal lines (Figs 5g, 6a); (13) venter yellow with fine brown stippling (Fig. 6b); (14) 376 mm SVL in the female holotype; (15) 37 mm TL in the female holotype.

Comparisons.

Atractuszgap sp. nov. is compared to other small brownish congeneric ground snakes distributed along the Amazonian slopes of the Andes (most of these are illustrated in Fig. 5): Atractusavernus, A.duboisi, A.discovery sp. nov., A.ecuadorensis, A.occipitoalbus, A.orcesi, and A.resplendens. From A.avernus, A.duboisi, A.occipitoalbus, and A.orcesi, the new species differs in having 17/17/17 dorsal scale rows. From A.discovery sp. nov., the new species differs in having two postocular scales (Fig. 7c) and no dark ventral stripe. From A.ecuadorensis, the new species differs in having fewer (31 instead of 41) subcaudals in males, seven (instead of five or six) infralabials, a shorter (2 × instead of 3 × longer than high) loreal, frontal longer than prefrontals, and five faint (instead of six or seven clearly defined) longitudinal black lines (Figs 5g, 6). From A.resplendens, the new species differs in having a shorter (2 × instead of 3 × longer than high) loreal, two (instead of one) postoculars, and a brownish dorsum with faint longitudinal black lines, whereas in A.resplendens the dorsum is dark gray with fine yellow stippling (Fig. 5b).

Description of holotype.

Adult female, SVL 376 mm, tail length 37 mm (9.8% SVL); body diameter 9.1 mm; head length 11.7 mm (3.1% SVL); head width 6.4 mm (1.7% SVL); interocular distance 4.3 mm; head slightly distinct from body; snout-orbit distance 3.8 mm; rostral 2.5 mm wide, ca. as broad as high; internasals 1.3 mm wide; prefrontals 2.5 mm wide; frontal 3.1 mm wide, with a curvilinear triangular shape in dorsal view; parietals 2.4 mm wide (56% length); nasal divided; loreal 1.6 mm long, ~ 2 × longer than high; eye diameter 1.7 mm; pupil round; supraoculars 1.2 mm wide; two postoculars; temporals 1+2; seven supralabials, third and fourth contacting orbit; symphysial 1.7 mm wide, ~ 2 × as broad as long, separated from chinshields by first pair of infralabials; seven infralabials, first three contacting chin shields; chinshields ~ 2 × as long as broad, posterior chinshields absent; dorsal scales arranged in 17/17/17 rows, smooth without apical pits; two preventrals; ventrals 173; anal plate single; 25 paired subcaudals.

Natural history.

Most individuals of Atractuszgap sp. nov. have been found during the day hidden under rocks, among herbs, or buried under soft soil in plantations and rural gardens close to remnants of native forest. At night, they have been seen crossing rural roads. Occasionally, during sunny days right after a rain, individuals have been seen crawling on the pavement or on gravel roads (Diego Piñán, pers. comm.).

Distribution.

Atractuszgap sp. nov. is known only from five localities (See Suppl. material 1: Table S1) along the valley of the Río Quijos, Napo province, in the Amazonian slopes of the Andes in northeastern Ecuador, at elevations 1460–1703 m a.s.l. (Fig. 2).

Etymology.

The specific epithet zgap is used as a noun in apposition and honors the ‘Zoological Society for the Conservation of Species and Populations’ (ZGAP) (https://www.zgap.de), a program seeking to conserve unknown but highly endangered species and their natural habitats throughout the world. The ZGAP grant program supports the fieldwork of young scientists who are eager to implement and start conservation projects in their home countries. Specifically, ZGAP has supported the work on endangered Andean reptiles in Ecuador conducted by AA and JV.

Conservation status.

We consider Atractuszgap sp. nov. to be Endangered following the IUCN criteria B2a, b (i, iii) (IUCN 2001), because the species’ extent of occurrence is estimated to be less than 500 km2 (Fig. 2) and its habitat is severely fragmented and declining in extent and quality due to deforestation. The valley of the Río Quijos formed the eastern frontier of the Incan Empire (1400–1532) and the cloud forest in the area suffered from intensive land-use even before European arrival (Loughlin et al. 2018). Today, this valley is one of the most important cattle farming areas along the eastern slopes of the Andes and the majority of the forest along the Quijos river plains has been destroyed. Although A.zgap occurs in one protected area (Bosque Protector “La Cascada”) and its presence is expected in adjacent Parque Nacional Cayambe-Coca and Parque Nacional Sumaco Napo-Galeras, it has so far not been recorded in major protected areas.

. Atractus michaelsabini sp. nov.

40F34958-F8F5-5BD7-9218-C051526D04A4

https://zoobank.org/E85C68A2-DAEF-4BC5-A6B3-6D1FEDEB9983

Figs 8 , 9 , 10f–h Proposed standard English name: Michael Sabin’s Ground Snake. Proposed standard Spanish name: Culebra tierrera de Michael Sabin.

Figure 8.

Figure 8.

Adult male holotype of Atractusmichaelsabini sp. nov. ZSFQ 4938 in a dorsal and b ventral view.

Figure 9.

Figure 9.

Head of the adult male holotype of Atractusmichaelsabini sp. nov. ZSFQ 4938 in a dorsal b ventral c lateral right, and d lateral left view.

Figure 10.

Figure 10.

Photographs of living specimens of Atractusroulei and A.michaelsabini sp. nov. aA.rouleiZSFQ 4942 from Tixán, Chimborazo province, Ecuador bA.rouleiZSFQ 4944 from Tixán, Chimborazo province, Ecuador cA.rouleiZSFQ 4941 from Tixán, Chimborazo province, Ecuador dA.rouleiZSFQ 4945 from Tixán, Chimborazo province, Ecuador eA.roulei from Tixán, Chimborazo province, Ecuador fA.michaelsabini sp. nov. AMARU 002 from Corraleja, Azuay province, Ecuador gA.michaelsabini sp. nov. holotype ZSFQ 4938 from Corraleja, Azuay province, Ecuador and hA.michaelsabini sp. nov. ZSFQ 4939 from El Panecillo, El Oro province, Ecuador.

Holotype.

ZSFQ 4938 (Figs 8, 9, 10g), adult male collected by Jorge Luis Romero at Corraleja, Azuay province, Ecuador (S3.3874, W79.22785; 2660 m).

Paratypes.

MZUTI 5289, adult female collected by Jorge Luis Romero at the type locality. AMARU 002 (Fig. 10f), adult female collected by Jorge Luis Romero at the type locality. ZSFQ 4939 (Fig. 10h), juvenile female collected by Jose Vieira and Amanda Quezada at El Panecillo, El Oro province, Ecuador (S3.46753, W79.48248; 2750 m). QCAZ 7887 and 7902, adult male and female collected by Silvia Aldás in December 2006 at Guanazán, El Oro province, Ecuador (S3.44667, W79.49051; 2663 m). QCAZ 9643 and 9652, adult females collected by Silvia Aldás in August 2009 at El Panecillo, El Oro province, Ecuador (S3.46753, W79.48248; 2775 m). DHMECN 7644–45, adult males collected by Mario Yánez-Muñoz, Luis Oyagata, Patricia Bejarano, and Marco Altamirano in March 2010 at Reserva Biológica Yunguilla, Azuay province, Ecuador (S3.22684, W79.27520; 1748 m). AMNH 18325, adult female collected in July 1920 at El Chiral, El Oro province, Ecuador (S3.63825, W79.59723; 1841 m). AMNH 22110–11, collected in August 1921 at La Chonta, El Oro province, Ecuador (S3.56585, W79.85144; 1025 m).

Diagnosis.

Atractusmichaelsabini sp. nov. is placed in the genus Atractus, as diagnosed by Savage (1960), based on phylogenetic evidence (Fig. 1). The species is diagnosed based on the following combination of characters: (1) 15/15/15 smooth dorsals; (2) one postocular; (3) loreal 3 × longer than high; (4) temporals 1+2; (5) five or six supralabials, with (usually) third and fourth contacting orbit; (6) five or six infralabials, with (usually) first three contacting chinshields; (7) 9–13 maxillary teeth; (8) 1–3 rows of gular scales; (9) 1–3 preventrals; (10) 143–144 ventrals in males and 144–153 in females; (11) 24–31 subcaudals in males and 17–19 in females; (12) dorsal ground color golden yellow (Figs 8, 10f–g) to dark brown (Fig. 10h) with each scale outlined in black, forming a reticulation; (13) venter yellowish with various degrees of brown stippling (Fig. 8b); (14) 256–321 mm SVL in males and 201–392 mm SVL in females; (15) 35–42 mm TL in males and 21–37 mm TL in females.

Comparisons.

Atractusmichaelsabini sp. nov. is compared to other members of the A.roulei species group: Atractuscarrioni and A.roulei. From A.carrioni, the new species differs in having a loreal scale (Fig. 9c) (absent in A.carrioni). From A.roulei (Figs 10a–e), the new species differs in having a dorsal pattern in which each scale is outlined in a thin black line, thus creating a reticulation, and by having the prefrontal scale in broad contact with the postnasal (Fig. 9c) (not in contact or barely in contact in A.roulei). Furthermore, the existence of the bright golden yellow morph in adult individuals has so far been recorded only in A.michaelsabini sp. nov.; not in A.roulei, where adults are dark brown dorsally (Fig. 10a–e). In A.roulei, there is a black spot at the base of each dorsal scale, whereas in A.michaelsabini sp. nov. the spot is at the tip of each dorsal scale and is connected to the black reticulum. Genetic divergence in a 578 bp long fragment of the mitochondrial CYTB gene between A.michaelsabini sp. nov. and A.roulei is 6.5–7.2%, whereas intraspecific distances are 0–4.5% in A.michaelsabini sp. nov. and 0–4.8% in A.roulei.

Description of holotype.

Adult male, SVL 256 mm, tail length 39 mm (15.2% SVL); body diameter 7.4 mm; head length 10.7 mm (3.1% SVL); head width 6.4 mm (2.5% SVL); interocular distance 3.7 mm; head slightly distinct from body; snout-orbit distance 3.5 mm; rostral 1.9 mm wide, ca. as broad as high; internasals 1.0 mm wide; prefrontals 2.0 mm wide; frontal 3.0 mm wide, with a curvilinear triangular shape in dorsal view; parietals 2.9 mm wide (65% length); nasal divided; loreal 2.2 mm long, ~ 3 × longer than high; eye diameter 1.4 mm; pupil round; supraoculars 1.3 mm wide; one postocular; temporals 1+2; five supralabials, third contacting orbit; symphysial 1.7 mm wide, ~ 3 × as broad as long, separated from chinshields by first pair of infralabials; five infralabials, first three contacting chinshields; chinshields ~ 2 × as long as broad, posterior chinshields absent; dorsal scales arranged in 15/15/15 rows, smooth without apical pits; no preventrals; ventrals 143; anal plate single; 31 paired subcaudals.

Natural history.

Most individuals of Atractusmichaelsabini sp. nov. have been found during the day hidden under rocks, mats of rotten vegetation, or buried in soft soil in pastures and maize plantations close to remnants of native forest. At night, they have been seen crossing forest trails. At the type locality, clutches of three or four eggs have been found under soil (Jorge Luis Romero, pers. comm.). Anecdotal information suggests that these snakes are more active during the rainy months (February-May at the type locality; Jorge Luis Romero, pers. comm.).

Distribution.

Atractusmichaelsabini sp. nov. is endemic to an estimated 2,530 km2 area along the Pacific slopes of the Andes in southwestern Ecuador. The species occurs in the xeric inter-Andean valley of the Río Jubones as well as on the slopes of the Cordillera de Chilla. Atractusmichaelsabini sp. nov. is known from provinces Azuay, El Oro, and Loja, and has been recorded at elevations between 927 and 2922 a.s.l. (Fig. 2).

Etymology.

The specific epithet michaelsabini is a patronym honoring a young nature lover, Michael Sabin, grandson of American philanthropist and conservationist Andrew “Andy” Sabin. The Sabin family is involved in conservation and field research of amphibians and reptiles and has protected over 264,365 acres of critical habitat throughout the world.

Conservation status.

We consider Atractusmichaelsabini sp. nov. to be Endangered following the IUCN criteria B1a, b (i, iii) (IUCN 2001), because the species’ extent of occurrence is estimated to be much less than 5,000 km2 (Fig. 2) and its habitat is severely fragmented and declining in extent and quality due to deforestation. Although A.michaelsabini sp. nov. is present in two protected areas (private reserves Buenaventura and Yunguilla of Fundación Jocotoco), nine of the 14 localities where the species has been recorded (Suppl. material 1: Table S1) are in heavily human-modified areas. Based on maps of Ecuador’s vegetation cover (MAE 2012), we estimate that nearly 70% of the forest cover throughout the species’ potential distribution area has been destroyed, mostly due to the expansion of the agricultural frontier.

Distribution maps

Our resulting distribution maps increase the number of known localities of occurrence for the studied taxa (listed under Suppl. material 1: Table S1) and show a distinct geographical separation between Atractusroulei and A.michaelsabini sp. nov. (Fig. 2). The predicted area of suitable habitat for A.michaelsabini sp. nov. includes the upper watershed of the Río Jubones (a xeric inter-Andean valley) as well as both slopes of the Cordillera de Chilla (an area having vegetation classified as evergreen montane forest; see Sierra 1999). Likewise, the predicted area of suitable habitat for A.roulei includes evergreen montane forests along the Pacific slopes of the Andes as well as the xeric inter-Andean valley of the upper Río Chanchán. The predicted area of suitable habitat for A.arangoi includes almost the entire extent of Pastaza province, although we did not find records of this species from this province. Although we did not build binary environmental niche models for A.discovery sp. nov. and A.zgap sp. nov. (only two and six localities are available for these species), they are both known only from their corresponding river valleys and occur on both sides of the Río Paute and Río Quijos, respectively.

Revalidation of Atractusarangoi

Prado (1939) described Atractusarangoi from Colombia whereas Daniel (1949) reported this species in Puerto Asís, Putumayo department. Schargel et al. (2013) considered A.arangoi to be a junior synonym of A.major claiming that all the putative diagnostic characters for A.arangoi fall within the variation in A.major as defined in their work. In our phylogenetic tree of Atractus (Fig. 1), we included sequences of three snakes that fit the original description of A.arangoi. DHMECN 8343 (reported as A.major in Arteaga et al. 2017), ZSFQ 4947 (Fig. 11), and ZSFQ 4948 (Fig. 5a). These three specimens form a strongly supported clade sister to all other samples of A.major, which includes specimens from throughout the latter species’ area of distribution. Furthermore, we find that these specimens, in addition to others reported in the literature as A.torquatus and A.major (see Duellman 1978; Maynard et al. 2017) can easily be separated from A.major based on differences in coloration, body size (compare Figs 5a and 5i, j), and ventral and subcaudal counts (summarized in Table 3), as originally suggested by Prado (1939). Thus, we formally remove A.arangoi from the synonymy of A.major, include this species in the herpetofauna of Ecuador, and provide a distribution map for this species (Fig. 2).

Figure 11.

Figure 11.

Adult male of AtractusarangoiZSFQ 4947 in a dorsal and b ventral view.

Table 3.

Differences in coloration, scale counts, and size between Atractusarangoi and A.major. The range of each continuous variable is from our own sample, Prado (1939), and Maynard et al. (2017). The numbers in parentheses represent the sample size.

Variable character Atractusarangoi Atractusmajor
Dark brown or black nape stripe Absent Present
Dorsal markings Irregular dark blotches Complete irregular dark bands anteriorly; blotches posteriorly
Sex Males (n = 2) Females (n = 2) Males (n = 7) Females (n = 5)
Maximum SVL 309 mm 412 mm 533 mm 986 mm
Ventral scales 154–163 160–161 162–165 172–177
Subcaudal scales 38–39 29–32 36–45 34–37

Presence of Atractusgigas in Peru

Passos et al. (2010) reported Atractusgigas, a snake species previously considered to be endemic to the cloud forests of northwestern Ecuador (Myers and Schargel 2006), on the Amazonian slopes of the Andes in Peru. The identification of the Peruvian specimens as A.gigas was based on their large size and the partial overlap in some characters of lepidosis with the Ecuadorian samples. However, these Peruvian snakes have a smaller number of subcaudals (25 or 26 instead of 31–37 in Ecuadorian specimens), a shorter loreal scale, first four infralabials contacting chinshields (instead of first three in Ecuadorian specimens), and a completely different color pattern in both juveniles and adults (for a figure depicting the variation among Ecuadorian individuals see Arteaga 2022). Juveniles of “A.gigas” from Peru have a black dorsum with short (one scale wide) reddish brown bands whereas juveniles of Ecuadorian A.gigas have a contrasting pattern of dark-brown to black rounded bands or blotches on a rosy white background color. Adults of “A.gigas” from Peru have a dorsal pattern in which each scale is dark brown distally but cream towards the base, forming a reticulation. Adults of A.gigas from Ecuador are uniformly rich dark brown or glossy black, and the skin between the scales is whitish (Arteaga 2022). QCAZ 14946, a specimen identified as A.atlas in Melo-Sampaio et al. (2021) from Reserva Biológica Cerro Plateado, just 7 km from the Peruvian border on the southeastern slopes of the Ecuadorian Andes, resembles Peruvian “A.gigas” as depicted in Passos et al. (2010) in having a short loreal, dorsal scales with a cream base, first four infralabials contacting chinshields, and fewer than 30 subcaudals. This specimen was included in our phylogeny (Fig. 1) and was recovered as the strongly supported sister taxon to a new sample of A.touzeti from this species’ type locality. Based on this evidence, we suggest that Peruvian specimens CORBIDI 877 and ZFMK 89147, as well as other Atractus specimens from Cajamarca labeled as A.gigas, be reidentified as A.atlas, or at the very least, be considered as an undescribed species related to the latter. Thus, we suggest A.gigas be removed from the herpetofauna of Peru, a view that confirms this species as endemic to the cloud forests of northwestern Ecuador as originally suggested by Myers and Schargel (2006) and Arteaga et al. (2013).

Status of Atractusoccidentalis and reidentification of specimens of Atractus of the iridescens group

In his unpublished BSc thesis, Mejía Guerrero (2018) used species distribution models, a comprehensive (based on 88 specimens) comparison of scale counts, and species delimitation analysis based on a combination of novel DNA sequences and those provided in Arteaga et al. (2017) to test species limits within the Atractusiridescens species group. He proposed that A.occidentalis Savage, 1955 is a junior synonym of A.microrhynchus and that some individuals identified as A.dunni from Mindo are actually A.microrhynchus. The topology for the included members of the A.iridescens group in our BI phylogeny (Fig. 1) and that of Murphy et al. (2019), though not identical, agree with the proposal of Mejía Guerrero (2018). Based this evidence, we also consider A.occidentalis to be a junior synonym of A.microrhynchus. Recently, Passos et al. (2022) provided a list of reidentifications of 15 (not 17, because two are duplicates and MZUTI 4178 retained the same identification despite being listed in the table) Atractus specimens having sequences deposited in GenBank, notably among them the members of the A.iridescens species group deposited in MZUTI and DHMECN. In this work, one reidentification (that of the holotype of A.pyroni; MZUTI 5107) was backed up by ample evidence and two others (ANF 2390, now MZUTI 5409; and GFM 307, now MPEG 21582) were substantiated in Melo-Sampaio et al. (2021), but the remaining were proposed without providing any evidence, either in the form of new phylogenetic relationships, new scale counts, or previously unsampled morphological features. Since these specimens are deposited at MZUTI and DHMECN, as well as their corresponding photo vouchers available in Arteaga et al. (2017), and their DNA sequences on GenBank, their identity can be tested by anyone. Although the reidentification of the remaining specimens provided by Passos et al. (2022) was unsubstantiated, not all of them were unwarranted (see Table 4). We agree that DHMECN 7644 (identified as A.lehmanni Boettger, 1898 in Arteaga et al. 2017) and IBSP 71932 (identified as A.zebrinus Jan, 1862 in Grazziotin et al. 2012) are misidentified, but their new identifications provided by Passos et al. (2022) are not correct either (see Table 4). DHMECN 7644 is a paratype of A.michaelsabini sp. nov., as defined herein, and IBSP 71932 is probably an A.trihedrurus Amaral, 1926, not an “A.triherurus.” Although the latter probably represents a typo and is a minor error, the problems with the remaining reidentifications are not trivial. For example, Passos et al. (2022) reidentified the same specimen, MZUTI 3758, as A.iridescens Peracca, 1896 and also as A.cf.iridescens. Additionally, these authors completely reidentified the type series of both A.cerberus and A.esepeArteaga et al., 2017, probably without much confidence since this action is not explained elsewhere in their work and is not trivial. Since MZUTI 4330 and MZUTI 3758 are name-bearing specimens, reidentification of these holotypes as A.iridescens, A.cf.iridescens, or anything other than their original identification presented in Arteaga et al. (2017) implies that these species are not valid. Surprisingly, the fact that the taxonomic validity of these two species is not questioned elsewhere in Passos et al. (2022) suggests that some of these reidentifications were proposed carelessly. Thus, in Table 4, we evaluate these reidentifications and mention whether they are substantiated or warranted or neither. Finally, we propose the reidentification of an additional six Atractus specimens (Table 5) having sequences deposited in GenBank based on the results presented in Fig. 1.

Table 4.

Reidentification of Atractus specimens reidentified in Passos et al. 2022 based on direct examination of voucher specimens.

Voucher Original identification (Arteaga et al. 2017) Proposed reidentification (Passos et al 2022) Reidentification warranted and substantiated Identification
MZUTI 4330 Atractuscerberus Atractuscf.iridescens No Atractuscerberus
MZUTI 1385, 2649–50, 3323 Atractusoccidentalis Atractusdunni No Atractusmicrorhynchus
MZUTI 3758–59 Atractusesepe Atractuscf.iridescens and A.iridescens No Atractusesepe
MZUTI 4178 Atractusiridescens Atractusiridescens Identity remained the same, but listed as “reidentified” Atractusiridescens
MZUTI 4122 Atractusmicrorhynchus Atractusiridescens No Atractusmicrorhynchus
DHMECN 7644 Atractuslehmanni Atractusroulei Warranted at time of publication Atractusmichaelsabini sp. nov.
MZUTI 5109 Atractusmicrorhynchus Atractusdunni No Atractusmicrorhynchus
MZUTI 5107 Atractuspyroni Atractusroulei Yes Atractusroulei
ANF 2390 Atractustouzeti Atractuspachacamac Yes Atractuspachacamac
GFM 307 Atractusschach Atractussnethlageae Yes Atractussnethlageae
IBSP 71932 Atractuszebrinus Atractustriherurus Yes, but name misspelled Atractustrihedrurus

Table 5.

Reidentification of Atractus sequences available in GenBank based on direct examination of voucher specimens.

Voucher GenBank accession numbers Identity in GenBank Identification
DHMECN 8343 KY610059, KY610105 Atractusmajor Atractusarangoi
QCAZ 7887 MT507872, MT511989 Atractusroulei Atractusmichaelsabini sp. nov.
QCAZ 7889 MT507874, MT511990 Atractusroulei Atractusmichaelsabini sp. nov.
QCAZ 9643 MT507875, MT511981, MT511991 Atractusroulei Atractusmichaelsabini sp. nov.
QCAZ 9652 MT507876, MT511992 Atractusroulei Atractusmichaelsabini sp. nov.
MHUA 14368 GQ334664, GQ334581, GQ334558, GQ334480 Atractuswagleri Atractuslasallei

Discussion

Atractus is perhaps the most taxonomically complex snake genus and the work needed to elucidate its evolutionary relationships is just starting. Achieving a comprehensive understanding of the real diversity within this cryptozoic group of snakes will require an approach combining three actions: 1) improving the taxon sampling available for comparison at the molecular level; 2) re-sampling type localities as well as exploring new remote areas; and 3) defining species boundaries among Atractus species using an integrative taxonomic approach, not only scale counts. Below, we discuss how our results help clear the waters in Atractus taxonomy and provide insights on where future research efforts might be most effective.

The molecular phylogenies presented here (Fig. 1 and Suppl. material 2: Fig. S1) include only approximately 30% of the total known diversity of the genus Atractus; thus, many higher-level relationships within species groups are still unknown. The placement of A.trilineatus as sister to a clade containing A.arangoi and A.major, rather than as an early divergent Atractus species (Murphy et al. 2019) is puzzling, but this relationship is moderately supported in both the BI and ML analyses and will likely benefit from an improved sampling of molecular characters. Atractusarangoi is supported as a valid species in our molecular analyses and is easily diagnosable from A.major based on body size, coloration, and lepidosis (Table 3), confirming its status as a valid species (Prado 1939; Daniel 1949). With the exception of the weakly placed A.zidoki Gasc & Rodrigues, 1979, we found that cis-Andean species of Atractus are more closely related to other cis-Andean species, whereas trans-Andean ground snakes are more closely related to other trans-Andean species. This finding may prove useful in understanding why the presence of the same Atractus species on both sides of the Andes, a scenario suggested for A.gigas by Passos et al. (2010), is unlikely.

There is a clade formed by the remaining Ecuadorian Atractus that were included in the phylogeny and are distributed along the Amazonian slopes of the Andes. The new species, A.discovery sp. nov. and A.zgap sp. nov., are included in this group. While the former is the strongly supported sister species to A.resplendens, it has a coloration pattern most similar to A.orcesi (Fig. 5e), a species not previously included in any phylogenetic analyses and characterized by having a yellow belly with a black ventral stripe. The black stripe on a yellow belly is a characteristic shared by A.duboisi, A.discovery sp. nov., and A.orcesi, but is absent from A.resplendens and A.ecuadorensis (the other two members of the group) and confirms this as a useful character in diagnosing species within this clade. In the ML analysis (Suppl. material 2: Figure S1), A.dunni is nested within A.microrhynchus, a topology not recovered in the BI phylogeny or in previous analyses despite being based on the same DNA sequences. We believe this incongruence is the result of character sampling and methodological approach instead of these two species being conspecific. The phylogenetic position of A.zgap sp. nov., a snake most similar to A.ecuadorensis in size, coloration, and lepidosis, as sister to a clade of banded Amazonian Atractus rather than to A.ecuadorensis is puzzling. Although the placement of A.zgap sp. nov. in both the BI and ML analyses is strongly supported and is probably correct, we do not have as much confidence in the position of A.ecuadorensis and this may be explained by the fact that only one gene fragment (ND4) was available for the latter species (Appendix I). We found higher intraspecific topological distances between members of A.carrioni, A.major, and A.roulei than between the pair of species A.trefauti-A.schach. Therefore, attention should be given to reevaluating the validity of these species.

The binary environmental niche models (Fig. 2) for both Atractusmichaelsabini sp. nov. and A.roulei include xeric inter-Andean valleys where populations of these snakes are known to occur, even though elsewhere these species inhabit humid areas where the dominant vegetation cover is evergreen montane forest (Sierra 1999). We found that the deep intraspecific genetic divergence found within both of these taxa corresponds to the sampling of populations distributed on different bioclimatic regimes (i.e., snakes of xeric habitats are genetically distinct from snakes of humid habitats). Although we did not find morphological differences that would allow the distinction of these subpopulations, we do not rule out the possibility that they correspond to cryptic species diversity.

In addition to creating a more robust phylogenetic tree of ground snakes, one of the most important actions in the quest towards a more clear, stable, and useful Atractus taxonomy is the correct identification of museum specimens. Based on our review of the reidentifications proposed in Passos et al. (2022), it is evident that reassigning the species identities of museum vouchers is not a trivial pursuit. On the contrary, it has consequences that go beyond taxonomy. For example, reidentifying the only known museum specimens of the Critically Endangered A.cerberus as A.iridescens, a Least Concern species, implies that the population of this species in the isolated Pa­coche forest of west-central Ecuador is not as unique and worthy of conservation efforts. It also implies that the presence of a species endemic to the humid Chocó rainforest in an isolated mountain range belonging to another biogeographic province is likely.

The last point on biogeography deserves elaboration. The use of species distribution models can be used not only to discover and test biogeographical patters but also to test species as hypotheses (Ahmadzadeh et al. 2013; Ortega-Andrade et al. 2015). The elaboration of distribution maps using ecological variables, in addition to the presentation of accurate color photographs of specimens and their corresponding genetic information as a part of an integrative taxonomic approach can greatly benefit Atractus taxonomy, a branch of herpetology in which diagnoses have largely been based only on meristics (Savage 1960; Passos et al. 2009c; Passos et al. 2010). Using this framework can help prevent Atractus species that are valid taxa and occur in distinct biogeographical provinces to be subsumed under the same name on the basis of overlapping scale counts. An example of this are the snakes A.gigas and A.dunni, two cloud forest species endemic to the Pacific slopes of the Andes in northwestern Ecuador. These snakes present a biogeographic pattern of distribution shared by other co-occurring reptiles (Avila Pires 2001; Köhler et al. 2004; Arteaga et al. 2013; Torres-Carvajal and Lobos 2014; Arteaga et al. 2016). Given how narrow the climatic requirements of these two Atractus species are (Mejía Guerrero 2018; Mantilla Espinoza 2021), their presence on the Amazonian slopes of the Andes, or on the Chocoan lowlands, as suggested by Passos et al. (2010) and Passos et al. (2022), respectively, is unlikely. In this work, we presented evidence that supports the status of A.gigas and A.dunni as species endemic to the cloud forests of the Pacific slopes of the Andes in northwestern Ecuador.

Finally, although Atractus systematics have progressed greatly since Savage published his monograph on the Ecuadorian members of this genus in 1960, many “stones are still left unturned.” The Ecuadorian species A.clarki Dunn & Bailey, 1939, A.collaris Peracca, 1897, A.gaigeae Savage, 1955, and A.occipitoalbus have not been included in a phylogenetic work, and their status remains uncertain. Also, an overwhelming majority of Atractus diversity, both described and undescribed, is in Colombia (Uetz et al. 2022). Unfortunately, only one or two samples of Atractus coming from Colombia have been included in published phylogenetic trees of this genus (Arteaga et al. 2017; Murphy et al. 2019; Melo-Sampaio et al. 2021, Passos et al. 2022). Thus, we suggest that future work on Atractus be focused on unveiling the incredible diversity of this genus in Colombia.

Supplementary Material

XML Treatment for Atractus discovery
XML Treatment for Atractus zgap
XML Treatment for Atractus michaelsabini

Acknowledgements

This article was greatly improved by comments of Omar Entiauspe-Neto, Abel Batista, and Robert Jadin. For granting access to the protected forests under their care, we are grateful to Pedro Alvarado of CELEC EP, Martin Schaefer and David Agro of Fundación Jocotoco, and Alex Rosillo of Fundación Jatun Sacha. Special thanks to Eric Osterman, Gabriella Marcano, and María José Quiroz for their assistance and companionship in the field. For providing specimens, photos, and ecological information of Atractus, we are grateful to Diego Piñán and Jorge Luis Romero. For creating the image of the juvenile of A.major, we are grateful to Sebastián Di Doménico. Gabriela Gavilanes provided invaluable lab assistance in generating DNA sequence data. For granting access to specimens under their care, we are grateful to Christopher Raxworthy (AMNH), Sebastián Padrón (MZUA), and Ernesto Arbeláez (AMARU). Special thanks to Arne Schulze for encouraging AA to combine the discovery of A.zgap sp. nov. with a concrete plan for the conservation of this species. Fieldwork was made possible with the support of “The Explorers Club Discovery Expedition Grants”, The Zoological Society for the Conservation of Species and Populations (ZGAP), Khamai Foundation, Tropical Herping, Re:wild, Sabin Family Foundation, and Prefectura del Azuay. Laboratory work was carried out at USFQ. Sequencing was made possible with support of the Inédita Program from the Ecuadorian Science Agency SENESCYT (Respuestas a la Crisis de Biodiversidad: La Descripción de Especies como Herramienta de Conservación; INEDITA PIC-20-INE-USFQ-001). The project also benefited from funds granted by Universidad San Francisco de Quito (HUBI 5466, 5467, 16871).

Appendix I

Table A1.

GenBank accession numbers for loci and terminals of taxa and outgroups sampled in this study. Novel sequence data produced in this study are marked with an asterisk (*).

Species Voucher 16S CYTB ND4 CMOS NT3 RAG1
A.arangoi DHMECN 8343 KY610059 KY610105
A.arangoi ZSFQ 4947 ON907812* ON925021* ON925012*
A.arangoi ZSFQ 4948 ON907811* ON925020* ON925011*
A.atlas QCAZ 14946 MH790470 MN887669 MN887691 MN887640 MN887715 MN887745
A.badius MNRJ 26717 MH790476 MK835891 MK835864 MK835980 MK835948
A.boimirim MPEG 21233 MH790478 MK835866 MK835982 MK835951
A.carrioni MZUTI 4195 KY610046 KY610094
A.carrioni QCAZ 6446 MT507867 MT511983
A.carrioni QCAZ 6533 MT507868 MT511984
A.carrioni QCAZ 6534 MT507869 MT511985
A.carrioni QCAZ 10038 MT507864 MT511977 MT511982
A.carrioni QCAZ 13094 MT507865 MT511978
A.cerberus MZUTI 4330 KY610047 KY610073 KY610095
A.dapsilis MNRJ 16796 MH790480 MK835894 MK835926 MN887642 MN887716 MK835951
A.discovery sp. nov. MZUA.Re.466 OP225330* OP244686* OP225393*
A.duboisi MZUTI 62 KT944041 KT944059
A.dunni MZUTI 2189 KY610048 KY610096
A.dunni MZUTI 3031 KY610049 KY610097
A.dunni MZUTI 4318 KY610050 KY610074 KY610098
A.dunni MZUTI 4319 KY610051 KY610075 KY610099
A.ecuadorensis DHMECN 5105 KY610100
A.elaps QCAZ 5574 MN855378 MK835896 MN887692 MK835867 MN887717 MK835954
A.esepe MZUTI 3758 KY610053 KT944052 KY610102
A.esepe MZUTI 3759 KT944039 KT944051 KT944058
A.favae MZUSP 20211 MN855380 MN887670
A.flammigerus MNRJ 26720 MH790488 MK835903 MK835932 MK835873 MK835994
A.gigas MZUTI 3286 KT944043 KT944053 MN891764
A.iridescens DHMECN 9633 KY610054 KY610077
A.iridescens MZUTI 3548 KY610055 KY610078
A.iridescens MZUTI 3680 KY610056 KY610079
A.iridescens MZUTI 4178 KT944040 KY610080 MH374931
A.iridescens MZUTI 4697 KY610057 KY610081
A.lasallei MHUA 14368 GQ334480 GQ334581
A.latifrons MPEG 22630 MH790493 MK835908 MN887694 MK835875
A.major ANF 1545 KT944045 KY610104
A.major CORBIDI 223 MH790497
A.major MNRJ 26126 MH790498 MK835911 MK835958
A.major MZUSP 20868 MH790499
A.major MZUSP 20887 MH790500
A.major QCAZ 4691 MH790506 MK835912 MK835934 MN887643 MK836002 MN887747
A.major QCAZ 4993 MH790507 MK835935
A.major QCAZ 5891 MH790508 MK835913 MK835936 MK835878 MK836003 MK835962
A.major QCAZ 7881 MH790509 MK835914 MK835937 MK836004 MK835963
A.major QCAZ 13819 MH790504 MK835933 MK836000 MK835960
A.major UFACRB 532 MH790511 MK835915 MK835879 MK836005
A.michaelsabini sp. nov. AMARU 002 ON907809* ON925018* ON925009*
A.michaelsabini sp. nov. MZUTI 5289 ON907810* ON925019* ON925010*
A.michaelsabini sp. nov. DHMECN 7644 KY610058 KY610082 KY610103
A.michaelsabini sp. nov. QCAZ 7887 MT507872 MT511989
A.michaelsabini sp. nov. QCAZ 7889 MT507874 MT511990
A.michaelsabini sp. nov. QCAZ 9643 MT507875 MT511981 MT511991
A.michaelsabini sp. nov. QCAZ 9652 MT507876 MT511992
A.michaelsabini sp. nov. ZSFQ 4939 ON907808* ON925017* ON925008*
A.microrhynchus MZUTI 1385 KY610063 KY610086 KY610109
A.microrhynchus MZUTI 2649 KY610064 KY610087 KY610110
A.microrhynchus MZUTI 2650 KT944038 KT944050 KT944057
A.microrhynchus MZUTI 3323 KY610065 KY610088 KY610111
A.microrhynchus MZUTI 4122 KT944037 KT944049 KT944056
A.microrhynchus MZUTI 5109 KY610060 KY610083 KY610106
A.modestus MZUTI 4760 KY610061 KY610084 KY610107
A.multicinctus MZUTI 5106 KY610062 KY610085 KY610108
A.orcesi ZSFQ 2222 ON907807* ON925007*
A.orcesi ZSFQ 2237 ON907806* ON925016* ON925006*
A.pachacamac QCAZ 12630 MH790524 MN887672 MN887697 MN887647 MN887723 MN887751
A.paucidens MZUTI 5102 KY610066 ON925015* KY610112
A.resplendens MZUTI 3996 KT944042 KT944055 KT944060
A.riveroi MNRJ 26087 MH790526 MK835916 MK836006 MK835964
A.roulei MZUTI 4503 KY610069 KY610090 KY610116
A.roulei MZUTI 4544 KY610069 KY610091 KY610117
A.roulei MZUTI 5107 KY610068 KY610089 KY610115
A.roulei QCAZ 6256 MT511980 MT511988
A.roulei QCAZ 7192 MT507871 MT511980
A.roulei ZSFQ 4945 ON907805* ON925014* ON925005*
A.savagei MZUTI 4916 KY610070 KY610092 KY610118
A.schach AF 1716 MH790527 MK835917 MK835880 MK836007
A.snethlageae MPEG 20605 MH790513 MN887678 MN887705 MN887655 MN887731 MN887759
A.tartarus MPEG 23931 MH790529 MK835919 MK835938 MK836009 MK835965
A.torquatus MPEG 23686 MH790532 MK835921 MK835941 MK836012 MK835968
A.touzeti ZSFQ 4949 ON907804* ON925013* ON925004*
A.trefauti MNRJ 26709 MH790536 MK835923 MK835942 MK835883 MK836015 MK835971
A.trilineatus CAS 257740 MK648018 MK648027 MK648035 MK648043
A.trilineatus UWISM 2015.18.2 MK648014 MK648022 MK648031 MK648039
A.typhon MZUTI 3284 KT944044 KT944054 KT944062
A.ukupacha QCAZ 4944 MH790540 MN887689 MN887714 MN887668 MN887744 MN887774
A.zgap sp. nov. MZUTI 5311 ON907803* ON925003*
A.zidoki MNHN 1997.2046 AF158487
G.godmani MVZ 233298 JQ598877 JQ598932
S.nebulatus MVZ 233298 EU728583 EU728583 EU728583

Appendix II

Table A2.

List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension, and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C.

Locus Primer Sequence (5’-3’) Reference PCR profile
16S 16Sar-L CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 30 cycles of 94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min)
16Sbr-H-R CCGGTCTGAACTCAGATCACGT
Cytb L14910 GACCTGTGATMTGAAAACCAYCGTTGT Burbrink et al. (2000) 94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30–36]
H16064 CTTTGGTTTACAAGAACAATGCTTTA
ND4 ND4 CACCTATGACTACCAAAAGCTCATGTAGAAGC Arévalo et al. (1994) 94 °C (25 sec), 56 or 60 °C (1 min), 72 °C (2 min) [x25–30]
Leu CATTACTTTTACTTGGATTTGCACCA
S78 CCTTGGGTGTGATTTTCTCACCT

Citation

Arteaga A, Quezada A, Vieira J, Guayasamin JM (2022) Leaving no stone unturned: three additional new species of Atractus ground snakes (Serpentes, Colubridae) from Ecuador discovered using a biogeographical approach. ZooKeys 1121: 175–210. https://doi.org/10.3897/zookeys.1121.86539

Funding Statement

The Explorers Club Discovery Expedition Grants, Khamai Foundation, Re:wild, Sabin Family Foundation, Prefectura del Azuay

Supplementary materials

Supplementary material 1

Table S1

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Alejandro Arteaga, Amanda Quezada, Jose Vieira, Juan M. Guayasamin

Data type

excel file.

Explanation note

Locality data for species included in Fig. 2.

Supplementary material 2

Figure S1

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Alejandro Arteaga, Amanda Quezada, Jose Vieira, Juan M. Guayasamin

Data type

Image.

Explanation note

Phylogenetic relationships within Atractus inferred using a maximum-likelihood approach and derived from analysis of 3,985 bp of DNA (gene fragments 16S, cytb, ND4, c-mos, NT3, and RAG1). Support values on intra-specific branches are not shown for clarity. Voucher numbers for sequences are indicated for each terminal. Black dots indicate clades with bootstrap values from 90–100%. Grey dots indicate values from 70–89%. White dots indicate values from 50–69% (values < 50% not shown). Colored clades correspond to the species’ distribution presented in the map of Fig. 2. New or resurrected species are indicated in bold type.

References

  1. Ahmadzadeh F, Flecks M, Carretero MA, Mozaffari O, Böhme W, Harris DJ, Freitas S, Rödder D. (2013) Cryptic speciation patterns in Iranian rock lizards uncovered by integrative taxonomy. PLoS ONE 8(12): e80563. 10.1371/journal.pone.0080563 [DOI] [PMC free article] [PubMed]
  2. Amaral A. (1926) Novos gêneros e expécies de ophidios brasileiros. Archivos do Museu Nacional do Rio de Janeiro 26: 1–27. [Google Scholar]
  3. Arévalo E, Davis SK, Sites JW. (1994) Mitochondrial DNA-sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporusgrammicus complex (Phrynosomatidae) in Central Mexico. Systematic Biology 43(3): 387–418. 10.1093/sysbio/43.3.387 [DOI] [Google Scholar]
  4. Arteaga A. (2022) Giant Ground Snake (Atractusgigas). In: Arteaga A, Bustamante L, Vieira J, Guayasamin JM (Eds) Reptiles of Ecuador: Life in the middle of the world. 10.47051/MNHT9360 [DOI]
  5. Arteaga A, Bustamante L, Guayasamin JM. (2013) The amphibians and reptiles of Mindo. Universidad Tecnológica Indoamérica, Quito, 257 pp. [Google Scholar]
  6. Arteaga A, Pyron RA, Peñafiel N, Romero-Barreto P, Culebras J, Bustamante L, Yánez-Muñoz MH, Guayasamin JM. (2016) Comparative phylogeography reveals cryptic diversity and repeated patterns of cladogenesis for amphibians and reptiles in northwestern Ecuador. PLoS ONE 11: e0151746. 10.1371/journal.pone.0151746 [DOI] [PMC free article] [PubMed]
  7. Arteaga A, Mebert K, Valencia JH, Cisneros-Heredia DF, Peñafiel N, Reyes-Puig C, Vieira-Fernandes JL, Guayasamin JM. (2017) Molecular phylogeny of Atractus (Serpentes, Dipsadidae), with emphasis on Ecuadorian species and the description of three new taxa. ZooKeys 661: 91–123. 10.3897/zookeys.661.11224 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Arteaga A, Salazar-Valenzuela D, Mebert K, Peñafiel N, Aguiar G, Sánchez-Nivicela JC, Pyron RA, Colston TJ, Cisneros-Heredia DF, Yánez-Muñoz MH, Venegas PJ, Guayasamin JM, Torres-Carvajal O. (2018) Systematics of South American snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Ecuador and Peru. ZooKeys 766: 79–147. 10.3897/zookeys.766.24523 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Arteaga A, Bustamante L, Vieira J, Tapia W, Guayasamin JM. (2019) Reptiles of the Galápagos: life on the Enchanted Islands. Tropical Herping, Quito, 208 pp. 10.47051/AQJU7348 [DOI] [Google Scholar]
  10. Arteaga A, Bustamante L, Vieira J, Guayasamin JM. (2022) Reptiles of Ecuador: life in the middle of the world. 10.47051/MNHT9360 [DOI]
  11. Avila-Pires TCS. (2001) A new species of Lepidoblepharis (Reptilia: Squamata: Gekkonidae) from Ecuador, with a redescription of L.grandis Miyata, 1985. Occasional Paper of the Sam Noble Oklahoma Museum of Natural History 11: 1–11. [Google Scholar]
  12. Beaupre SJ, Jacobson ER, Lillywhite HB, Zamudio K. (2004) Guidelines for use of live amphibians and reptiles in field and laboratory research. American Society of Ichthyologists and Herpetologists, Lawrence, 43 pp. [Google Scholar]
  13. Boettger O. (1898) Katalog der Reptilien-Sammlung im Museum der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt. II Teil (Schlangen). Gebrüder Knauer, Frankfurt, 160 pp. [Google Scholar]
  14. Boie F. (1827) Bemerkungen über Merrem’s Versuch eines Systems der Amphibien. Isis von Oken 20: 508–566. [Google Scholar]
  15. Boulenger GA. (1880) Reptiles et Batraciens recueillis par M. Emile de Ville dans les Andes de l’Équateur. Bulletin de la Société Zoologique de France 5: 41–48. [Google Scholar]
  16. Boulenger GA. (1894) Catalogue of the snakes in the British Museum. Taylor & Francis, London, 382 pp. 10.5962/bhl.title.8316 [DOI] [Google Scholar]
  17. Burbrink FT, Lawson R, Slowinski JB. (2000) Mitochondrial DNA phylogeography of the polytypic North American rat snake (Elapheobsoleta): A critique of the subspecies concept. Evolution 54(6): 2107–2188. 10.1111/j.0014-3820.2000.tb01253.x [DOI] [PubMed] [Google Scholar]
  18. Caramaschi U, de Sá RO, Heyer WR. (2006) Leptodactylus. Information bank for Leptodactylus frogs. https://facultyhub.richmond.edu
  19. Cisneros-Heredia D. (2005) Rediscovery of the Ecuadorian snake Atractusdunni Savage, 1955 (Serpentes: Colubridae). Journal by the National Museum. Natural History Series 174: 87–114. [Google Scholar]
  20. Coloma LA, Guayasamin JM. (2011–2017) Nombres vernáculos de anfibios de Ecuador. http://www.anfibiosecuador.ec
  21. Cope ED. (1868) An examination of the Reptilia and Batrachia obtained by the Orton Expedition to Equador and the Upper Amazon, with notes on other species. Proceedings. Academy of Natural Sciences of Philadelphia 20: 96–140. [Google Scholar]
  22. da Cunha OR, do Nascimento FP. (1983) Ofidios da Amazonia. XX. As especies de Atractus Wagler, 1828, na Amazonia oriental & Maranhao (Ophidia, Colubridae). Boletim do Museu Paraense Emílio Goeldi 123: 1–38. [Google Scholar]
  23. Daniel H. (1949) Las serpientes en Colombia. Revista Facultad Nacional de Agronomía 9: 301–333. [Google Scholar]
  24. de Queiroz K. (2007) Species concepts and species delimitation. Systematic Biology 56(6): 879–886. 10.1080/10635150701701083 [DOI] [PubMed] [Google Scholar]
  25. Despax R. (1910) Mission géodésique de l’Équateur. Collections recueillies par M. le Dr. Rivet. Liste des Ophidiens et description des espèces nouvelles. Bulletin du Muséum National d’Histoire Naturelle 16: 368–376. 10.5962/bhl.part.20432 [DOI] [Google Scholar]
  26. Dowling HG. (1951) A proposed standard system of counting ventrals in snakes. British Journal of Herpetology 1: 97–99. [Google Scholar]
  27. Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Heled J, Kearse M, Moir R, Stones-Havas S, Sturrock S, Thierer T, Wilson A. (2021) Geneious version 2021.1. https://www.geneious.com
  28. Duellman WE. (1978) The biology of an equatorial herpetofauna in Amazonian Ecuador. Publications of the Museum of Natural History, University of Kansas 65: 1–352. [Google Scholar]
  29. Duméril AMC, Bibron G, Duméril AHA. (1854) Erpétologie générale ou Histoire Naturelle complète des Reptiles. Librairie Encyclopédique de Roret, Paris, 780 pp. 10.5962/bhl.title.45973 [DOI] [Google Scholar]
  30. Dunn ER, Bailey JR. (1939) Snakes from the uplands of the Canal Zone and of Darien. Bulletin of the Museum of Comparative Zoology at Harvard College 86: 1–22. [Google Scholar]
  31. Elith J, Leathwick JR. (2009) Species distribution models: Ecological explanation and prediction across space and time. Annual Review of Ecology, Evolution, and Systematics 40(1): 677–697. 10.1146/annurev.ecolsys.110308.120159 [DOI] [Google Scholar]
  32. Elith J, Phillips SJ, Hastie T, Dudík M, Chee YE, Yates CJ. (2011) A statistical explanation of MaxEnt for ecologists. Diversity & Distributions 17(1): 43–57. 10.1111/j.1472-4642.2010.00725.x [DOI] [Google Scholar]
  33. Felsenstein J. (2004) Inferring phylogenies. Sinauer Associates, Sunderland, 664 pp. [Google Scholar]
  34. Gasc JP, Rodrigues MT. (1979) Une nouvelle espèce du genre Atractus (Colubridae, Serpentes) de la Guyane Française. Bulletin du Muséum National d’Histoire Naturelle 2: 547–557. [Google Scholar]
  35. Grazziotin FG, Zaher H, Murphy RW, Scrocchi GJ, Benavides MA, Zhang YP, Bonatto SL. (2012) Molecular phylogeny of the New World Dipsadidae (Serpentes: Colubroidea): a reappraisal. Cladistics 1(5): 1–223. 10.1111/j.1096-0031.2012.00393.x [DOI] [PubMed] [Google Scholar]
  36. Hijmans RJ, Cameron SE, Parra JL, Jones PG, Jarvis A. (2005) Very high resolution interpolated climate surfaces for global land areas. International Journal of Climatology 25(15): 1965–1978. 10.1002/joc.1276 [DOI] [Google Scholar]
  37. IUCN (2001) IUCN Red List categories and criteria: Version 3.1. IUCN Species Survival Commission, Gland and Cambridge, 30 pp. [Google Scholar]
  38. Jan G. (1862) Enumerazione sistematico delle specie d’ofidi del gruppo Calamaridae. Archivio per la Zoologia, l’Anatomia e la Fisiologia 2: 1–76. [Google Scholar]
  39. Katoh K, Standley DM. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Köhler G, Böhme W, Schmitz A. (2004) A new species of Echinosaura (Squamata: Gymnophthalmidae) from Ecuador. Journal of Herpetology 38(1): 52–60. 10.1670/164-02A [DOI] [Google Scholar]
  41. Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A. (2019) RAxML-NG: A fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 35(21): 4453–4455. 10.1093/bioinformatics/btz305 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. (2016) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. 10.1093/molbev/msw260 [DOI] [PubMed] [Google Scholar]
  43. Loughlin NJD, Gosling WD, Mothes P, Montoya E. (2018) Ecological consequences of post-Columbian indigenous depopulation in the Andean-Amazonian corridor. Nature Ecology & Evolution 2(8): 1233–1236. 10.1038/s41559-018-0602-7 [DOI] [PubMed] [Google Scholar]
  44. MAE (2012) Línea base de deforestación del Ecuador continental. Ministerio del Ambiente del Ecuador, Quito, 30 pp. [Google Scholar]
  45. Mantilla Espinoza EF. (2021) Áreas potenciales de conservación para serpientes del género Atractus por encima de los 2000 m.s.n.m. en el Ecuador. BSc thesis, Universidad Central del Ecuador, 59 pp. [Google Scholar]
  46. Maynard RJ, Lynch RL, Maier P, Hamilton P. (2017) Reptiles of San José de Payamino, Ore­llana, Ecuador. Field guides of the Field Museum of Natural History, Chicago, 9 pp. [Google Scholar]
  47. Mejía Guerrero MA. (2018) Revisión taxonómica de las serpientes tierreras Atractus del grupo iridescens Arteaga et al. 2017. BSc thesis, Quito, Pontificia Universidad Católica del Ecuador, 67 pp. [Google Scholar]
  48. Melo-Sampaio PR, Passos P, Fouquet A, Da Costa Prudente AL. (2019) Systematic review of Atractusschach (Serpentes: Dipsadidae) species complex from the Guiana Shield with description of three new species. Systematics and Biodiversity 17(3): 207–229. 10.1080/14772000.2019.1611674 [DOI] [Google Scholar]
  49. Melo-Sampaio PR, Passos P, Prudente ALC, Venegas PJ, Torres-Carvajal O. (2021) Systematic review of the polychromatic ground snakes Atractussnethlageae complex reveals four new species from threatened environments. Journal of Zoological Systematics and Evolutionary Research 00(3): 1–30. 10.1111/jzs.12453 [DOI] [Google Scholar]
  50. Meneses-Pelayo E, Passos P. (2019) New polychromatic species of Atractus (Serpentes: Dipsadidae) from the eastern portion of the Colombian Andes. Copeia 107(2): 250–261. 10.1643/CH-18-163 [DOI] [Google Scholar]
  51. Murphy JC, Salvi D, Braswell AL, Jowers MJ. (2019) Phylogenetic position and biogeography of Three-Lined Snakes (Atractustrilineatus: Squamata, Dipsadidae) in the Eastern Caribbean. Herpetologica 75(3): 247–253. 10.1655/D-18-00043 [DOI] [Google Scholar]
  52. Myers CW. (2003) Rare snakes – five new species from eastern Panama: reviews of northern Atractus and southern Geophis (Colubridae: Dipsadinae). American Museum Novitates 3391: 1–47. [DOI] [Google Scholar]
  53. Myers CW, Schargel WE. (2006) Morphological extremes-two new snakes of the genus Atractus from northwestern South America (Colubridae: Dipsadinae). American Museum Novitates 3532(1): 1–13. 10.1206/0003-0082(2006)3532[1:MENSOT]2.0.CO;2 [DOI]
  54. Ortega-Andrade MH, Rojas-Soto OR, Valencia JH, Espinosa de los Monteros A, Morrone JJ, Ron S, Cannatella DC. (2015) Insights from integrative systematics reveal cryptic diversity in Pristimantis frogs (Anura: Craugastoridae) from the upper amazon basin. PLoS ONE 10(11): e0143392. 10.1371/journal.pone.0143392 [DOI] [PMC free article] [PubMed]
  55. Palumbi SR, Martin A, Romano S, McMillan WO, Stice L, Grabowski G. (1991) The simple fool’s guide to PCR, version 2.0. University of Hawaii, Honolulu, 94 pp. [Google Scholar]
  56. Parker HW. (1930) A new colubrine snake from Ecuador. Annals & Magazine of Natural History 5(26): 207–209. 10.1080/00222933008673120 [DOI] [Google Scholar]
  57. Passos P, Arredondo JC, Fernandes R, Lynch JD. (2009a) Three new Atractus (Serpentes: Dipsadidae) from the Andes of Colombia. Copeia 2009(3): 425–436. 10.1643/CH-08-063 [DOI] [Google Scholar]
  58. Passos P, Chiesse A, Torres-Carvajal O, Savage JM. (2009b) Testing species boundaries within the Atractusoccipitoalbus complex (Serpentes: Dipsadidae). Herpetologica 65(4): 384–403. 10.1655/08-024.1 [DOI] [Google Scholar]
  59. Passos P, Mueses-Cisneros JJ, Lynch JD, Fernandes R. (2009c) Pacific lowland snakes of the genus Atractus (Serpentes: Dipsadidae), with description of three new species. Zootaxa 2293(1): 1–34. 10.11646/zootaxa.2293.1.1 [DOI] [Google Scholar]
  60. Passos P, Dobiey M, Venegas PJ. (2010) Variation and natural history notes on giant groundsnake, Atractusgigas (Serpentes: Dipsadidae). South American Journal of Herpetology 5(2): 73–82. 10.2994/057.005.0201 [DOI] [Google Scholar]
  61. Passos P, Prudente ALC, Lynch JD. (2016) Redescription of Atractuspunctiventris and description of two tew Atractus (Serpentes: Dipsadidae) from Brazilian Amazonia. Herpetological Monograph 30(1): 1–20. 10.1655/HERPMONOGRAPHS-D-14-00009 [DOI] [Google Scholar]
  62. Passos P, Scanferla A, Melo-Sampaio PR, Brito J, Almendariz A. (2018) A giant on the ground: another large-bodied Atractus (Serpentes: Dipsadinae) from Ecuadorian Andes, with comments on the dietary specializations of the goo-eaters snakes. Anais da Academia Brasileira de Ciências 91(suppl 1): e20170976. 10.1590/0001-3765201820170976 [DOI] [PubMed]
  63. Passos P, Melo-Sampaio PR, Ramos LO, Grazziotin FG, Fouquet A, Torres-Carvajal O. (2022) When the tail shakes the snake: phylogenetic affinities and morphology of Atractusbadius (Serpentes: Dipsadidae), reveals some current pitfalls on the snake’s genomic age. Annals of the Brazilian Academy of Sciences 94(1): e20191254. 10.1590/0001-3765202220191254 [DOI] [PubMed]
  64. Peñafiel N, Flores DM, Rivero De Aguilar J, Guayasamin JM, Bonaccorso E. (2020) A cost-effective protocol for total DNA isolation from animal tissue. Neotropical Biodiversity 5(1): 69–74. 10.1080/23766808.2019.1706387 [DOI] [Google Scholar]
  65. Peracca MG. (1896) Sopra alcuni Ofidii nuovi o poco noti dell’America meridionale. Bolletino dei Musei di Zoologia e di Anatomia Comparata della Università di Torino 11: 1–4. 10.5962/bhl.part.4563 [DOI] [Google Scholar]
  66. Peracca MG. (1897) Intorna ad una piccola raccolta di Rettili di Cononacco (Perù orientale). Bolletino dei Musei di Zoologia e di Anatomia Comparata della Università di Torino 12: 1–7. 10.5962/bhl.part.4563 [DOI] [Google Scholar]
  67. Peterson AT, Soberon JR, Pearson RG, Anderson RP, Martínez‐Meyer E, Nakamura M, Bastos Araújo M. (2011) Ecological niches and geographic distributions. Princeton University Press, Princeton, 328 pp. 10.23943/princeton/9780691136868.003.0003 [DOI] [Google Scholar]
  68. Phillips SJ, Anderson RP, Schapire RE. (2006) Maximum entropy modeling of species geographic distributions. Ecological Modelling 190(3–4): 231–259. 10.1016/j.ecolmodel.2005.03.026 [DOI] [Google Scholar]
  69. Prado A. (1939) Cinco especies novas de serpentes colombianas do genero Atractus Wagler. Memorias do Instituto Butantan 13: 1–9. [Google Scholar]
  70. Rambaut A, Suchard M, Drummond AJ. (2022) Tracer version 1.7.1 http://www.beast.community
  71. Renner IW, Warton DI. (2013) Equivalence of MAXENT and poisson point process models for species distribution modeling in ecology. Biometrics 69(1): 274–281. 10.1111/j.1541-0420.2012.01824.x [DOI] [PubMed] [Google Scholar]
  72. Ronquist F, Huelsenbeck JP. (2013) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19(12): 1572–1574. 10.1093/bioinformatics/btg180 [DOI] [PubMed] [Google Scholar]
  73. Royle JA, Chandler RB, Yackulic C, Nichols JD. (2012) Likelihood analysis of species occurrence probability from presence-only data for modelling species distributions. Methods in Ecology and Evolution 3(3): 545–554. 10.1111/j.2041-210X.2011.00182.x [DOI] [Google Scholar]
  74. Salazar-Valenzuela D, Torres-Carvajal O, Passos P. (2014) A new species of Atractus (Serpentes: Dipsadidae) from the Andes of Ecuador. Herpetologica 70(3): 350–363. 10.1655/HERPETOLOGICA-D-13-00045 [DOI] [Google Scholar]
  75. Savage JM. (1955) Descriptions of new colubrid snakes, genus Atractus, from Ecuador. Proceedings of the Biological Society of Washington 68: 11–20. [Google Scholar]
  76. Savage JM. (1960) A revision of the Ecuadorian snakes of the Colubrid genus Atractus. Miscellaneous Publications, Museum of Zoology. University of Michigan 112: 1–184. [Google Scholar]
  77. Schargel WE, Lamar WW, Passos P, Valencia JH, Cisneros-Heredia DF, Campbell JA. (2013) A new giant Atractus (Serpentes: Dipsadidae) from Ecuador, with notes on some other large Amazonian congeners. Zootaxa 3721(5): 455–474. 10.11646/zootaxa.3721.5.2 [DOI] [PubMed] [Google Scholar]
  78. Sierra R. (1999) Propuesta preliminar de un sistema de clasificación de vegetación para el Ecuador continental. EcoCiencia, Quito, 174 pp. [Google Scholar]
  79. Soberón J, Peterson TA. (2005) Interpretation of models of fundamental ecological niches and species’ distributional areas. Biodiversity Informatics 2(0): 1–10. 10.17161/bi.v2i0.4 [DOI] [Google Scholar]
  80. Tolhurst B, Peck M, Morales JN, Cane T, Recchio I. (2010) Extended distribution of a recently described dipsadine colubrid snake: Atractusgigas. Herpetology Notes 3: 73–75. [Google Scholar]
  81. Torres-Carvajal O, Lobos SE. (2014) A new species of Alopoglossus lizard (Squamata, Gymnophthalmidae) from the tropical Andes, with a molecular phylogeny of the genus. ZooKeys 410: 105–120. 10.3897/zookeys.410.7401 [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Uetz P, Freed P, Hošek J. (2022) The Reptile Database. http://www.reptile-database.org [accessed 12 Jun 2022]
  83. van Proosdij ASJ, Sosef MSM, Wieringa JJ, Raes N. (2015) Minimum required number of specimen records to develop accurate species distribution models. Ecography 39(6): 542–552. 10.1111/ecog.01509 [DOI] [Google Scholar]
  84. Wagler J. (1828) Auszüge aus seinem Systema Amphibiorum. Isis von Oken 21: 740–744. [Google Scholar]
  85. Werner F. (1901) Ueber Reptilien und Batrachier aus Ecuador und Neu-Guinea. Verhandlungen der Kaiserlich-Königlichen Zoologisch-Botanischen Gesellschaft in Wien 51: 593–614. 10.5962/bhl.part.4586 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Atractus discovery
XML Treatment for Atractus zgap
XML Treatment for Atractus michaelsabini
Supplementary material 1

Table S1

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Alejandro Arteaga, Amanda Quezada, Jose Vieira, Juan M. Guayasamin

Data type

excel file.

Explanation note

Locality data for species included in Fig. 2.

Supplementary material 2

Figure S1

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Alejandro Arteaga, Amanda Quezada, Jose Vieira, Juan M. Guayasamin

Data type

Image.

Explanation note

Phylogenetic relationships within Atractus inferred using a maximum-likelihood approach and derived from analysis of 3,985 bp of DNA (gene fragments 16S, cytb, ND4, c-mos, NT3, and RAG1). Support values on intra-specific branches are not shown for clarity. Voucher numbers for sequences are indicated for each terminal. Black dots indicate clades with bootstrap values from 90–100%. Grey dots indicate values from 70–89%. White dots indicate values from 50–69% (values < 50% not shown). Colored clades correspond to the species’ distribution presented in the map of Fig. 2. New or resurrected species are indicated in bold type.


Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES