Magnesium Supplementation Affects the Expression of Sirtuin1, Tumor Protein P53 and Endothelial Nitric Oxide Synthase Genes in Patients with Atherosclerosis: A Double-Blind, Randomized, Placebo-Controlled Trial

Abstract

Magnesium seems to play a role in improving cardiovascular function, but its exact mechanism is unknown. In this study, we hypothesized that magnesium could modulate the expression of genes involved in atherosclerosis. The aim of the present investigation was to evaluate the effect of magnesium sulfate on the expression of sirtuin1 (SIRT1), tumor protein p53 (TP53), and endothelial nitric oxide synthase (eNOS) genes in patients with atherosclerosis. This study was a placebo-controlled double-blind randomized clinical trial on 56 patients with angiographically proven atherosclerosis. Participants were randomly divided into two groups receiving 300 mg/day magnesium sulfate (n = 29) and placebo (n = 27) for three months (following up every month). Fasting blood samples were taken before and after the intervention and total RNA was extracted and used to evaluate the expression level of SIRT1, TP53, and eNOS genes by Real-Time PCR. The expression of eNOS gene was significantly increased (P < 0.0001) and the expression of TP53 gene was decreased (P = 0.02) in the magnesium sulfate group compared to the placebo group. But SIRT1 gene expression was not significantly different between the two groups. Our findings demonstrate that magnesium sulfate supplementation may have a protective role against the progression of atherosclerosis through upregulation of eNOS and downregulation of TP53 gene.

Trial registration: This present clinical trial has been registered in the Iranian Registry of Clinical Trials (IRCT) with the registration code of “IRCT20151028024756N3”, https://www.irct.ir/trial/29097?revision=114102. Registered on 16 December 2019.

Introduction

Atherosclerosis is the leading cause of cardiovascular diseases and death worldwide [1]. There are several risk factors for atherosclerosis. Recent studies show that oxidative stress and chronic inflammation promote the development of atherosclerosis through changes in cell function, impaired homeostasis, and induction of cellular aging [2–5]. Therefore, treatment strategies to reduce inflammation and oxidative stress can be helpful in preventing atherosclerosis.

Sirtuins are a family of histone deacetylase (HDAC) enzymes. In mammals, there are 7 types of sirtuins protein (SIRT1-7) [6]. Sirtuin 1 (SIRT1) is the most important class III histone deacetylase protein dependent on nicotinamide adenine dinucleotide (NAD ⁺) [7]. Numerous studies show that SIRT1 involved in many cellular processes, such as gene expression and stability, cell differentiation, apoptosis, energy metabolism, oxidative stress, and inflammation through deacetylation of tumor protein p53 (TP53), endothelial nitric oxide synthase (eNOS), forkhead box group O (FOXO), nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kb) and peroxisome proliferator-activated receptors (PPARs) [2, 8–10].

The SIRT1-p53 axis plays a key role in regulating the processes of oxidative stress and inflammation. By deacetylation of lysine-382 at the C-terminus of p53, SIRT1 can inhibit apoptosis, thereby leading to cell survival. This axis also has a key function in reducing oxidative stress by inhibiting growth suppressor genes [2, 11, 12]. SIRT1 can cause to activate eNOS and subsequently produce nitric oxide (NO) by deacetylation of lysine 496 and 506 in the calmodulin-binding domain of eNOS. This interaction can protect endothelial cells against oxidative stress-induced damage [13]. SIRT1 also reduces inflammation and expression of adhesive molecules by deacetylation of transcription factor NF-kb and inhibiting it signaling pathway [7, 14, 15].

Studies show that there is a relation between serum magnesium levels and the process of atherosclerosis. Magnesium deficiency causes inflammation, endothelial dysfunction, increased low-density lipoprotein cholesterol (LDL-C) concentration, and stimulation of monocyte-endothelial interaction by increasing adhesion molecules. Therefore, low levels of magnesium can lead to the development of atherosclerosis [16, 17].

In vitro studies show that magnesium, by increasing eNOS and increasing NO synthesis, causes to proliferate endothelial cells, improves endothelial function, and protects against atherosclerosis [17]. Animal studies also show that oral magnesium sulfate causes improve blood pressure and vascular structure by reducing oxidized LDL (ox-LDL) and reducing lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) gene expression and is useful in preventing atherosclerosis in the arteries of diabetic rats [16]. Interestingly, SIRT1 reduces foam cell formation by reducing LOX-1 gene expression [14].

Some evidence suggests that magnesium may indirectly affect the expression of SIRT1. Adenosine monophosphate-activated protein kinase (AMPK) and c-Mcy have both been shown to increase the expression of the SIRT1 gene [18], while magnesium leads to an increase in the activity of AMPK [19] and magnesium deficiency leads to a decrease in the expression of c-Mcy [20]. Therefore, magnesium may cause SIRT1 expression alteration by affecting AMPK and c-Mcy.

Recently, the magnesium treatment approach has been considered to maintain SIRT1 activity. Magnesium/SIRT1 interaction causes to reduce the aging process in various cells and tissues by regulating telomere length in the nucleus, preventing the formation of amyloid beta toxin, and subsequently preventing mitochondrial apoptosis and reducing free radicals formation [21].

Limited studies have been performed regarding the effect of magnesium on SIRT1 expression and its association with atherosclerotic parameters. Therefore, with regards to antioxidant and anti-inflammatory effects of magnesium and the possible role of SIRT1, TP53, and eNOS in reducing inflammation and oxidative stress, this study has been done to investigate the effect of oral magnesium sulfate supplementation on the expression of SIRT1, TP53, and eNOS genes in patients with atherosclerosis.

Materials and Methods

This study was a double-blind, placebo-controlled with parallel group, randomized clinical trial registered in the Iranian Clinical Trials List (IRCT20151028024756N3 with registration number 29097) and performed on patients with atherosclerosis who refer to the angiography center of Shahid Mohammadi Hospital in Bandar Abbas, Iran. patients did not require angioplasty or surgery. The trial was started on 22 December 2019 and ended on 22 April 2020. The study was conducted according to the ethical principles that have their origin in the Declaration of Helsinki. Exclusion criteria include liver, kidney, thyroid, and chronic inflammatory disease, cancer, history of cardiovascular disease, and using anti-inflammatory drugs. Those subjects that use magnesium or calcium supplements or consume alcohol were also excluded. This research has been approved by the University Ethics Committee (IR.HUMS.REC.1398.295). Written informed consent was obtained from all participants at the beginning of the study. It is worth mentioning that all data of participants are protected.

Study Design

The sample size was 60 based on previous studies [22–24]. Some of the drugs that are routinely used by the study participants are: statins as lipid lowering drug, aspirin, clopidogrel, metoprolol and losartan. According to angiographic findings, patients with atherosclerosis who had one or two large coronary arteries with 55–69% obstruction were selected. Then the patients were divided into two groups by random allocation method using a sequence of random numbers provided by the computer. Although the study was blind for all patients, physicians, laboratory technicians, and statisticians, the study predictor accessed the data and was responsible for sample randomization and allocated the participant between groups. As shown in Fig. 1, 60 patients were included, 4 were excluded from the study due to not completing their follow-up period. Twenty-nine patients received magnesium sulfate supplementation (Niak Pharmaceuticals Co. Gorgan, I.R. Iran) as 3 capsules of 100 mg daily and 27 subjects received placebo for 3 months: To monitor the clinical condition of subjects, every month the blood pressure, heart rate and patient’s general health status were checked by an expert cardiologist. All patients were asked to maintain their normal physical activity and current lifestyle during the study period.

Fig. 1.

Summary of patient flow diagram

Evaluation of Anthropometric and Clinical Parameters

At the beginning and end of the study, all individuals underwent anthropometric standard measurements including height and weight, then BMI was calculated. Systolic blood pressure, diastolic blood pressure, heart rate, and liver enzyme activity were measured before and after the intervention.

RNA Extraction and Real-Time PCR Assay

10 ml of fasting blood sample was taken from patients' brachial vein before and after the intervention. The samples were taken before the intervention and 10 days after angiography to minimize the interfering effects of the contrast agent used in angiography. RNA was extracted from blood samples using RiboEx™ LS kit (GeneAll Company, Korea). Concentration and purity of RNAs were measured using Nanodrop-1000 (Thermo Scientific, USA). The extracted RNA was kept in a -80 ºC until cDNA synthesis. The cDNA was made by PrimeScript™ RT reagent (Takara Company, Japan) according to the kit instructions and kept in the -20 ºC until assay. The expression level of SIRT1, TP53, and eNOS genes were measured by real-time PCR, using Master Mix Cyber green (Ampliqon, Denmark). The GAPDH was used as the housekeeping gene. The formula 2^−ΔΔct was used to calculate the expression level of the studied genes. The sequence of primers used is given in Table 1.

Table 1.

Specific primers used for real-time quantitative PCR

GENE	Primer	Product size (bp)	Annealing temperature (C)
GAPDH	F: GGTGTGAACCATGAGAAGTAT R: AGTCCTTCCACGATACCAA	122	60
SIRT1	F: ACATAGACACGCTGGAACAG R: TAGGACATCGAGGAA CTACC	153	61
TP53	F: AAGTCTAGAGCCACCGTCCA R: CAGTCTGGCTGCCAATCCA	120	62
eNOS	F: ACCCTCACCGCTACAACAT R: GCCTTCTGCTCATTCTCCA	205	56

Statistical Analysis

Statistical analysis of the data was performed using GraphPad Prism 8 and SPSS version 22 softwares. Results were shown as mean ± SEM. Shapiro–Wilk test was used to determine the normality of the data. To analyze the nonparametric data, the Mann–Whitney test was used to compare the two groups of placebo and magnesium sulfate and the Wilcoxon test was used for comparison of parameters in each group before and after the intervention. Independent samples test was used to analyze normal data and Chi-square was used to analyze qualitative data. P < 0.05 was considered statistically significant.

Results

In the present investigation, 60 patients were included of which 4 patients were excluded due to not completing their follow-up period, and the study was performed with 56 participants. Subjects in the treated group (n = 29) took 300 mg of magnesium sulfate capsules daily and in the placebo group (n = 27) took placebo capsules for 3 months (Fig. 1).

Height, weight, and BMI before and after the intervention in both magnesium and placebo-treated groups were not statistically different (Table 2). The clinical parameters including heart rate, systolic and diastolic blood pressure, and serum liver enzyme activity were not also different between the two groups before and after the intervention. In addition, no significant difference between the two groups in terms of smoking and having underlying diseases such as diabetes, hypertension, and hyperlipidemia was observed (Table 2).

Table 2.

Demographic, clinical, and laboratory characteristics of the individuals before and after magnesium intake

	Placebo group (n = 27)	Magnesium sulfate group (n = 29)	P value
Age (y)	59.07 ± 1.44	60.06 ± 2.20	0.85
Height (cm)	159.85 ± 2.25	162.74 ± 2.15	0.45
Weight at study baseline (kg)	62.81 ± 1.68	69.24 ± 3.07	0.29
Weight at end of trial (kg)	63.37 ± 1.76	70.10 ± 3.20	0.29
BMI at study baseline (kg/m2)	24.84 ± 0.92	25.87 ± 0.75	0.15
BMI at end of trial (kg/m2)	25.06 ± 0.95	26.19 ± 0.80	0.27
Heart rate at study baseline (bpm)	71.62 ± 1.39	71.31 ± 1.58	0.98
Heart rate at end of trial (bpm)	70.25 ± 1.30	72.51 ± 1.01	0.20
SBP at study baseline (mmHg)	127.03 ± 3.19	128.10 ± 2.15	0.84
SBP at end of trial (mmHg)	124.62 ± 3.07	125.17 ± 2.37	0.74
DBP at study baseline (mmHg)	77.59 ± 1.68	77.75 ± 1.55	0.92
DBP at end of trial (mmHg)	74.25 ± 1.56	76.51 ± 1.45	0.30
AST at study baseline (U/L)	21.37 ± 1.38	20.96 ± 1.21	0.90
AST at end of trial (U/L)	20.66 ± 1.06	20.51 ± 0.99	0.62
ALT at study baseline (U/L)	23.48 ± 3.03	26.79 ± 2.71	0.32
ALT at end of trial (U/L)	20.70 ± 2.33	23.89 ± 2.16	0.30
Cigarette (%)	5 (18.5)	4 (13.8)	0.630
Diabetes (%)	9 (33.3)	6 (20.7)	0.286
Hypertension (%)	17 (63.0)	17 (58.6)	0.740
Hyperlipidemia (%)	11 (40.7)	5 (17.2)	0.052

BMI body mass index; DBP Diastolic blood pressure; SBP systolic blood pressure; AST, aspartate aminotransferase; ALT alanine aminotransferase. The results were expressed as Mean ± SEM. Data were analyzed using the Mann–Whitney test for quantitative data and the Chi-square test for qualitative data

The expression level of the studied genes, SIRT1, TP53, and eNOS before the intervention in the two groups of magnesium sulfate and placebo, was not significantly different (Table 3).

Table 3.

Comparison of the mRNA expression level of studied genes before the intervention

Genes	P-value	Magnesium Sulfate group N = 29	Placebo group N = 27
SIRT1	0.71	0.96 ± 0.14	1.00 ± 0.13
TP53	0.24	0.80 ± 0.20	1.00 ± 0.38
eNOS	0.34	0.76 ± 0.13	1.00 ± 0.16

SIRT1 sirtuin1; eNOS endothelial nitric oxide synthase; TP53, tumor protein p53. The results were expressed as mean ± SEM. Wilcoxon test was used for comparison of parameters in two groups

According to Table 4, magnesium sulfate prescription could reduce the expression level of TP53 gene and increase eNOS gene expression significantly in comparison to placebo group. But the effect of magnesium sulfate on SIRT1 expression was not statistically significant (Table 4).

Table 4.

Comparison of the mRNA expression level of studied genes three months after magnesium sulfate intervention

Genes	Placebo group N = 27	Magnesium sulfate group N = 29	P-value
SIRT1	1.00 ± 0.17	0.95 ± 0.17	0.60
TP53	1.00 ± 0.23	0.29 ± 0.06	0.02
eNOS	1.00 ± 0.29	21.72 ± 3.51	< 0.0001

SIRT1 sirtuin1; eNOS endothelial nitric oxide synthase; TP53, tumor protein p53. The results were expressed as mean ± SEM. Wilcoxon test was used for comparison of parameters in two groups

It is noteworthy that after 3 months of magnesium treatment, the expression of eNOS gene was significantly increased in comparison to its level before intervention. But in the placebo group, no difference in eNOS gene expression was observed before and after the intervention (Fig. 2).

Fig. 2.

Comparison of eNOS mRNA expression level in placebo and magnesium sulfate groups before and after treatment. The results were expressed as mean ± SEM

Discussion

In the present study, the prescription of 300 mg daily oral magnesium sulfate for 3 months in patients with atherosclerosis significantly upregulate eNOS and downregulate TP53 mRNA expression. But the effect of magnesium on SIRT1 gene expression was not statistically significant. To the best of our knowledge, the present work is the first study to evaluate the effect of magnesium sulfate supplementation on the expression of genes associated with atherosclerosis.

Studies show that magnesium deficiency causes inflammation, endothelial dysfunction, and increased serum LDL-C level, which can lead to the development of atherosclerosis [16, 17]. The study by Kolte et.al shows that magnesium has a protective role against inflammation and oxidative stress by reducing interleukin-1, interleukin -6, and reducing free radicals [25]. Also in another work, it has been shown that treatment of diabetic rats with magnesium can improve vascular structure and prevent atherosclerosis by reducing ox-LDL and Lox-1 [16].

The SIRT1 gene has been shown to be highly expressed in vascular endothelial cells and plays an essential role in regulating endothelial function [26]. SIRT1 prevents LDL oxidation [27] and by decreasing the plasma level of Proprotein convertase subtilisin/kexin type 9 (Pcsk9) enzyme, leads to increase the hepatic LDL receptor and decrease the plasma LDL-C level [8]. In addition, by deacetylation of liver x receptor (LXR) in the macrophage, stimulates the expression of transporter ATP binding cassette subfamily A member 1 (ABCA1), which leads to reverse cholesterol transport and thus prevents excessive accumulation of cholesterol in the macrophage [14]. All of these processes consequently diminish atherosclerosis and plaque formation.

A study by Nogueiras et.al shows that increasing SIRT1 activity by resveratrol leads to reduce vascular dysfunction in diabetic rats via the SIRT1-p53 pathway [18]. P53 overexpression leads to increase blood sugar and insulin resistance by inducing apoptosis in pancreatic beta cells, inhibiting transcription of glucose transporters and insulin receptors and plays a significant role in the progression of diabetes [28]. By deacetylation of p53, SIRT1 can inhibit apoptosis and modulate oxidative stress. [2, 11, 12].

A study by Ota et.al on endothelial cells isolated from the aorta of individuals with atherosclerosis shows that inhibition of SIRT1 increases p53 acetylation and causes a premature aging-like phenotype along with a decrease in eNOS expression. On the other hand, increasing the expression of SIRT1 can prevent premature aging and increasing the expression of eNOS, can protect endothelial cells [29].

Although the SIRT1-p53 axis plays an important role in regulating processes related to oxidative stress and inflammation [2], in our study magnesium could not be an effective activator for the SIRT1 gene. A study by Abiri et al., shows that magnesium supplementation for 8 weeks in overweight women with depression did not make a significant difference in serum levels of SIRT1 between the magnesium and placebo groups [30]. However, our study showed that magnesium decreased the expression of TP53 and since TP53 plays an important role in the development of oxidative stress, it can be assumed that magnesium by reducing the expression of TP53 can modulate oxidative stress and consequently be effective in improving atherosclerosis.

A study by Altura et.al shows that magnesium deficiency causes DNA fragmentation, apoptosis in the vascular smooth muscle cells, and increased p53 level in atherosclerotic plaque [31]. However, Tabas's study has obtained conflicting results, such that inhibition of the TP53 gene has been associated with increased lesion size and exacerbated atherosclerosis [32].

Studies have shown that the level of eNOS expression and subsequently NO synthesis gradually decreases with the development of atherosclerotic lesions that can lead to endothelial dysfunction and increased oxidative stress, which plays a major role in the instability of atherosclerotic plaque [29, 33–36].

Endothelial-derived NO has been shown to reduce reactive oxygen species (ROS) production and lipid peroxidation. It also inhibits platelet adhesion and accumulation of adhesive molecules and chemokines, as well as reduces the penetration of inflammatory cells. In addition, as an endogenous vasodilator, it inhibits the key process of vascular lesion formation. Therefore, therapies such as magnesium that increase the expression level of eNOS can be an important goal in the prevention and treatment of atherosclerosis [33].

In vitro study on endothelial cells shows that magnesium leads to increase eNOS and NO production and protects against atherosclerosis by improving endothelial function and reducing oxidative stress [13, 17]. In addition, magnesium can increase plaque stability by increasing eNOS, which leads to a better prognosis for atherosclerotic patients [17, 34–36].

Although in the present study, magnesium sulfate intake could not increase the expression level of the SIRT1 gene compared to the placebo group, but it is possible that magnesium can increase the expression of this gene in the endothelial cell of the vascular wall, which other studies on tissue samples are needed to show this role of magnesium. It is noteworthy that the SIRT1 gene is highly expressed in vascular endothelial cells [37].

In the present study, intake of magnesium sulfate for 3 months had no adverse effect on the liver function. The activity of two important liver enzymes including aspartate aminotransferase (AST) and alanine aminotransferase (ALT) (Table 2) was not changed before and after magnesium sulfate treatment, indicating this dose of magnesium has no side effects on the liver, and its consumption is safe.

Conclusion

Our findings demonstrate that magnesium sulfate supplementation for 3 months at a dose of 300 mg/day, could significantly increase the expression level of eNOS and reduce the TP53 mRNA level in atherosclerotic patients. These changes may have a protective role against the progression of atherosclerosis.

Funding

This research has been funded by the Hormozgan University of medical sciences.

Data Availability

The data are available from the corresponding author on reasonable request.

Declarations

Conflict of interest

The authors declare that they have no competing interests.

Ethical Approval

This research has been approved by the University Ethics Committee (IR.HUMS.REC.1398.295).

Consent to Participate

All participants were given informed consent and were properly informed of the procedure.