Skip to main content
Genes logoLink to Genes
. 2023 Jan 14;14(1):223. doi: 10.3390/genes14010223

Parvalbumin: A Major Fish Allergen and a Forensically Relevant Marker

Subham Mukherjee 1,2, Petra Horka 1, Kamila Zdenkova 3, Eliska Cermakova 2,3,*
Editor: John H Postlethwait
PMCID: PMC9858982  PMID: 36672964

Abstract

Parvalbumins (PVALBs) are low molecular weight calcium-binding proteins. In addition to their role in many biological processes, PVALBs play an important role in regulating Ca2+ switching in muscles with fast-twitch fibres in addition to their role in many biological processes. The PVALB gene family is divided into two gene types, alpha (α) and beta (β), with the β gene further divided into two gene types, beta1 (β1) and beta2 (β2), carrying traces of whole genome duplication. A large variety of commonly consumed fish species contain PVALB proteins which are known to cause fish allergies. More than 95% of all fish-induced food allergies are caused by PVALB proteins. The authentication of fish species has become increasingly important as the seafood industry continues to grow and the growth brings with it many cases of food fraud. Since the PVALB gene plays an important role in the initiation of allergic reactions, it has been used for decades to develop alternate assays for fish identification. A brief review of the significance of the fish PVALB genes is presented in this article, which covers evolutionary diversity, allergic properties, and potential use as a forensic marker.

Keywords: parvalbumin, fish identification, allergen, gene diversity, forensic marker

1. Introduction

Parvalbumins (PVALBs) are small-size calcium-binding proteins with molecular weights ranging from 10–12.5 kDa related in structure to calmodulin and troponin C. They are generally expressed in the highest quantity in fast-twitching muscles but are also expressed in other tissues and organs such as the brain and gonads of fishes [1,2]. PVALBs were first discovered in fish and amphibian muscle fibres in 1934 by Deuticke [3] and were later crystallised by Henrotte in 1952 [4] from carp muscle [1]. Despite being called “parvalbumin” by Pechère et al. [5] because of its low molecular weight and high solubility in water, it has no functional similarity to the protein serum albumin. In 1971, Pechère et al. highlighted its binding affinity towards Ca2+ [6]. In the following year, the 3D structure of PVALB, the first protein capable of binding calcium, was published [7].

Parvalbumins play a critical role in many biological processes. An essential function of PVALBs is to regulate the intracellular Ca2+ exchange in fast-twitch muscle fibres. The PVALB proteins are acidic (intracellular isoelectric point, pI: 4.1–5.2) and have a high affinity for Ca2+ and can bind two Ca2+ ions per molecule [8,9]. PVALB’s also aid in the relaxation process of fast-contracting muscles in vertebrates by carrying Ca2+ from troponin C to the sarcoplasmic reticulum via the ATPase pump [10]. Regulating the process is really important because, if Ca2+ switching in muscle fibres is left unchecked, it can cause shifts in Ca2+ homeostasis, ultimately leading to significant health issues such as Alzheimer’s in humans [11]. Moreover, PVALBSs have been observed to contribute to a variety of swimming forms in fish. Swimming form is a specific pattern of swimming behavior, such as a fast start or a C-bend [8,12]. In fish, the PVALB content in muscle varies from 0 to >1.5 mmol per litre [13]. In addition, the muscle relaxation rate varies longitudinally within a fish due to the variation in PVALB expression along its length [14]. Apart from this, PVALBs have also been detected immunohistochemically in non-muscle tissues, including bone, teeth, skin, brain, seminal vesicles, testes, and ovaries [2,15]. The parvalbumin protein belongs to the calcium-binding protein family of food allergens [16], and it has the ability to survive high temperatures such as many other food allergens [17,18], as well as enzymatic digestion and food processing systems [19]. The IgE reactivity of PVALB is, however, reported to decrease when the tissues are heated to 140 °C, as well as when various seafood processing methods are used [20,21].

The PVALB gene also provides an interesting marker for fish identification. The highly conserved four exons and three introns make it an appropriate tool for the authentication of fish species, as well as serving as a tool for forensic applications in case of fish frauds such as species substitution. This genomic marker provides an alternative to mitochondrial-based markers used for identification, which can be highly useful when comparing closely related fish species [22,23,24,25].

Fish muscles usually express 2–5 PVALB isoforms in their white muscle all through development from larval to adult forms [8], whereas a maximum of seven PVALB isoforms were detected in the white muscle of the adult common snook, Centropomus undecimalis [26]. Genetic polymorphism of PVALBs was observed in various fish species, including Cyprinus carpio, Carassius cavatus, Acanthopagrus schlegeli, Tinca tinca, etc. [2,27]. However, due to the wide-ranging distribution, species-specific expression, and unique electrophoretic mobility, together with exceptional stability, make PVALBs an excellent promising molecular marker for species identification [1].

This article reviews the significance of fish PVALB genes. We provide a brief summary about the fish PVALB evolutionary lineage and diversity in teleost fishes. We will also briefly describe the allergenic properties of PV, and its potential as a marker for fish identification, detection of allergens, and forensic application (Figure 1).

Figure 1.

Figure 1

Overview of the importance and applicability of fish parvalbumin.

2. Parvalbumin Gene Diversity

The PVALB gene family is divided into two gene types, alpha (α) and beta (β), with the β gene further divided into two gene types, beta1 (β1) and beta2 (β2). These two phylogenetically distinct gene types of PV, α and β, have different isoelectric points (α, pI > 5.0; β, pI < 4.5). Since PVALBs belonging to the α-gene type have fewer amino acid residues than the β-gene type, they have higher isoelectric points than the β-gene type. They also differ in their amino acid sequences [28,29]. While α-genes only express 95-111 amino acid residues, β-genes express 106-113 amino acids [30]. They also have different crystal structures, and physiological roles, as well as magnesium and calcium ion affinities. For example, PVALBs of the β-gene type bind more effectively to Ca2+ ions than α-lineage PVALBs (200% better affinity), but in the case of Mg2+ ions, β-gene type PVALBs only have a 16% better affinity [31,32]. In the case of fishes, bony fishes predominantly express β-PVALB in muscle tissue while cartilaginous fishes (e.g., rays and sharks) express α-PVALBs in muscle tissue, resulting in lower allergic incidence in cartilaginous fishes. Through X-ray diffraction spectroscopy, it has been shown that the PVALB protein can be divided into three domains: AB, CD, and EF. While AB domains play a crucial role in protecting the hydrophobic core of the protein as well as hydrophobic parts of the functional EF hands from solvents, CD and EF domains are involved in the calcium-binding system (Figure 2) [33]. The EF domain is the most well-defined and has been used to characterise the canonical EF-hand Ca2+ binding motif [34].

Figure 2.

Figure 2

Parvalbumin structure. (1) Carp parvalbumin beta protein ribbon structure. Six helixes (A, B, C, D, E, F) and two Ca2+ ions (Arrow) [35]; (2) Carp parvalbumin gene structure. Four exons (Yellow) and three introns [36].

Regardless of overall structural similarity to β genes, α-PVALB is generally non-allergic in fishes. However, α-PVALBs in frog, chicken, and crocodile meat also act as allergens in humans. While sequencing has revealed that chances of cross-reactivity between fish PVALBs with its mammalian or avian homologs is low and IgE cross-reactivity is unlikely it is still advisable for sensitized consumers to ascertain caution when consuming these products [37]. On the molecular level β isoforms also differ significantly from α isoforms. For example, alignment of the sequencing data of three PVALB gene types of Atlantic salmon (Salmo salar) reveals that a higher similarity is observed between the two β-gene types than between the α-gene and either β-gene types. When PVALB β1 and β2 were compared amongst each other 71.8 % nucleotide similarity was observed. However, the similarity was significantly reduced to 61.1 % when PVALB α and PVALB β isoforms were compared [2].

The parvalbumin gene family, such as that of the HOX gene family, is a conserved gene and carries traces of whole genome duplication [38]. The origin of PVALB-α, PVALB-β1and PVALB-β2 gene types have been attributed to vertebrate ancestors [39]. The diversity of PVALB genes is a possible result of the occurrence of vertebrate-specific whole genome duplication. In a recent study by Mukherjee et al. [2], a high diversity of PVALB genes was observed in teleost fishes. Apart from ancestral vertebrate gene duplication, several teleost lineages such as the Salmoniformes, Cyprinidae, and Sturgeons underwent additional lineage-specific duplication events giving rise to even more clusters of PVALB genes with higher diversity. The study reported a variable number of PVALB gene copies within the teleosts, from seven copies in Esox Lucius (Pike) to 22 copies in S. salar (Atlantic salmon) (Figure 3).

Figure 3.

Figure 3

Phylogentic relation of parvalbumin in selected species of the teleost fishes and a non-teleost outgroup. Parvalbumin genes found in the selected fish genomes are shown in groups and coloured by the parvalbumin gene type, i.e., PVALB-α in pink, PVALB-β1 in green, and PVALB-β2 in blue The phylogenetic relation is according to the work of Mukherjee et al. [2].

The diversity of the three PVALB genes was also observed among non-bony fish vertebrates such as Callorhinchus milii (ghost shark), Gallus gallus (chicken), Homo sapiens (human), Rattus norvegicus (mouse), and Xenopus laevis (frog). Amongst the three gene types, the PVALB β2 gene was the most diverse in teleost fishes, with salmon possessing up to 14 copies of the ancestral PVALB β2. Homo sapiens (humans) possess one PVALB α, one PVALEF, two oncomodulin {OCM (OCM, OCM2)}, and three calmodulin (CALM) genes. Oncomodulin genes OCM and OCM2 are both similar to the fish PVALB β1 gene. Belonging to the EF-hand protein family, oncomodulin genes express proteins to increase the calcium-ion binding affinity. These proteins are also found in early embryonic cells in the placenta and can also be found in tumors [40].

While this gene (PVALB β2) is most diverse in teleost fishes, it is absent in mammals such as humans and mice [2]. Due to the presence of all three isoforms in a single species, as observed in teleost’s fishes, a layered complexity is added for diagnosing, detecting, and effectively managing allergic PVALB [41]. So, albeit having α, β1, and β2, the gene types are also present in multiple copies. Phylogenetic analysis along with structural and biochemical investigations have assigned α and β PVALBs as separate clusters [2]. While the α subtype is present in humans and other vertebrates such as the house mouse (Mus musculus), subtype β2 is absent in them. The allergenicity of these two gene types may be due to the distantly separated clusters of PVALBs.

3. Parvalbumin—A Major Fish Allergen

Food allergy is an immunologically based adverse reaction to food or food additives. Allergies caused by foods are deemed a significant hazard to public health, particularly for those sensitive to an allergic reaction. Peanuts, soy, milk, shellfish, fish, and tree nuts are some common foods that induce allergic reactions [42]. These food sources contain high levels of allergens, which remain stable when processed and digested in the body [43]. While some allergens degrade during the process of digestion, their fragments are still identified by IgE antibodies that instigate an allergic reaction [44].

Nowadays, fish allergy is one of the most frequently occurring food allergies among children and adults [45]. Fish is an integral part of the human diet and nutrition since it is rich in essential lipid-soluble vitamins, polyunsaturated fatty acids (such as docosahexaenoic acid and eicosapentaenoic acid), and essential amino acids. Even though fish intake in landlocked countries continues at a reasonably stable state, the overall demand for fish and fish products continues to increase worldwide [45,46].

PVALBs are responsible for more than 95% of fish-induced food allergies [28]. Studies provide evidence that the PVALB protein is a fish allergen for a wide range of commonly consumed species, including salmon, carp, mackerel, tuna, and pilchard [47,48]. Due to the high cross-reactivity of β-PVALB from different species, more than 90% of people sensitive to fish usually have allergic reactions to several species of fish. Researchers found a 50% possibility of reacting to PVALB from more than one fish species [49,50,51]. The allergen cross-reactivity can be evaluated by comparing amino acid sequences of isoallergen. While certain fishes such as S. salar (Atlantic salmon) and Rastrelliger kanagurta (Indian mackerel) possess only one PVALB isoallergen, others such as Gadus morhua (Atlantic cod), Lates calcarifer (Baramundi), and Clupea harengus (Atlantic herring) contain more than one (Table 1). Fish species that are closely related also exhibit marked clinical cross-reactivity. A significant number of food-allergic individuals may suffer severe health problems due to unintentionally consuming products containing undeclared seafood [52]. Cross-reactive PVALB epitopes are located in highly conserved protein regions, especially at the ion-binding sites [53]. Oral allergy syndrome and rhinitis are general clinical manifestations, as well as diarrhea, abdominal pain, angioedema, urticaria, asthma, and, in severe cases, life-threatening anaphylactic reactions.

Table 1.

Fish and non-fish parvalbumin allergens registered with the WHO (www.allergen.org (accessed on 15 November 2022)).

Name of Allergen Organism Biochemical Name Genbank Nucleotide Accession no. Reference
Scientific Name Common Name
Fish species
Clu h 1 Clupea harengus Atlantic herring β-parvalbumin FM178220 [61]
FM178221
FM178222
Cten i 1 Ctenopharyngodon idella Grass carp β-parvalbumin MK140606 [62]
Cyp c 1 Cyprinus carpio Common carp β-parvalbumin AJ292211 [63]
AJ292212
Gad c 1 Gadus callarias Baltic cod β-parvalbumin [64]
Gad m 1 Gadus morhua Atlantic cod β-parvalbumin AY035584 [65]
AM497927
AY035585
AM497928
lat c 1 Lates calcarifer Baramundi β-parvalbumin AY688372 [66]
KF021278
AY626068
KF021279
AY688373
Lep w 1 Lepidorhombus whiffiagonis Megrim, whiff, turbot fish β-parvalbumin AM904681 [19]
Onc m 1 Oncorhynchus mykiss Rainbow trout β-parvalbumin not specified [67]
Pan h 1 Pangasianodon hypophthalmus Striped catfish β-parvalbumin XM_026916202 [68]
XM_026947968
Ras k 1 Rastrelliger kanagurta Indian mackerel parvalbumin KX527884 [69]
Sal s 1 Salmo salar Atlantic salmon β-parvalbumin 1 X97824 [70]
Sar sa 1 Sardinops sagax Pacific pilchard β-parvalbumin FM177701 [47]
Sco s 1 Scomber scombrus Atlantic mackerel parvalbumin FM994926 [48]
Seb m 1 Sebastes marinus Ocean perch, redfish β-parvalbumin FM178218 [71]
FM178219
Sole s 1 Solea solea Sole parvalbumin [72]
Thu a 1 Thunnus albacares Yellow fin β-parvalbumin FM178217 [73]
Xip g 1 Xiphias gladius Swordfish β-parvalbumin FM202668 [19]
Non-fish Species
Cro p 1 Crocodylus porosus Australian saltwater crocodile β-parvalbumin XM_019542160 [74]
Cro p 2 α-parvalbumin XM_019544844
Gal d 8 Gallus domesticus Chicken α-parvalbumin FM994924 [75]
[76]
Ran e 1 Rana esculenta (Pelophylax esculentus) Edible frog α-parvalbumin AJ315959 [77]
Ran e 2 Rana esculenta (Pelophylax esculentus) Edible frog β-parvalbumin AJ414730

For allergy sufferers, the only effective way to prevent an adverse reaction in the event of exposure to the allergenic food is to avoid seafood altogether or, in the case of accidental exposure, to use therapeutic treatment (e.g., antihistamines, corticosteroids, epinephrine) [54]. However, it has been shown that even patients with extreme fish sensitivities can consume certain kinds of fish, such as tuna, without an untoward event [55,56]. In addition, molecule-specific epitope regions are known, such as PVALBs from salmonid fish, explaining a limited cross-reactivity with these species. Nonetheless, there are substantial differences in PVALB content between fish species, and these variations correlate with differences in the allergenicity of fish PVALBs [28,57]. For example, Kuehn et al. [28] demonstrated that the PVALB level in fish muscles is up to 100 times higher for carp than mackerel or tuna. They found an average of <0.05 mg/g PVALB in tuna; 30.7 mg/g in mackerel; 12.5 mg/g in salmon, trout, and cod; and >2.5 mg/g in carp, herring, and redfish. The amount of PVALB depends not only on the fish species but also on the method of preparation. PVALB allergenicity decreases due to fish processing through cooking, baking, and smoking; due to this variability, people with a clinically relevant sensitization to PVALB may still eat processed fish with a lower concentration of PVALB without a reaction. In the case of fish allergen PVALB, isoforms and the extent of thermal processing influence antibody reactivity. Saptarshi et al. [18] validated this by comparing PVALBs in a wide-range of fishes (raw and heated fish extracts) from the Asia-Pacific region through immunoblotting experiments. They found variations in the thermal stability of PVALB within the tested fish genera, and their results demonstrate that heat processing the antigen significantly affects the reactivity of antibodies to PVALBs. Human antibodies reacted less strongly to multimeric bony fish PVALBs after heating, whereas antibodies lost reactivity completely in cartilaginous fish.

Apart from clinical advances, it has become imperative to improve consumer protection through an accurate food labelling system preventing potentially life-threatening risks for sensitized/allergic individuals [58]. According to recent European Union (EU) regulations, food manufacturers are required to declare the presence of 14 food groups classified as potentially allergenic, namely fish, crustaceans, molluscs, celery, mustard, sesame seeds, gluten, tree nuts, peanuts, milk, eggs, soybeans, lupins and sulphites, and highlighting them from the list of other ingredients [59].

As of 2022, there are more than 290 entries in the Allergome database (www.allergome.org) for fish PV and its isoforms and allergens [60]. Out of these 290, 27 isoforms from 17 fish species are registered and documented with the World health organization (WHO) and the International Union of Immunological Societies (IUIS) (Table 1).

4. Forensic Application of Parvalbumin

The seafood industry is ever-increasing and as the industry expands, the issue of authentication of fish species becomes more imperative. With the increase in fish consumption and an uncertain supply and demand chain, cases of the surreptitious substitution of one species with another (fish fraud) are on the rise. While fish fraud not only amounts to economic deception, it can also have a detrimental effect on consumers’ health due to species-specific antigenicities discussed above and environmental management programs for endangered species. Regulatory authorities such as US FDA, FAO, and EU have established laws for labelling fish products to prevent product substitutes, however, these regulations can be difficult to enforce when morphological fish identification is not possible. Hence, apart from the enforcement of labelling regulations, research into various analytical methods for fish identification is carried out to overcome challenging situations such as precooked and frozen seafood.

Fishes are particularly unidentifiable through their external features in the case of landlocked countries since most fish is imported in the form of compact frozen blocks of meat or fillets [78]. Taxonomical identification is an ideal method for identifying fish species to prevent adulteration of fish, however, it is compromised when distinguishing features are removed (for example, head, fins, scales, and skin in fish) or if the specimen has been cooked. It may also be difficult to ascertain the geographic origin and also to visually identify fish due to the phenotypic resemblances of some fish species [79]. In many instances, globally, fraudsters take advantage of this fact and intentionally mislabel fish products by substituting a species of high worth with a low-priced alternative. Experts anticipate an increase in cases of food fraud due to COVID-19 regulations since there have been reduced private sector food inspections and audits and limitations in supply and demand [80,81]. Therefore, it is essential that standardized, accurate, and simple fish identification methods should be developed that have global use.

A number of assays and methodologies have been used to tackle the problem of fish identification in the past few decades. Since the PVALB gene plays an important role in inducing allergenic reactions, it has been used for decades to design assays to be used as an alternate approach for fish authentication. The assays can be broadly divided into protein-based assays that include electrophoretic [22,82], chromatographic [83] or immunological [84] methods, and DNA-based assays (PCR with species-specific or universal primers, DNA microarray) [85,86,87,88], and biosensor based assays [89,90].

4.1. Protein-Based Assays

Parvalbumin proteins can be regarded as a suitable biomarker for fish species authentication and have been detected and quantified using a variety of protein-based assays [91]. PVALB proteins are expressed in high concentrations in fish muscle and also have high interspecies variability. The interspecies variability of PVALB sequences is fundamental for the discrimination of different fish species as assessed by earlier proteomic analyses performed on species belonging to the Merlucciidae family (hake’s) [92]. PVALB solubility in aqueous buffers makes the extraction protocol both easy and extremely quick. The structural stability of PVALBs even under harsh conditions such as heat is paramount to utilising these biomarkers also for the authentication of fish species sold as thermally processed products [93,94].

Earlier, isoelectric focusing (IEF) was one of the most widely used methods for fish identification [95]. Urea IEF and IEF in immobilized pH gradients (IPG) have great practical significance in the analysis of both fresh and boiled samples. However, in urea IEF, standard marker proteins cannot be used due to modification of their conformation, which impacts their isoelectric points. [95,96]. In place of standard marker proteins, known fish PVALBs can serve as marker proteins in IEF gels for unknown PVALBs due to their thermostable properties and may also be employed in database generation for the differentiation and identification of diverse fish or other specimens [8]. Dobrovolov et al. [97] demonstrated the ability to differentiate various species of sturgeons and their origin using the IEF of sarcoplasmic protein (general muscle protein such as lactate dehydrogenase, malate dehydrogenase, or malic enzyme). Using a similar principle, PVALB was detected in three sturgeon species, Acipenser baeri, A. gueldenstaedtii, A. ruthenus [98]. Authentication of closely related scombrid, catfish, and tilapia species by isoelectric focusing of PVALB also provided a rapid screening method for identification [22]. IEF was also used to study mislabeling in cases of various Alaskan flatfishes in German meat markets [99].

In addition to IEF, tandem mass spectrometry has been used to define the structure of protein isoforms that are essential to understanding cross-reactivity among various allergenic proteins [100]. More recently, exploiting the improved performance of new instruments such as Fourier-transform ion-cyclotron resonance (FTICR) mass spectrometers and linear ion trap (LIT) mass spectrometers, innovative strategies for the extensive characterization of PVs have been proposed. These studies led to the de novo sequencing of 25 isoforms from all commercial species of the Merlucciidae family and the rapid and direct detection of the presence of fish allergens in all of the investigated food products [94,101]. Detection of allergens with high levels of sensitivity was also achieved by employing an optimized protein chip [102]. These assays were useful in detecting fish allergens thus increasing consumer safety.

MALDI-MS can be used in the quality control processes including the main issues of fish authentication and fraud detection. Apart from MALDI-MS, the application of MALDI-TOF in the mass spectra of sarcoplasmic proteins allows the authentication of fish species. Targeted proteomics has been applied to assess fish authenticity and detect allergens. Proteomics offers tools potentially suitable as routine tests in food authentication [103]. PVALBs exhibit a high ionization efficiency in MALDI-TOF MS analysis so that, regardless of the complexity of the analyzed sarcoplasmic extracts, the obtained mass spectra predominantly show signals originating from these proteins [100,104]. Proteomic studies integrating two-dimensional electrophoresis (2-DE) with MALDI-TOF MS peptide mass mapping for protein identification allowed the characterization of the 2-DE PVALB-specific pattern and the definition of a set of specific tryptic peptides suitable for the identification of nine hake species [105,106].

Studies have shown that immunoassays, including indirect ELISA and Western blotting, are the primary tools for detecting fish allergen changes following processing [107]. Despite being primary tools, immunoassays might be inaccurate due to cross-reactivity with nontarget allergenic proteins, and they might not be specific enough to detect allergens [108]. MALDI-MS also have certain disadvantages, such as in some cases, the inability of the system to differentiate between two related species may be due to the inherent similarity of the organisms themselves. Another reason that similar species may be incorrectly identified is a lack of sufficient spectra in the database. If this occurs, it is possible to obtain an incorrect species-level identification or no identification at all [109]. Hence, to overcome the limitations possessed by protein-based methods, DNA-based approaches for fish identification are intrinsically independent of biomolecular interactions and are thus slowly gaining more interest than protein-based methods [110].

4.2. Using DNA-Based Assays for Fish Identification

The genetic identification of species is based on DNA polymorphisms or genetic variations caused by naturally occurring mutations in the DNA [111]. The PVALB gene is a conserved gene with highly conserved exons in the protein-coding part of the PVALB gene, separated by three introns that are unique among various fish species [88]. PVALB can be used as an interesting universal marker for fish identification and allergen detection, as Sun et al. [25] and Rehbein [88] demonstrated. Both universal and species-specific assays have been designed in recent times for better detection of PVALB genes (Table 2).

Table 2.

Universal and species-specific primers that have been used for detection of PVALB genes.

Organism Primer Name Primer Sequence (5′-3′) Amplification Length (BP) Amplification Region Reference
Scientific Name Common Name
Universal IFF232 GACAAGAGCGGCTTCATTGAGG 268 β-parvalbumin [122]
IFF233 TCAACTCCAATCTTGCCATCACCAT Exon 3 to Exon 4
Universal IFF 233a TCAATACCGATCTTGCCATCACCGT NA [123]
IFF 233b TCAACTCCGATCATGCCATCACCAT
Universal SUN-F CAGGACAAGAGTGGCTTCAT 57 β2-parvalbumin [25]
SUN-R GAAGTTCTGCAGGAACAGCTT Exon2 to Exon 3
probe AGGAGGAYGAGCT
C. harengus Atlantic herring Pacific herring CluHaPaF CCGCTGATGATGTGAAGAAG 189 β2-parvalbumin [124]
Clupea pallasii CluHaPaR GCAGGAACAGCCTGAGAGAG Exon 2 to Exon 3
Cyprinus carpio Carp MA-f ACAAGCTTATGGCTTTCGCCGGAATTCTGA β-parvalbumin [125]
MA-r ATCGGATCCTATGCCTTGATCATGGC
G. morhua Atlantic cod rGad m 1.01 ATGGCATTCGCTGGAATTCTCG 599
rGad m 1.02 ATGGCTTTCGCCGGAATTCTG 797
Lophius piscatorius Lophius budegassa White anglerfish DAS-F ACAACTTTCCCCGAGAAGC 196 β2-parvalbumin [126]
Black-bellied anglerfish DAS-R ACAACATCACAGTTTAAGTTTTGC Exon 2 to Exon 3
Oncorhynchus mykiss Rainbow trout 601F9 forward AGACAGAGACACAGGTTGGCTTACTATTCT 75 β-parvalbumin [24]
601G0 reverse TTTACGACATAGGGAGCAGCTTACTATTCT Intron 2
Paralichthys olivaceus Japanese flounder sunF GATGACACCATATGTCTCTGGCATCTAAGCTGTCTG 327 β-parvalbumin [127]
sunR GTGTCCTCGAGTTACTGTTTCACCATCGCCGC
S. salar Atlantic salmon 601F5 forward AGACAGAGACACAGGTTGGCTTACTATTCT 126 β-parvalbumin [24]
601F6 reverse TTTACGACATAGGGAGCAGCTTACTATTCT Intron 2
S. salar Atlantic salmon Sense PV AGYGGCTTYATHGARGARGAYGARYT 430 β2-parvalbumin [70]
Antisense PV1 YTGYTTNACNAANACNGCRAAYTC Exon 2 to Exon 4
Antisense PV2 GAATTCRTCRACHCCDATYTTHCC
S. salar Atlantic salmon IFF 156 ATGGCCTGTGCCCATCTGTGC 300 β1-parvalbumin [122]
IFF 157 GGACTTCGAGGCAAAGCCAAT Exon 1 to Exon 2
S. salar Atlantic salmon Psal1 CTGTGCCCATCTGTGCAAGG 650 β1-parvalbumin [128]
Oncorhynchus mykiss Rainbow trout Psal2 CCAATCATGCCATCACCATCG Exon1 to Exon 3
Salmo trutta Brown trout Psal3 TACCGATGCAGAGACAAAGG 931 β1-parvalbumin
Salvelinus alpinus Arctic char Psal4 GTCTTGGGCAATATTGTTCC 3′ end of Exon 3 to Exon 4
Scomber japonicus Mackerel SJ9 CCCTACAAAGCAAAAACATC 1500 β-parvalbumin [129]
SJ487 GCATAGGAGGAAAGGICTCT
SJ106 GTAGITTCGACCACAAAAAGTT 190 β-parvalbumin
SJG441r ACTGCTGTATAGGTGATAGG Exon 2 to Intron 2
SJG107f AGCTATTCTGTATCGCTTCG 284 β-parvalbumin
SGG297r GGTGTGAGTCTTACTTCAGC Intron 1 to Intron 2
S. scombrus
Trachurus trachurus
Atlantic mackerel
Atlantic horse mackerel
Pval1Fw CTGAAGCTGTTCCTGCAGAACTT 87 β-parvalbumin [130]
Pval1Rev GCTGTCACCGGCCTTGAG
Pval1Probe [6FAM]TCCGACGCCGAGACCAAGGC[TAM] Intron 2 to Exon 3
Spondyliosoma cantharus Black seabream 1189B6 TGAGCTGAAGTAAGACACTCAGGAA 78 β-parvalbumin [23]
1189B7 TCTAAAATGTTGTCTTGGTGCCTTAG
1273H9(probe) TGCACACTTGAGCAAGCAATGGCC Intron 2
Spondyliosoma cantharus Black seabream 601F7 forward AGACAGAGACACAGGTTGGCTTACTATTCT 79 β-parvalbumin [24]
601F8 reverse TTTACGACATAGGGAGCAGCTTACTATTCT Intron 2
Thunnus albacares Yellowfin tuna ALB4F AGGATTGGATTTTCTGTCTTAGCTT 227 β-parvalbumin [22]
ALB4R TCAGTTTGTGTCAATTGGTCTGTAG Intron 2
PARVT1F GGGGTTGGAGATGAATGGCA 785 β-parvalbumin
PARVT1R GAGTCACCGGCCATGAGAAA Intron 1 to Exon 3
PARVT2F ACAGCTGCCGACTCTTTCAA 670 Parvalbumin β
PARVT2R CGGCCATGAGAAATGCCTTG Intron 1/Exon 2 to Exon 3

NA = Not available in the reference.

DNA-based methodologies follow an indirect approach to detecting allergens because they identify the DNA sequences from the allergenic food components rather than detecting the allergenic protein itself [112]. DNA is overall more stable than proteins, particularly when subjected to thermal treatments. Even though DNA may fragment at high temperatures, it is still detectable [25]. DNA-based methodologies thus have a significant advantage over other methods and as a result, DNA-based methods are especially useful to analyze highly processed foodstuffs, emphasizing their important role in the management of allergens in the food industry [113,114].

The most frequent markers used for fish identification are found in the mitochondrial genome, such as cytochrome oxidase 1 (COI) and Cytochrome b (Cyt b). Due to the fact that mitochondrial genes are a part of a large number of copies in fish tissues, and their mutation rate is much higher than that of nuclear genes, mitochondrial gene loci are usually relied upon for species identification in fish, primarily as a result of their characteristics such as being part of a haploid genome with a high copy number [88,115]. Due to the fact that mitochondrial genes are small and mitochondria are numerous and relatively easy to isolate, mitochondrial genes are widely used for species identification. Additionally, the number of mitochondrial DNA (mtDNA) gene sequences available in public databases has rapidly increased, making it relatively easy to compare a test sequence with previously identified samples.

However, in the last few years, markers residing in the nuclear genome have also started to play an essential role in constructing such species-identification assays. Although mitochondrial DNA has quite a few advantages when compared to nuclear DNA, some disadvantages must be considered [116]. Although mtDNA markers can separate species, they can sometimes be uninformative while separating closely related species, such as in the case of Thunnus species [117] and in cases of mixed products. The mixed product can be manufactured by combing premium quality tuna with tuna of lower quality and price. The sequencing of mtDNA also has the significant disadvantage of potentially introducing nuclear mitochondrial pseudogenes (numts), which are mitochondrial-derived non-functional nuclear sequences [118,119]. In contrast, amplifying nuclear sequences (markers) can overcome these problems while providing fairly high levels of uniqueness even in closely related fish species [23,88,120].

The identification of certain species has also been proposed using novel nuclear regions, such as the flatfish genome [121]. DNA can be amplified even in highly processed foods since nuclear DNA (nDNA) barcodes tend to be shorter than mtDNA barcodes. Next-generation sequencing (NGS) can be conducted on DNAs extracted from these foods as they are easy to read. As a result, species can be identified even in samples containing several species [121].

Previous reports showed that the PVALB protein of bony fishes could be encoded by different paralogs genes that contain the same number of exons and introns but whose introns differ in size and nucleotide sequence, such as the Parv β1 polymorphic site in salmonoids, which was demonstrated by Muñoz-Colmenero et al. [128]. Each orthologous exon contains an identical number of nucleotides in all the paralogs, for example, the exon sequence of PVALB β1 of carp (Cyprinus carpio) and rainbow trout (Oncorhynchus mykiss) is 330 bp long [131,132,133]. Rencova et al. [124] demonstrated a fast, simple, specific, and sensitive PCR assay for the detection of PVALB in two closely related herring species (C. harengus and C. pallasii). Additionally, PVALB species-specific primers were used to authenticate closely related species of scombrid, catfish, and tilapia [22]. These results validate the use of DNA-based assays for cheap, routine screening methods for PVALB allergens in fish and food products.

Conserved PVALB exon sequences can be used to design universal PCR primers that amplify a species-specific intron, as well as regions of the exons flanking the intron, from even very distantly related fish species, such that fish species identification could be achieved by using probes that target a species-specific intron region [134]. EPIC (Exon primed intron crossing) PCR makes use of this property demonstrating the suitability of nuclear intron sequences as molecular markers for PCR-based species determination and subsequent real-time PCR-based quantification of the extent of each species in a complex mixed sample [25,88]. The use of the PVALB gene for fish identification and their quantification in commercial products is well documented in the literature. Results obtained confirmed the possibility of using the PVALB gene for forensic application in the fish trade and food industry.

4.3. Methods of Parvalbumin Allergen Quantification

Apart from the traditional assays based on protein and DNA detection, biosensor detection of PVALB for fish authentication is a developing field. Biosensors are integrated receptor-transducer devices that convert biological recognition events into measurable chemical, and physical signals proportional to the target concentration. Depending on the target allergen, the receptor might be an antibody raised against it, a single-strand DNA molecule that hybridizes with the allergen-specific DNA fragment, or an aptamer that recognizesthe allergen directly. To detect PVALB a fluorescence sensor was developed by Jiang et al. [89] exhibiting the possibility of quantification of fish PVALB. They also demonstrated its utility for food allergen and detection. Similarly, kinetic analysis by a surface plasmon resonance biosensor was performed to understand the parvalbumin antigen-antibody interaction, providing a fast and powerful tool for allergen detection and quantification [135]. Recently a gold nanoparticle aptasensor was developed for PVALB detection [136]. While gold-based nanoparticles offer an excellent platform for developing rapid, low-cost, portable biosensors for food safety detection, they also have certain drawbacks. For example, colour changes of gold particles can be difficult to interpret in cases of low concentration. Further stability issues of the sensor may change over time giving inaccurate results [137]. While biosensors provide a good alternative in the field of food safety and allergen detection, it is necessary to address the drawbacks before moving forward.

5. Future Outlook

The PVALB gene, usually present in fish’s muscle tissue, is a major fish allergen affecting humans. The presence of three gene types (PVALB α, PVALB β1, and PVALB β2) makes detecting and managing these allergens difficult. A high level of cross-reactivity between species is observed without proper knowledge of the cause of the cross-reactivity. Though significant innovations and efforts have been made in recent times to study and control food allergies, further work is still required. While the scientific community has managed to identify new isoforms successfully, some work is still needed to develop standardised methodologies and assessment tools to detect and quantify PVALBs easily, quickly, and efficiently. Developing reliable, rapid, on-site allergen-detection methods showing high accuracy and sensitivity are future research needs for seafood products that will benefit the food industry and make food products healthier for consumers. However, avoiding allergenic seafood intake is still the only standard way for clinical protection of seafood-allergic patients. Consequently, it is imperative to conduct in-depth research into the therapeutic hypoallergenic treatment of PVALB in order to decrease the risk of seafood allergy and provide a safe environment for global consumers. Studying trends in the incidence of fish allergies is also critical to understanding the burden of allergic disease. Unfortunately, no robust studies have been conducted to assess food/fish allergy prevalence trends over time. This lapse could be the result of the data gap that exists between recorded statistics and real allergy diagnostics based on DBPCFC (Double Blind Placebo Controlled Food Challenge).

With the increase in cases of fish substitutions and fish fraud, reliable methods are needed to detect and identify fish products. The PVALB gene has high variability which makes it a reliable marker for fish identification. PVALB assays could be used as a tool to control species mislabeling of samples containing closely related fish species. At the same time, efforts have been made to develop authentication tools for commercial purposes by cataloguing SNPs. There is a need to find out and catalogue more SNPs of species of commercial interest. Since most studies are focused on the northern hemisphere, data available from the southern hemisphere is still sparse. Filling this data gap is essential in cataloguing SNPs enabling the development of more reliable and efficient tools that can be applied around the globe.

Author Contributions

Conceptualization, S.M. and E.C.; formal analysis, S.M.; investigation, S.M., E.C., P.H., K.Z.; resources, S.M., E.C., P.H., K.Z.; data curation, S.M.; writing—original draft preparation, S.M., E.C., P.H., K.Z.; writing—review and editing, S.M. and E.C.; visualization, S.M. and E.C.; supervision, E.C.; project administration, E.C., P.H., K.Z.; funding acquisition, E.C. and P.H. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This research was financially supported by the Ministry of Agriculture of the Czech Republic [grant No. QK1910231 and the institutional support MZE-RO0318].

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Arif S.H., Jabeen M., Hasnain A. Biochemical characterisation and thermostable capacity of parvalbumins: The major fish-food allergens. J. Food. Biochem. 2007;31:121–137. doi: 10.1111/j.1745-4514.2007.00104.x. [DOI] [Google Scholar]
  • 2.Mukherjee S., Bartoš O., Zdeňková K., Hanák P., Horká P., Musilova Z. Evolution of the Parvalbumin Genes in Teleost Fishes after the Whole-Genome Duplication. Fishes. 2021;6:70. doi: 10.3390/fishes6040070. [DOI] [Google Scholar]
  • 3.Deuticke H.J. Űber die Sedimentationskonstante von Muskelproteinen. Physiol. Chem. 1934;224:216–228. doi: 10.1515/bchm2.1934.224.5-6.216. [DOI] [Google Scholar]
  • 4.Henrotte J.G. A crystalline constituent from myogen of carp muscles. Nature. 1952;169:968–969. doi: 10.1038/169968b0. [DOI] [PubMed] [Google Scholar]
  • 5.Pechère J.F. Muscular parvalbumins as homologous proteins. Comp. Biochem. Physiol. 1968;24:289–295. doi: 10.1016/0010-406X(68)90978-X. [DOI] [PubMed] [Google Scholar]
  • 6.Pechère J.F., Capony J., Ryden L. The primary structure of the major parvalbumin from hake muscle. Eur. J. Biochem. 1971;23:421–428. doi: 10.1111/j.1432-1033.1971.tb01636.x. [DOI] [PubMed] [Google Scholar]
  • 7.Nockolds C.E., Kretsinger R.H., Coffee C.J., Bradshaw R.A. Structure of a calcium binding carp myogen. Proc. Natl. Acad. Sci. USA. 1972;69:581–584. doi: 10.1073/pnas.69.3.581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Arif S.H. A Ca2+-binding protein with numerous roles and uses: Parvalbumin in molecular biology and physiology. BioEssays. 2009;31:410–421. doi: 10.1002/bies.200800170. [DOI] [PubMed] [Google Scholar]
  • 9.Heizmann C.W. Ca2+-Binding proteins of the EF-hand superfamily: Diagnostic and prognostic biomarkers and novel therapeutic targets. Methods Mol. Biol. 2019;1929:157–186. doi: 10.1007/978-1-4939-9030-6_11. [DOI] [PubMed] [Google Scholar]
  • 10.Nogueira L., Gilmore N.K., Hogan M.C. Role of parvalbumin in fatigue-induced changes in force and cytosolic calcium transients in intact single mouse myofibers. J. Appl. Physiol. 2022;132:1041–1053. doi: 10.1152/japplphysiol.00861.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ge M., Chen S., Huang Y., Chen W., He L., Zhang Y. Role of calcium homeostasis in Alzheimer’s Disease. Neuropsychiatr. Dis. Treat. 2022;18:487. doi: 10.2147/NDT.S350939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Berchtold M.W., Brinkmeier H., Műntener M. Calcium ion in skeletal muscle: Its crucial role for muscle function, plasticity and disease. Physiol. Rev. 2000;80:1215–1265. doi: 10.1152/physrev.2000.80.3.1215. [DOI] [PubMed] [Google Scholar]
  • 13.Gillis J.M. Relaxation of vertebrate skeletal muscle. A synthesis of the biochemical and physiological approaches. Biochem. Biophys. Acta. 1985;811:97–145. doi: 10.1016/0304-4173(85)90016-3. [DOI] [PubMed] [Google Scholar]
  • 14.Coughlin D.J. Aerobic muscle functions during steady swimming in fishes. Fish Fish. 2002;3:63–78. doi: 10.1046/j.1467-2979.2002.00069.x. [DOI] [Google Scholar]
  • 15.Celio M.R., Heizmann C.W. Calcium-binding protein parvalbumin as a neuronal marker. Nature. 1981;293:300–302. doi: 10.1038/293300a0. [DOI] [PubMed] [Google Scholar]
  • 16.Radauer C., Bublin M., Wagner S., Mari A., Breiteneder H. Allergens are distributed into few protein families and possess a restricted number of biochemical functions. J. Allergy Clin. Immunol. 2006;121:847–852. doi: 10.1016/j.jaci.2008.01.025. [DOI] [PubMed] [Google Scholar]
  • 17.Lopata A.L., Jeebhay M.F. Airborne seafood allergens as a cause of occupational allergy and asthma. Curr. Allergy Asthma Rep. 2013;13:288–297. doi: 10.1007/s11882-013-0347-y. [DOI] [PubMed] [Google Scholar]
  • 18.Saptarshi S.R., Sharp M.F., Kamath S.D., Lopata A.L. Antibody reactivity to the major fish allergen parvalbumin is determined by isoforms and impact of thermal processing. Food Chem. 2014;148:321–328. doi: 10.1016/j.foodchem.2013.10.035. [DOI] [PubMed] [Google Scholar]
  • 19.Griesmeier U., Vázquez-Cortés S., Bublin M., Radauer C., Ma Y., Briza P., Fernández-Rivas M., Breiteneder H. Expression levels of parvalbumins determine allergenicity of fish species. Allergy. 2010;65:191–198. doi: 10.1111/j.1398-9995.2009.02162.x. [DOI] [PubMed] [Google Scholar]
  • 20.Kubota H., Kobayashi A., Kobayashi Y., Shiomi K., Hamada-Sato N. Reduction in IgE reactivity of Pacific mackerel parvalbumin by heat treatment. Food Chem. 2016;206:78–84. doi: 10.1016/j.foodchem.2016.03.043. [DOI] [PubMed] [Google Scholar]
  • 21.Pérez-Tavarez R., Moreno H.M., Borderias J., Loli-Ausejo D., Pedrosa M., Hurtado J.L., Rodriguez-Pérez R., Gasset M. Fish muscle processing into seafood products reduces β-parvalbumin allergenicity. Food Chem. 2021;364:130308. doi: 10.1016/j.foodchem.2021.130308. [DOI] [PubMed] [Google Scholar]
  • 22.Abdullah A., Rehbein H. The differentiation of tuna (family: Scombridae) products through the PCR-based analysis of the cytochrome b gene and parvalbumin introns. J. Sci. Food Agric. 2016;96:456–464. doi: 10.1002/jsfa.7111. [DOI] [PubMed] [Google Scholar]
  • 23.Akhatova D., Laknerova I., Zdenkova K., Olafsdottir G., Magnusdottir S., Piknova L., Kyrova V., Lerch Z., Hanak P. International interlaboratory study on TaqMan real-time polymerase chain reaction authentication of black seabream (Spondyliosoma cantharus) J. Food Nutr. Res. 2018;57:27–37. [Google Scholar]
  • 24.Hanak P., Laknerova I., Svatora M. Second intron in the protein-coding region of the fish parvalbumin gene-a promising platform for polymerase chain reaction-based discrimination of fish meat of various species. J. Food Nutr. Res. 2012;51:81–88. [Google Scholar]
  • 25.Sun M., Liang C., Gao H., Lin C., Deng M. Detection of parvalbumin, a common fish allergen gene in food, by real-time polymerase chain reaction. J. AOAC Int. 2009;92:234–240. doi: 10.1093/jaoac/92.1.234. [DOI] [PubMed] [Google Scholar]
  • 26.Ross C., Tilghman R.W., Hartmann J.X., Mari F. Distribution of parvalbumin isotypes in adult snook and their potential applications as species-specific biomarkers. J. Fish. Biol. 1997;51:561–572. doi: 10.1111/j.1095-8649.1997.tb01512.x. [DOI] [Google Scholar]
  • 27.Huriaux F., Vandewalle P., Focant B. Immunological study of muscle parvalbumin isotypes in three African catfish during development. Comp. Biochem. Physiol. 2002;132B:579–584. doi: 10.1016/S1096-4959(02)00071-4. [DOI] [PubMed] [Google Scholar]
  • 28.Kuehn A., Swoboda I., Arumugam K., Hilger C., Hentges F. Fish allergens at a glance: Variable allergenicity of parvalbumins, the major fish allergens. Front. Immunol. 2014;5:179. doi: 10.3389/fimmu.2014.00179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sharp M.F., Lopata A.L. Fish allergy: In review. Clin. Rev. Allergy Immunol. 2014;46:258–271. doi: 10.1007/s12016-013-8363-1. [DOI] [PubMed] [Google Scholar]
  • 30.Goodman M., Pechére J.F. The evolution of muscular parvalbumins investigated by the maximum parsimony method. J. Mol. Evol. 1977;9:131–158. doi: 10.1007/BF01732745. [DOI] [PubMed] [Google Scholar]
  • 31.Leung N.Y., Wai C.Y., Shu S., Wang J., Kenny T.P., Chu K.H., Leung P.S. Current immunological and molecular biological perspectives on seafood allergy: A comprehensive review. Clin. Rev. Allergy Immunol. 2014;46:180–197. doi: 10.1007/s12016-012-8336-9. [DOI] [PubMed] [Google Scholar]
  • 32.Rodenbaugh D.W., Wang W., Davis J., Edwards T., Potter J.D., Metzger J.M. Parvalbumin isoforms differentially accelerate cardiac myocyte relaxation kinetics in an animal model of diastolic dysfunction. Am. J. Physiol. Heart Circ. Physiol. 2007;293:1705–1713. doi: 10.1152/ajpheart.00232.2007. [DOI] [PubMed] [Google Scholar]
  • 33.Permyakov E.A., Uversky V.N. What Is Parvalbumin for? Biomolecules. 2022;12:656. doi: 10.3390/biom12050656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Haiech J., Moreau M., Leclerc C., Kilhoffer M.C. Facts and conjectures on calmodulin and its cousin proteins, parvalbumin and troponin C. Biochim. Biophys. Acta-Mol. Cell Res. 2019;1866:1046–1053. doi: 10.1016/j.bbamcr.2019.01.014. [DOI] [PubMed] [Google Scholar]
  • 35.Cates M.S., Berry M.B., Ho E.L., Li Q., Potter J.D., Phillips G.N., Jr. Metal-ion affinity and specificity in EF-hand proteins: Coordination geometry and domain plasticity in parvalbumin. Structure. 1999;7:1269–1278. doi: 10.1016/S0969-2126(00)80060-X. [DOI] [PubMed] [Google Scholar]
  • 36.Biomatters, Geneious version 2022.2. [(accessed on 6 December 2022)]. Available online: https://www.geneious.com.
  • 37.Cox A.L., Eigenmann P.A., Sicherer S.H. Clinical relevance of cross-reactivity in food allergy. J. Allergy Clin. Immunol. Pract. 2021;9:82–99. doi: 10.1016/j.jaip.2020.09.030. [DOI] [PubMed] [Google Scholar]
  • 38.Meyer A., Van de Peer Y. From 2R to 3R: Evidence for a fish-specific genome duplication (FSGD) Bioessays. 2005;27:937–945. doi: 10.1002/bies.20293. [DOI] [PubMed] [Google Scholar]
  • 39.Modrell M.S., Lyne M., Carr A.R., Zakon H.H., Buckley D., Campbell A.S., Davis M.C., Micklem G., Baker C.V. Insights into electrosensory organ development, physiology and evolution from a lateral line-enriched transcriptome. eLife. 2017;6:e24197. doi: 10.7554/eLife.24197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Fagerberg L., Hallström B.M., Oksvold P., Kampf C., Djureinovic D., Odeberg J., Uhlén M. Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol. Cell Proteom. 2014;13:397–406. doi: 10.1074/mcp.M113.035600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Perez-Gordo M., Lin J., Bardina L., Pastor-Vargas C., Cases B., Vivanco F., Cuesta-Herranz J., Sampson H.A. Epitope mapping of Atlantic salmon major allergen by peptide microarray immunoassay. Int. Arch. Allergy Immunol. 2012;157:31–40. doi: 10.1159/000324677. [DOI] [PubMed] [Google Scholar]
  • 42.Sicherer S.H., Sampson H.A. Food allergy. J. Allergy Clin. Immunol. 2006;117:470–475. doi: 10.1016/j.jaci.2005.05.048. [DOI] [PubMed] [Google Scholar]
  • 43.Bannon G.A. What makes a food protein an allergen? Curr. Allergy Asthma Rep. 2004;4:43–46. doi: 10.1007/s11882-004-0042-0. [DOI] [PubMed] [Google Scholar]
  • 44.Moreno F.J. Gastrointestinal digestion of food allergens: Effect on their allergenicity. Biomed. Pharmacother. 2007;61:50–60. doi: 10.1016/j.biopha.2006.10.005. [DOI] [PubMed] [Google Scholar]
  • 45.Fu L., Wang C., Zhu Y., Wang Y. Seafood allergy: Occurrence, mechanisms and measures. Trends Food Sci. Technol. 2019;88:80–92. doi: 10.1016/j.tifs.2019.03.025. [DOI] [Google Scholar]
  • 46.Failler P., Van der Walle G., Lecrivain N., Himbes A., Lewins R. Future Prospects for Fish and Fishery Products, European Overview. FAO; Rome, Italy: 2007. 204p FAO Fisheries Circular No. 972/4, Part 1. [Google Scholar]
  • 47.Beale J.E., Jeebhay M.F., Lopata A.L. Characterisation of purified parvalbumin from five fish species and nucleotide sequencing of this major allergen from Pacific pilchard, Sardinops sagax. Mol. Immunol. 2009;46:2985–2993. doi: 10.1016/j.molimm.2009.06.018. [DOI] [PubMed] [Google Scholar]
  • 48.Hamada Y., Tanaka H., Ishizaki S., Ishida M., Nagashima Y., Shiomi K. Purification, reactivity with IgE and cDNA cloning of parvalbumin as the major allergen of mackerels. Food Chem. Toxicol. 2003;41:1149–1156. doi: 10.1016/S0278-6915(03)00074-7. [DOI] [PubMed] [Google Scholar]
  • 49.Helbling A., Heydet R., McCants M.L., Musmand J.J., El-Dahr J., Lehrer S.G. Fish allergy: Is cross-reactivity among fish species relevant? Double-blind placebo-controlled food challenge studies or fish-allergic patients. Ann. Allergy Asthma Immunol. 1999;83:517–523. doi: 10.1016/S1081-1206(10)62862-1. [DOI] [PubMed] [Google Scholar]
  • 50.Lim D.L.C., Neo K.H., Yi F.C., Chua K.Y., Goh D.L.M., Shek L.P.C., Giam Y.C., Van Bever H.P., Lee B.W. Parvalbumin–the major tropical fish allergen. Pediatr. Allergy Immunol. 2008;19:399–407. doi: 10.1111/j.1399-3038.2007.00674.x. [DOI] [PubMed] [Google Scholar]
  • 51.Borrego J.T., Cuevas J.M., Garcia J.T. Cross reactivity between fish and shellfish. Allergol. Immunopathol. 2003;31:146–151. doi: 10.1016/s0301-0546(03)79282-9. [DOI] [PubMed] [Google Scholar]
  • 52.Madsen C.B., Hattersley S., Allen K.J., Beyer K., Chan C.H., Godefroy S.B., Hodgson R., Mills E.N., Muñoz-Furlong A., Schnadt S., et al. Can we define a tolerable level of risk in food allergy? Report from a EuroPrevall/UK food standards agency workshop. Clin. Exp. Allergy. 2012;42:30–37. doi: 10.1111/j.1365-2222.2011.03868.x. [DOI] [PubMed] [Google Scholar]
  • 53.Ruethers T., Taki A.C., Johnston E.B., Nugraha R., Le T.T., Kalic T., McLean T.R., Kamath S.D., Lopata A.L. Seafood allergy: A comprehensive review of fish and shellfish allergens. Mol. Immunol. 2018;100:28–57. doi: 10.1016/j.molimm.2018.04.008. [DOI] [PubMed] [Google Scholar]
  • 54.Van Hengel A.J. Introduction. In: Nollet L.M.L., van Hengel A.J., editors. Food Allergens: Analysis Instrumentation and Methods. CRC Press; Boca Raton, FL, USA: 2011. pp. 1–11. [Google Scholar]
  • 55.Bernhisel-Broadbent J., Strause D., Sampson H.A. Fish hypersensitivity. II. Clinical relevance of altered fish allergenicity caused by various preparation methods. J. Allergy Clin. Immunol. 1992;90:622–629. doi: 10.1016/0091-6749(92)90135-O. [DOI] [PubMed] [Google Scholar]
  • 56.Pascual C.Y., Reche M., Fiandor A., Valbuena T., Cuevas T., Martin-Esteban M.M. Fish allergy in childhood. Pediatr. Allergy Immunol. 2008;19:573–579. doi: 10.1111/j.1399-3038.2008.00822.x. [DOI] [PubMed] [Google Scholar]
  • 57.Lee P.W., Nordlee J.A., Koppelman S.J., Baumert J.L., Taylor S.L. Measuring parvalbumin levels in fish muscle tissue: Relevance of muscle locations and storage conditions. Food Chem. 2012;135:502–507. doi: 10.1016/j.foodchem.2012.05.030. [DOI] [PubMed] [Google Scholar]
  • 58.Costa J., Ansari P., Mafra I., Oliveira M.B.P.P., Baumgartner S. Assessing hazelnut allergens by protein- and DNA-based approaches: LC-MS/MS, ELISA and real-time PCR. Anal. Bioanal. Chem. 2014;406:2581–2590. doi: 10.1007/s00216-014-7679-x. [DOI] [PubMed] [Google Scholar]
  • 59.European Commission Directive 2007/68/EC of 27 November 2007 amending Annex IIIa to Directive 2000/13/EC of the European Parliament and of the Council as regards certain food ingredients. Off. J. Eur. Union. 2007;310:11–14. [Google Scholar]
  • 60.Mari A., Scala E., Palazzo P., Ridolfi S., Zennaro D., Carabella G. Bioinformatics applied to allergy: Allergen databases, from collecting sequence information to data integration. The allergome platform as a model. Cell Immunol. 2006;244:97–100. doi: 10.1016/j.cellimm.2007.02.012. [DOI] [PubMed] [Google Scholar]
  • 61.Swoboda I., Balic N., Klug C., Focke M., Weber M., Spitzauer S., Neubauer A., Quirce S., Douladiris N., Papadopoulos N.G., et al. A general strategy for the generation of hypoallergenic molecules for the immunotherapy of fish allergy. J. Allergy Clin. Immunol. 2013;132:979–981. doi: 10.1016/j.jaci.2013.04.027. [DOI] [PubMed] [Google Scholar]
  • 62.Leung N.Y.H., Leung A.S.Y., Xu K.J.Y., Wai C.Y.Y., Lam C.Y., Wong G.W.K., Leung T.F. Molecular and immunological characterization of grass carp (Ctenopharyngodon idella) parvalbumin Cten i 1: A major fish allergen in Hong Kong. Pediatr. Allergy Immunol. 2020;31:792–804. doi: 10.1111/pai.13259. [DOI] [PubMed] [Google Scholar]
  • 63.Bugajska-Schretter A., Grote M., Vangelista L., Valent P., Sperr W.R., Rumpold H., Pastore A., Reichelt R., Valenta R., Spitzauer S. Purification, biochemical, and immunological characterisation of a major food allergen: Different immunoglobulin E recognition of the apo-and calcium-bound forms of carp parvalbumin. Gut. 2000;46:661–669. doi: 10.1136/gut.46.5.661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Bugajska-Schretter A., Elfman L., Fuchs T., Kapiotis S., Rumpold H., Valenta R., Spitzauer S. Parvalbumin, a cross-reactive fish allergen, contains IgE-binding epitopes sensitive to periodate treatment and Ca2+ depletion. J. Allergy Clin. Immunol. 1998;101:67–74. doi: 10.1016/S0091-6749(98)70195-2. [DOI] [PubMed] [Google Scholar]
  • 65.Van Do T., Hordvik I., Endresen C., Elsayed S. The major allergen (parvalbumin) of codfish is encoded by at least two isotypic genes: cDNA cloning, expression and antibody binding of the recombinant allergens. Mol. Immunol. 2003;39:595–602. doi: 10.1016/S0161-5890(02)00200-6. [DOI] [PubMed] [Google Scholar]
  • 66.Sharp M.F., Kamath S.D., Koeberl M., Jerry D.R., O’Hehir R.E., Campbell D.E., Lopata A.L. Differential IgE binding to isoallergens from Asian seabass (Lates calcarifer) in children and adults. Mol. Immunol. 2014;62:77–85. doi: 10.1016/j.molimm.2014.05.010. [DOI] [PubMed] [Google Scholar]
  • 67.Kondo Y., Ahn J., Komatsubara R., Terada A., Yasuda T., Tsuge I., Urisu A. Comparison of allergenic properties of salmon (Oncorhynchus nerka) between landlocked and anadromous species. Allergol. Int. 2009;58:295–299. doi: 10.2332/allergolint.08-OA-0064. [DOI] [PubMed] [Google Scholar]
  • 68.Ruethers T., Taki A.C., Karnaneedi S., Nie S., Kalic T., Dai D., Daduang S., Leeming M., Williamson N.A., Breiteneder H., et al. Expanding the allergen repertoire of salmon and catfish. Allergy. 2021;76:1443–1453. doi: 10.1111/all.14574. [DOI] [PubMed] [Google Scholar]
  • 69.Ruethers T., Raith M., Sharp M.F., Koeberl M., Stephen J.N., Nugraha R., Le T.T., Quirce S., Nguyen H.X., Kamath S.D., et al. Characterization of Ras k 1 a novel major allergen in Indian mackerel and identification of parvalbumin as the major fish allergen in 33 Asia-Pacific fish species. Clin. Exp. Allergy. 2018;48:452–463. doi: 10.1111/cea.13069. [DOI] [PubMed] [Google Scholar]
  • 70.Lindstrøm C.D.V., Van Do T., Hordvik I., Endresen C., Elsayed S. Cloning of two distinct cDNAs encoding parvalbumin, the major allergen of Atlantic salmon (Salmo salar) Scand. J. Immunol. 1996;44:335–344. doi: 10.1046/j.1365-3083.1996.d01-314.x. [DOI] [PubMed] [Google Scholar]
  • 71.Gajewski K.G., Hsieh Y.H. Monoclonal antibody specific to a major fish allergen: Parvalbumin. J. Food Prot. 2009;72:818–825. doi: 10.4315/0362-028X-72.4.818. [DOI] [PubMed] [Google Scholar]
  • 72.Kuehn A. Allergen Nomenclature. 2021. [(accessed on 17 October 2022)]. Available online: http://allergen.org/viewallergen.php?aid=655.
  • 73.Van Do T., Elsayed S., Florvaag E., Hordvik I., Endresen C. Allergy to fish parvalbumins: Studies on the cross-reactivity of allergens from 9 commonly consumed fish. J. Allergy Clin. Immunol. 2005;116:1314–1320. doi: 10.1016/j.jaci.2005.07.033. [DOI] [PubMed] [Google Scholar]
  • 74.Ruethers T., Nugraha R., Taki A.C., O’Malley A., Karnaneedi S., Zhang S., Kapingidza A.B., Mehr S., Kamath S.D., Chruszcz M., et al. The first reptilian allergen and major allergen for fish-allergic patients: Crocodile β-parvalbumin. Pediatr. Allergy Immunol. 2022;33:e13781. doi: 10.1111/pai.13781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Kuehn A., Lehners C., Hilger C., Hentges F. Food allergy to chicken meat with IgE reactivity to muscle α-parvalbumin. Allergy. 2009;64:1557–1558. doi: 10.1111/j.1398-9995.2009.02094.x. [DOI] [PubMed] [Google Scholar]
  • 76.Kuehn A., Codreanu-Morel F., Lehners-Weber C., Doyen V., Gomez-André S.A., Bienvenu F., Van Hage M., Perotin J.M., Silcret-Grieu S. Cross-reactivity to fish and chicken meat–a new clinical syndrome. Allergy. 2016;71:1772–1781. doi: 10.1111/all.12968. [DOI] [PubMed] [Google Scholar]
  • 77.Hilger C., Grigioni F., Thill L., Mertens L., Hentges F. Severe IgE-mediated anaphylaxis following consumption of fried frog legs: Definition of α-parvalbumin as the allergen in cause. Allergy. 2002;57:1053–1058. doi: 10.1034/j.1398-9995.2002.23677.x. [DOI] [PubMed] [Google Scholar]
  • 78.Hubalkova Z., Kralik P., Tremlova B., Rencova E. Methods of gadoid fish species identification in food and their economic impact in the Czech Republic: A review. Vet. Med. 2007;52:273. doi: 10.17221/2044-VETMED. [DOI] [Google Scholar]
  • 79.Kim H., Kumar K.S., Hwang S.Y., Kang B.C., Moon H.B., Shin K.H. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp. J. Agric. Food Chem. 2015;63:5548–5556. doi: 10.1021/acs.jafc.5b01469. [DOI] [PubMed] [Google Scholar]
  • 80.Schmidhuber J., Pound J., Qiao B. COVID-19: Channels of Transmission to Food and Agriculture. Food and Agriculture Organization of the United Nations; Rome, Italy: 2020. [Google Scholar]
  • 81.Whitworth J. High Risk Firms May Miss an Inspection Due to COVID-19. 2020. [(accessed on 15 October 2022)]. Available online: https://www.foodsafetynews.com/2020/12/high-risk-firms-may-miss-an-inspection-due-to-covid-19/
  • 82.Rehbein H., Kundiger R., Yman I.M., Ferm M., Etienne M., Jerome M., Craig A., Mackie I., Jessen F., Martinez I., et al. Species identification of cooked fish by urea isoelec-tric focusing and sodium dodecylsulfate polyacryla-mide gel electrophoresis: A collaborative study. Food Chem. 1999;67:333–339. doi: 10.1016/S0308-8146(99)00175-2. [DOI] [Google Scholar]
  • 83.Piñeiro C., Sotelo C.G., Medina I., Gallardo J.M., Pérez-Martín R.I. Reversed-phase HPLC as a method for the identification of gadoid fish species. Z. Lebensm. Unters. Forsch. 1997;204:411–416. doi: 10.1007/s002170050103. [DOI] [Google Scholar]
  • 84.Céspedes A., García T., Carrera E., González I., Fernández A., Asensio L., Hernández P.E., Martín R. Indirect enzyme-linked immunosorbent assay for the identification of sole (Solea solea), European plaice (Pleuronectes platessa), floun-der (Platichthys flesus), and Greenland hali-but (Reinhardtius hippoglossoides) J. Food Prot. 1999;62:1178–1182. doi: 10.4315/0362-028X-62.10.1178. [DOI] [PubMed] [Google Scholar]
  • 85.Hubalkova Z., Kralik P., Kasalova J., Rencova E. Identification of gadoid species in fish meat by polymerase chain reaction (PCR) on genomic DNA. J. Agric. Food Chem. 2008;56:3454–3459. doi: 10.1021/jf703684w. [DOI] [PubMed] [Google Scholar]
  • 86.Kochzius M., Seidel C., Antoniou A., Botla S.K., Campo D., Cariani A., Vazquez E.G., Hauschild J., Hervet C., Hjörleifsdottir S., et al. Identifying fishes through DNA barcodes and microarrays. PLoS One. 2010;5:e12620. doi: 10.1371/journal.pone.0012620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Hulley E.N., Tharmalingam S., Zarnke A., Boreham D.R. Development and validation of probe-based multiplex real-time PCR assays for the rapid and accurate detection of freshwater fish species. PLoS One. 2019;14:e0210165. doi: 10.1371/journal.pone.0210165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Rehbein H. Differentiation of fish species by PCR-based DNA analysis of nuclear genes. Eur. Food Res. Technol. 2013;236:979–990. doi: 10.1007/s00217-013-1961-6. [DOI] [Google Scholar]
  • 89.Jiang D., Jiang H., Ji J., Sun X., Qian H., Zhang G., Tang L. Mast-cell-based fluorescence biosensor for rapid detection of major fish allergen parvalbumin. J. Agric. Food Chem. 2014;62:6473–6480. doi: 10.1021/jf501382t. [DOI] [PubMed] [Google Scholar]
  • 90.Hua Z., Yu T., Liu D., Xianyu Y. Recent advances in gold nanoparticles-based biosensors for food safety detection. Biosens. Bioelectron. 2021;179:113076. doi: 10.1016/j.bios.2021.113076. [DOI] [PubMed] [Google Scholar]
  • 91.Li J., Wang H., Cheng J.H. DNA, protein and aptamer-based methods for seafood allergens detection: Principles, comparisons and updated applications. Crit. Rev. Food Sci. Nutr. 2023;63:178–191. doi: 10.1080/10408398.2021.1944977. [DOI] [PubMed] [Google Scholar]
  • 92.Piñeiro C., Vázquez J., Marina A.I., Barros-Velázquez J., Gallardo J.M. Characterization and partial sequencing of species-specific sarcoplasmic polypeptides from commercial hake species by mass spectrometry following two-dimensional electrophoresis. Electrophoresis. 2001;22:1545–1552. doi: 10.1002/1522-2683(200105)22:8<1545::AID-ELPS1545>3.0.CO;2-5. [DOI] [PubMed] [Google Scholar]
  • 93.Elsayed S., Bennich H. The primary structure of allergen M from cod. Scand. J. Immunol. 1975;4:203–208. doi: 10.1111/j.1365-3083.1975.tb02618.x. [DOI] [PubMed] [Google Scholar]
  • 94.Carrera M., Canas B., Vázquez J., Gallardo J.M. Extensive de novo sequencing of new parvalbumin isoforms using a novel combination of bottom-up proteomics, accurate molecular mass measurement by FTICR− MS, and selected MS/MS Ion monitoring. J. Proteome Res. 2010;9:4393–4406. doi: 10.1021/pr100163e. [DOI] [PubMed] [Google Scholar]
  • 95.Rehbein H., Kundiger R., Pineiro C., Perez-Martin R.I. Fish muscle parvalbumins as marker proteins for native and urea isoelectric focusing. Electrophoresis. 2000;21:1458–1463. doi: 10.1002/(SICI)1522-2683(20000501)21:8<1458::AID-ELPS1458>3.0.CO;2-T. [DOI] [PubMed] [Google Scholar]
  • 96.Etienne M., Jerome M., Fleurence J., Rehbein H., Kundiger R., Malmheden Yman I., Ferm M., Craig A., Mackie I., Jessen F., et al. A standardised method of identification of raw and heat-processed fish by urea isoelectric focusing: A collaborative study. Electrophoresis. 1999;20:1923–1933. doi: 10.1002/(SICI)1522-2683(19990701)20:10<1923::AID-ELPS1923>3.0.CO;2-J. [DOI] [PubMed] [Google Scholar]
  • 97.Dobrovolov I., Ivanova P., Tsekov A. Genetic-biochemical identification of some sturgeons and their hybrids (Pisces, Acipenseridae) Verh. Int. Ver. Theor. Angew. Limnol. 2005;29:917–921. doi: 10.1080/03680770.2005.11902816. [DOI] [Google Scholar]
  • 98.Rehbein H., Lopata A.L. Presence of parvalbumin in different tissues of three sturgeon species (Acipenser baeri, A. gueldenstaedtii, A. ruthenus) J. Appl. Ichthyol. 2011;27:219–225. doi: 10.1111/j.1439-0426.2010.01654.x. [DOI] [Google Scholar]
  • 99.Rehbein H., Oliveira A. Alaskan flatfishes on the German market: Part 1: Identification by DNA and protein analytical methods. Eur. Food Res. Technol. 2012;234:245–251. doi: 10.1007/s00217-011-1629-z. [DOI] [Google Scholar]
  • 100.Mazzeo M.F., Giulio B.D., Guerriero G., Ciarcia G., Malorni A., Russo G.L., Siciliano R.A. Fish authentication by MALDI-TOF mass spectrometry. J. Agric. Food Chem. 2008;56:11071–11076. doi: 10.1021/jf8021783. [DOI] [PubMed] [Google Scholar]
  • 101.Carrera M., Cañas B., Gallardo J.M. Rapid direct detection of the major fish allergen, parvalbumin, by selected MS/MS ion monitoring mass spectrometry. J. Proteom. 2012;75:3211–3220. doi: 10.1016/j.jprot.2012.03.030. [DOI] [PubMed] [Google Scholar]
  • 102.Li Z., Zhang Y., Pawar R., Wang G., Lin H. Development of an optimized protein chip for the detection of fish parvalbumin allergen. Curr. Anal. Chem. 2011;7:349–356. doi: 10.2174/157341111797183100. [DOI] [Google Scholar]
  • 103.Mazzeo M.F., Siciliano R.A. Proteomics for the authentication of fish species. J. Proteom. 2016;147:119–124. doi: 10.1016/j.jprot.2016.03.007. [DOI] [PubMed] [Google Scholar]
  • 104.Carrera M., Cañas B., Gallardo J.M. Proteomics for the assessment of quality and safety of fishery products. Food Res. Int. 2013;54:972–979. doi: 10.1016/j.foodres.2012.10.027. [DOI] [Google Scholar]
  • 105.Carrera M., Cañas B., Piñeiro C., Vázquez J., Gallardo J.M. Identification of commercial hake and grenadier species by proteomic analysis of the parvalbumin fraction. Proteomics. 2006;6:5278–5287. doi: 10.1002/pmic.200500899. [DOI] [PubMed] [Google Scholar]
  • 106.Siciliano R.A., d’Esposito D., Mazzeo M.F. Advances in MALDI and Laser-Induced Soft Ionization Mass Spectrometry. Springer; Berlin/Heidelberg, Germany: 2016. Food authentication by MALDI MS: MALDI-TOF MS analysis of fish species; pp. 263–277. [Google Scholar]
  • 107.Dong X., Raghavan V. A comprehensive overview of emerging processing techniques and detection methods for seafood allergens. Compr. Rev. Food Sci. Food Saf. 2022;21:3540–3557. doi: 10.1111/1541-4337.12987. [DOI] [PubMed] [Google Scholar]
  • 108.Xu J., Ye Y., Ji J., Sun J., Sun X. Advances on the rapid and multiplex detection methods of food allergens. Crit. Rev. Food Sci. Nutr. 2022;62:6887–6907. doi: 10.1080/10408398.2021.1907736. [DOI] [PubMed] [Google Scholar]
  • 109.Rychert J. Benefits and limitations of MALDI-TOF mass spectrometry for the identification of microorganisms. J. Infect. Epidemiol. 2019;2 doi: 10.29245/2689-9981/2019/4.1142. [DOI] [Google Scholar]
  • 110.Holzhauser T., Röder M. Handbook of Food Allergen Detection and Control. Elsevier; Amsterdam, The Netherlands: 2015. Polymerase chain reaction (PCR) methods for detecting allergens in foods; pp. 245–263. [Google Scholar]
  • 111.Liu Z.J., Cordes J.F. DNA marker technologies and their applications in aquaculture genetics. Aquaculture. 2004;238:1–37. doi: 10.1016/j.aquaculture.2004.05.027. [DOI] [Google Scholar]
  • 112.Broeders S.R., De Keersmaecker S.C., Roosens N.H. How to deal with the upcoming challenges in GMO detection in food and feed. J. Biotechnol. Biomed. 2012;2012:402418. doi: 10.1155/2012/402418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Eischeid A.C., Kim B.H., Kasko S.M. Two quantitative real-time PCR assays for the detection of penaeid shrimp and blue crab, crustacean shellfish allergens. J. Agric. Food Chem. 2013;61:5669–5674. doi: 10.1021/jf3031524. [DOI] [PubMed] [Google Scholar]
  • 114.Herrero B., Vieites J.M., Espiñeira M. Development of an in-house fast real-time PCR method for detection of fish allergen in foods and comparison with a commercial kit. Food Chem. 2014;151:415–420. doi: 10.1016/j.foodchem.2013.11.042. [DOI] [PubMed] [Google Scholar]
  • 115.Cline S.D. Mitochondrial DNA damage and its consequences for mitochondrial gene expression. Biochim. Biophys. Acta Gene Regul. Mech. BBA. 2012;1819:979–991. doi: 10.1016/j.bbagrm.2012.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116.Raupach M.J., Barco A., Steinke D., Beermann J., Laakmann S., Mohrbeck I., Neumann H., Kihara T.C., Pointner K., Radulovici A., et al. The application of DNA barcodes for the identification of marine crustaceans from the North Sea and adjacent regions. PLoS One. 2015;10:e0139421. doi: 10.1371/journal.pone.0139421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117.Bremer J.R.A., Viñas J., Mejuto J., Ely B., Pla C. Comparative phylogeography of Atlantic bluefin tuna and swordfish: The combined effects of vicariance, secondary contact, introgression, and population expansion on the regional phylogenies of two highly migratory pelagic fishes. Mol. Phylogenet. Evol. 2005;36:169–187. doi: 10.1016/j.ympev.2004.12.011. [DOI] [PubMed] [Google Scholar]
  • 118.Buhay J.E. “COI-Like” sequences are becoming problematic in molecular systematic and DNA barcoding studies. J. Crustac. Biol. 2009;29:96–110. doi: 10.1651/08-3020.1. [DOI] [Google Scholar]
  • 119.Song H., Buhay J.E., Whiting M.F., Crandall K.A. Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proc. Natl. Acad. Sci. USA. 2008;105:13486–13491. doi: 10.1073/pnas.0803076105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120.Mariani S., Bekkevold D. Stock Identification Methods. Academic Press; Cambridge, MA, USA: 2014. The nuclear genome: Neutral and adaptive markers in fisheries science; pp. 297–327. [Google Scholar]
  • 121.Paracchini V., Petrillo M., Lievens A., Gallardo A.P., Martinsohn J.T., Hofherr J., Maquet A., Silva A.P., Kagkli D.M., Querci M., et al. Novel nuclear barcode regions for the identification of flatfish species. Food Control. 2017;79:297–308. doi: 10.1016/j.foodcont.2017.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Rehbein H., Kress G. Detection of short mRNA sequences in fishery products. Dtsch. Lebensm. Rundsch. 2005;101:333–337. [Google Scholar]
  • 123.Rehbein H. Differentiation of hake species by RFLP-and SSCP-analysis of PCR amplified cytochrome b and parvalbumin sequences. Dtsch. Lebensm. Rundsch. 2007;103:511–517. [Google Scholar]
  • 124.Rencova E., Kostelnikova D., Tremlova B. Detection of allergenic parvalbumin of Atlantic and Pacific herrings in fish products by PCR. Food Addit. Contam. Part A. 2013;30:1679–1683. doi: 10.1080/19440049.2013.817024. [DOI] [PubMed] [Google Scholar]
  • 125.Ma Y., Griesmeier U., Susani M., Radauer C., Briza P., Erler A., Bublin M., Alessandri S., Himly M., Vàzquez-Cortés S., et al. Comparison of natural and recombinant forms of the major fish allergen parvalbumin from cod and carp. Mol. Nutr. Food Res. 2008;52:S196–S207. doi: 10.1002/mnfr.200700284. [DOI] [PubMed] [Google Scholar]
  • 126.Mukherjee S., Hanak P., Akhatova D., Musilova Z., Horka P., Lerch Z., Zdenkova K., Cermakova E. Simultaneous detection and quantification of two European anglerfishes by novel genomic primer. J. Food Compos. Anal. 2022;115:104992. doi: 10.1016/j.jfca.2022.104992. [DOI] [Google Scholar]
  • 127.Sun L., Xu L., Huang Y., Lin H., Ahmed I., Li Z. Identification and comparison of allergenicity of native and recombinant fish major allergen parvalbumins from Japanese flounder (Paralichthys olivaceus) Food Funct. 2019;10:6615–6623. doi: 10.1039/C9FO01402K. [DOI] [PubMed] [Google Scholar]
  • 128.Muñoz-Colmenero M., Rahman S., Martínez J.L., Garcia-Vazquez E. High variability in parvalbumin beta 1 genes offers new molecular options for controlling the mislabeling in commercial Salmonids. Eur. Food Res. Technol. 2019;245:1685–1694. doi: 10.1007/s00217-019-03278-0. [DOI] [Google Scholar]
  • 129.Choi K.Y., Hong K.W. Genomic DNA sequence of mackerel parvalbumin and a PCR test for rapid detection of allergenic mackerel ingredients in food. Food Sci. Biotechnol. 2007;16:67–70. [Google Scholar]
  • 130.Prado M., Boix A., von Holst C. Development of a real-time PCR method for the simultaneous detection of mackerel and horse mackerel. Food Control. 2013;34:19–23. doi: 10.1016/j.foodcont.2013.04.007. [DOI] [Google Scholar]
  • 131.Heizmann W., Hauptle M., Eppenberger H.M. The purification, characterisation and localisation of a parvalbumin like protein from chicken-leg muscle. Eur. J. Biochem. 1977;80:433–441. doi: 10.1111/j.1432-1033.1977.tb11898.x. [DOI] [PubMed] [Google Scholar]
  • 132.Gerday C., Joris B., Gerardin-Otthiers N., Collin S., Hamoir G. Parvalbumins from the lungfish (Protopterus dolloi) Biochemistry. 1979;61:589–599. doi: 10.1016/S0300-9084(79)80156-X. [DOI] [PubMed] [Google Scholar]
  • 133.Hamoir G., Gerardin-Otthiers N. Differentiation of the sarcoplasmic proteins of white, yellowish and cardiac muscles of an antarctic haemoglobin-free fish Champsocephalus gunnari. Comp. Biochem. Physiol. 1980;65:199–206. doi: 10.1016/0305-0491(79)90178-0. [DOI] [PubMed] [Google Scholar]
  • 134.Hildebrandt S. Multiplexed identification of different fish species by detection of parvalbumin, a common fish allergen gene: A DNA application of multi-analyte profiling (xMAP™) technology. Anal. Bioanal. Chem. 2010;397:1787–1796. doi: 10.1007/s00216-010-3760-2. [DOI] [PubMed] [Google Scholar]
  • 135.Lu Y., Ohshima T., Ushio H. Rapid detection of fish major allergen parvalbumin by surface plasmon resonance biosensor. J. Food Sci. 2004;69:C652–C658. doi: 10.1111/j.1750-3841.2004.tb18013.x. [DOI] [Google Scholar]
  • 136.Wang Y., Li H., Zhou J., Qi Q., Fu L. A colorimetric and fluorescent gold nanoparticle-based dual-mode aptasensor for parvalbumin detection. Microchem. J. 2020;159:105413. doi: 10.1016/j.microc.2020.105413. [DOI] [Google Scholar]
  • 137.Fu L., Qian Y., Zhou J., Zheng L., Wang Y. Fluorescence-based quantitative platform for ultrasensitive food allergen detection: From immunoassays to DNA sensors. Compr. Rev. Food Sci. Food Saf. 2020;19:3343–3364. doi: 10.1111/1541-4337.12641. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable.


Articles from Genes are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES