Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2023 Jan 9;24(2):1269. doi: 10.3390/ijms24021269

Comparison of Virulence-Factor-Encoding Genes and Genotype Distribution amongst Clinical Pseudomonas aeruginosa Strains

Tomasz Bogiel 1,2,*, Dagmara Depka 1,2, Stanisław Kruszewski 3, Adrianna Rutkowska 4, Piotr Kanarek 5, Mateusz Rzepka 1,2, Jorge H Leitão 6,7,*, Aleksander Deptuła 8, Eugenia Gospodarek-Komkowska 1,2
Editors: Thomas Litman, Nitin Amdare
PMCID: PMC9863696  PMID: 36674786

Abstract

Pseudomonas aeruginosa is an opportunistic pathogen encoding several virulence factors in its genome, which is well-known for its ability to cause severe and life-threatening infections, particularly among cystic fibrosis patients. The organism is also a major cause of nosocomial infections, mainly affecting patients with immune deficiencies and burn wounds, ventilator-assisted patients, and patients affected by other malignancies. The extensively reported emergence of multidrug-resistant (MDR) P. aeruginosa strains poses additional challenges to the management of infections. The aim of this study was to compare the incidence rates of selected virulence-factor-encoding genes and the genotype distribution amongst clinical multidrug-sensitive (MDS) and MDR P. aeruginosa strains. The study involved 74 MDS and 57 MDR P. aeruginosa strains and the following virulence-factor-encoding genes: lasB, plC H, plC N, exoU, nan1, pilA, and pilB. The genotype distribution, with respect to the antimicrobial susceptibility profiles of the strains, was also analyzed. The lasB and plC N genes were present amongst several P. aeruginosa strains, including all the MDR P. aeruginosa, suggesting that their presence might be used as a marker for diagnostic purposes. A wide variety of genotype distributions were observed among the investigated isolates, with the MDS and MDR strains exhibiting, respectively, 18 and 9 distinct profiles. A higher prevalence of genes determining the virulence factors in the MDR strains was observed in this study, but more research is needed on the prevalence and expression levels of these genes in additional MDR strains.

Keywords: multiple-antibiotic resistance, Pseudomonas aeruginosa virulence genes, virulence-factor-encoding genes, virulence gene genotyping, Pseudomonas aeruginosa clinical isolates, antibiotic resistance profiles

1. Introduction

Pseudomonas aeruginosa is a ubiquitous Gram-negative γ-proteobacterium commonly isolated from soil, water, plants, feces, compost, fungi, and sediments. It is also a commensal bacterium transiently inhabiting the digestive tract and skin of humans and animals. Due to its high genomic plasticity and metabolic versatility, P. aeruginosa is able to colonize and cause infection in a wide range of hosts, from unicellular organisms to humans [1,2,3,4].

P. aeruginosa is responsible for hospital-associated infections (HAIs) as an opportunistic pathogen, posing a serious risk to patients affected by a wide range of diseases, such as cystic fibrosis, immune deficiencies, cancer, chronic pneumonia, ventilator-associated pneumonia (e.g., during the COVID-19 pandemic), and burn and surgical wounds infections. P. aeruginosa is one of the most common etiological agents of intensive-care-unit (ICU)-acquired pulmonary, urinary, and bloodstream infections [3,5,6]. The pathogenesis of the infections caused by P. aeruginosa is associated with multiple factors leading to effective colonization and biofilm formation, tissue necrosis, invasion, and dissemination through the vascular system, as well as the activation of both local and systemic inflammatory responses [7].

The presence of diverse properties encoded in its genome, namely virulence and antimicrobial-resistant determinants, led to the classification of P. aeruginosa as a member of the ESKAPE group (amongst the Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, and Enterobacter species) [4,8]. The occurrence of multidrug-resistant (MDR) P. aeruginosa strains is a significant medical issue. MDR P. aeruginosa isolates, in addition to their intrinsic intracellular resistance mechanisms (such as the overexpression of the efflux pumps and low outer membrane permeability), are capable of exogenously acquiring genes related to the synthesis of enzymes inactivating β-lactams, as well as genes encoding antimicrobial efflux system pumps [9,10].

In P. aeruginosa, the genes encoding virulence factors may be located on the bacterial chromosome or on the additional genome–genetic elements, such as the plasmids and pathogenicity islands. Virulence factors can be categorized as extracellularly secreted and bacterial-cell-associated. The pathogenicity of P. aeruginosa depends on the interaction of multiple virulence factors in each stage of an infection [11]. The synthesis of enzymes (such as elastases, phospholipases, and neuraminidases), extracellular toxins (e.g., exotoxins T, U, and Y), and cell components (e.g., pili) are some of the virulence factors that can be identified [12].

A detailed understanding of the contributions of the genes that encode virulence factors in both MDR and multidrug-sensitive (MDS) strains allows for a better understanding of the evolutionary strategy and pathogenicity of P. aeruginosa. This knowledge could also contribute to the effective control of the pathogen’s spread, especially in hospital environments, where the presence of virulent MDR strains is a critical threat to patients’ health and lives [13].

The aim of this study was to compare the incidence of virulence-factor-encoding genes and the genotype distribution amongst clinical MDR and MDS P. aeruginosa strains. The study involved 74 MDS and 57 MDR P. aeruginosa strains of clinical origin, and the presence of the virulence-factor-encoding genes lasB, plC H, plC N, exoU, nan1, pilA, and pilB in their genomes was investigated. Their consecutive genotype distribution, with respect to the antimicrobial susceptibility profiles of the strains, was also analyzed. The mentioned genes were selected based on previous studies in order to analyze their presence among clinical strains with different phenotypic susceptibility profiles.

2. Results

2.1. The Origin and Prevalence of Virulence-Factor-Encoding Genes among MDR and MDS P. aeruginosa Strains

In total, 74 MDS and 57 MDR clinical isolates of P. aeruginosa strains were included in the study. Their origins are presented in Figure 1 and Figure 2 (MDS) and Figure 3 and Figure 4 (MDR).

Figure 1.

Figure 1

The origins (units) of the multidrug-sensitive P. aeruginosa strains included in the study (n = 74).

Figure 2.

Figure 2

The origin (specimen types) of the multidrug-sensitive P. aeruginosa strains included in the study (n = 74).

Figure 3.

Figure 3

The origins (units) of the multidrug-resistant P. aeruginosa strains included in the study (n = 57).

Figure 4.

Figure 4

The origins (specimen types) of the multidrug-resistant P. aeruginosa strains included in the study (n = 57).

The assessment of the virulence genes frequency revealed a wide variety in the genes’ distribution. The incidence of virulence genes amongst the examined strains was as follows: the lasB and plC N genes were detected in all the tested MDR strains, whereas the pilA and pilB genes presented with the lowest frequency amongst both groups of strains, being around 5.0% and below 2.0% for pilA and pilB, respectively. The incidence of the detected virulence genes amongst the examined P. aeruginosa strains is shown in Figure 5, while their detailed incidence is provided in the Supplementary Materials (Table S1 for the MDS strains and Table S2 for the MDR isolates).

Figure 5.

Figure 5

Prevalence of the studied virulence genes amongst the P. aeruginosa strains included in the study with respect to the strains’ antimicrobial susceptibility profiled (multidrug-resistant, MDR, n = 57 vs. multidrug-sensitive, MDS, n = 74).

There was a statistically significant relationship between the frequency of the lasB (p = 0.0354), plC N (p = 0.0051) and plC H (p = 0.0227) genes and their occurrence among the MDR isolates.

In the group of MDR strains, the only moderate positive correlation observed was that of the pilA and pilB genes (r = 0.5669). In the group of MDS strains, the only moderate positive correlation observed was that of the plC H and lasB genes (r = 0.6752), and a weak positive relationship between the plC H and plC N gene was noted (r = 0.2849). In the present study, the only negative correlation between the genes, in terms of their presence, was noted among the MDS strains (r = −0.2327, weak) in the case of the exoU and pilA genes. The detailed statistical calculation of Spearman’s rank correlation coefficient for the particular gene pairs, with respect to the antimicrobial susceptibility profiles of the P. aeruginosa strains included in the study, is presented in Supplementary Materials, Table S3.

2.2. Prevalence of the Observed Genotypes

Eighteen genotypes were observed (named I-S to XVIII-S) in the group of MDS P. aeruginosa strains. Their prevalence and distribution amongst the examined strains are shown in Table 1. The most prevalent genotype, numbered VII-S, including the lasB, plC H, and plC N genes, was observed among 22 (29.7%) of the isolates. Eight (10.8%) strains presented individual genotypes. The incidence of the genotypes identified amongst the studied P. aeruginosa MDS strains is presented in Table 1, while the detailed specification of their genotypes is presented in the Supplementary Materials, Table S1.

Table 1.

Characteristics and distribution of the genotypes detected amongst the examined multidrug-sensitive P. aeruginosa strains (n = 74).

Genotype Gene Presence (+) or Absence (-) in a Particular Genotype
Name n % lasB plC N plC H exoU nan1 pilA pilB
I-S 1 1.4 + + + + + - +
II-S 10 13.5 + + + + + - -
III-S 15 20.3 + + + + - - -
IV-S 1 1.4 + + + - + + -
V-S 6 8.1 + + + - + - -
VI-S 2 2.7 + + + - - + -
VII-S 22 29.7 + + + - - - -
VIII-S 1 1.4 + + - + + - -
IX-S 2 2.7 + + - + - - -
X-S 2 2.7 + - + + + - -
XI-S 1 1.4 + - + + - - -
XII-S 1 1.4 + - + - + + -
XIII-S 1 1.4 + - + - + - -
XIV-S 2 2.7 + - - + - - -
XV-S 1 1.4 + - - - - - -
XVI-S 2 2.7 - + - + - - -
XVII-S 3 4.1 - + - - - - -
XVIII-S 1 1.4 - - - - - - -

(+)—presence of a particular gene, (-)—absence of a particular gene.

Nine genotypes (named I-R to IX-R) were observed among the MDR P. aeruginosa strains. Their prevalence and distribution amongst the examined strains are shown in Table 2. The most prevalent genotype, named III-R, consists of all the genes detected (except for the nan1, pilA, and pilB genes) and was observed among 20 (35.1%) of the isolates, while the VII-R genotype, including the lasB, plC H, and plC N genes, was noted in 19 (33.3%) of the strains. Five (8.8%) strains presented individual genotypes. The incidence of the genotypes amongst the P. aeruginosa MDR strains is presented in Table 2, while the detailed specification of the genotypes is shown in the Supplementary Materials, Table S2. However, no statistically significant correlation was found between the presence of particular genotypes in the MDS or MDR groups of strains (χ2 = 1.2375, p = 0.7440).

Table 2.

Characteristics and distribution of the genotypes detected amongst the examined multidrug-resistant P. aeruginosa strains (n = 57).

Genotype Gene Presence (+) or Absence (-) in a Particular Genotype
name n % lasB plC N plC H exoU nan1 pilA pilB
I-R 1 1.8 + + + + + + -
II-R 8 14.0 + + + + + - -
III-R 20 35.1 + + + + - - -
IV-R 1 1.8 + + + - + + +
V-R 5 8.8 + + + - + - -
VI-R 1 1.8 + + + - - + -
VII-R 19 33.3 + + + - - - -
VIII-R 1 1.8 + + - + + - -
IX-R 1 1.8 + + - - - - -

(+)—presence of a particular gene, (-)—absence of a particular gene.

3. Discussion

For many years, P. aeruginosa strains have frequently been the object of many studies, mostly due to their relevance for hospital-acquired infections. The high incidence of MDR P. aeruginosa in HAIs and infections among ICU patients renders the constant observation of this pathogen necessary [14]. The global threat is significant, since the combination of antibiotic resistance mechanisms and virulence factors usually determines the severe course of the infection [9].

To the best of our knowledge, the present study was one of the largest in terms of the number of the strains included in the study and the number of diverse virulence factors investigated. The detected genes were selected to cover a number of virulence factors with different activities, e.g., typical toxins, the most important enzymes, and structure-dependent factors, including well-known and rarely investigated genes.

Elastase B, encoded by the lasB gene, is an important virulence factor with a widespread distribution among P. aeruginosa strains. Through the hydrolysis of antibodies and complement components, this metallopeptidase influences the disintegration of intercellular connections in the host tissues and interferes with the process of normal immune responses [15]. In this study, the elastase B-encoding gene was present in all the MDR strains analyzed. The gene was also present in high proportions among the MDS strains (91.9%). A study by Elmouaden et al. [16] also reported high proportions of the lasB gene among both MDR strains (99%) and MDS strains (97.6%). In addition, Ratajczak et al. [17] reported the leading contribution of the lasB gene among the majority of the P. aeruginosa strains tested (93.1%). Similar findings were reported in the study conducted by Dawodeyah et al. [18], which revealed that all the MDR strains contained the lasB gene. The results obtained in our study are in line with the general pattern of the lasB gene’s ubiquitous distribution in P. aeruginosa and its identification as a significant predictor of the species’ evolutionary strategy. It is also worth noting the high fraction of this gene among non-clinical strains and the spread of its presence in both natural and anthropogenic contexts [19,20].

In our study, a moderately positive correlation was found between the presence of the lasB gene and the plC H genes in MDS strains. Both the hemolytic (plC H) and the non-hemolytic phospholipase C (plC N) play an important role in the pathogenesis of P. aeruginosa infections. The products of these bacterial enzymes compete with the second messengers of the host enzymes, affecting physiological cell processes and disrupting cell membrane lipid homeostasis [21]. There is a noticeable difference in the number of publications on phospholipase genes, with the hemolytic phospholipase described much more frequently. This study identified the plC N gene in 100% of the MDR strains and in 87.8% of the MDS strains, while the gene encoding the synthesis of hemolytic phospholipase C was identified in 96.5% and 83.8% of the strains, respectively. The results are quite similar to the values obtained in our previous study on bloodstream-derived isolates, where the presence of the plC N and plC H genes was detected in 95.8% and 100% of the strains, respectively [22]. Meanwhile, Gonçalves et al. [23] identified a lower prevalence of the plC N gene among carbapenem-resistant strains (88.0%) compared to the results of this work. Additionally, the study by Wolska and Szweda [24] identified a higher prevalence of the plC H gene (95.2%) compared to the plC N gene (88.7%). Despite varying reports regarding the proportions of individual genes encoding phospholipase C synthesis, it should be concluded that these genes encode one of the most common virulence factors, regardless of the susceptibility patterns of the P. aeruginosa strains. The frequent detection of both virulence genes among the strains demonstrates that these genes may serve as potent factors in the development of infections and that their presence affects the population dynamics of P. aeruginosa. Notably, this study also found a weak positive correlation between the presence of both discussed phospholipases genes.

The presence of exotoxin U (encoded by the exoU gene), as the most toxic of the four effector proteins observed in the pathogenesis of P. aeruginosa infections, results in a more severe disease course. This effector protein induces a highly rapid lytic effect on the host cell membrane, leading to necrosis in the epithelial cells, macrophages, and neutrophils [25]. This study identified a moderate level of presence of the exoU gene in both the MDR and MDS strains, which occurred in 52.6% and 48.6% of the strains, respectively. A lower incidence was reported by Naik et al. [26], where the distribution of the exoU gene among MDR strains was 8.7%, while the aforementioned gene was absent in MDS. It is worth noting that the study also referred to the presence of the exoS and exoA genes, and the proportions of the genes among the genotypes varied significantly. The investigation by Mitov et al. [27] identified the presence of the exoU gene in 30.2% of the 202 strains tested, while the percentage of this gene among the strains isolated from cystic fibrosis patients was 28.6%, slightly below the level of 30.6% for the isolates from other origins. Horn et al. [28] studied a total of 189 clinical isolates and concluded that 22.8% of the strains carried the exoU gene, which was additionally associated with the multidrug resistance profiles of the strains. Moreover, Subedi et al. [29] also observed higher antibiotic resistance in exoU-positive strains. This stands in opposition to the results of our study, where the prevalence of this gene was similar in both the MDR and MDS strains.

Neuraminidase is also an important virulence factor involved in the pathogenesis of infections caused by P. aeruginosa [30]. The enzyme plays an integral role in respiratory tract infections by modifying receptors on the surfaces of the host cells and enabling mucosal colonization. Neuraminidase also affects cystic fibrosis pathogenesis, as it is involved in the bacterial colonization of mucins in the airways. The exact role of neuraminidase in the pathogenesis of infections is unexplored; however, nan1-negative P. aeruginosa strains fail to cause infections in in vivo models [31]. Our study reported the presence of the nan1 gene in 28.1% of the MDR and in 31.1% of the MDS strains. Our previous study identified the prevalence of the nan1 gene at a much higher level, occurring among 47.9% of the strains isolated from bloodstream infections, with variable levels of resistance to selected antibiotics [22]. It is noteworthy that the clinical samples in the previous study were also derived from patients at the same hospital. The absence of significant differences between the studies suggests a moderate dynamic of gene distribution in the local P. aeruginosa population [22]. Meanwhile, the study by Elmaraghy et al. [32] reported a higher presence of the nan1 gene among MDR (46.4%) compared to MDS strains (31.6%), which stands in opposition to this study. The nan1 gene was one of the least prevalent virulence genes among the studied strains in the cited study. As shown previously, the occurrence of the nan1 gene is strongly influenced by the type of material from which the strains are isolated. The study by Nikbin et al. [33] identified the nan1 gene in 4% of the P. aeruginosa strains derived from burn patients, in 30% of the strains isolated from infected wounds, and in 46.6% of the strains isolated from patients with respiratory tract infections. The second value was very close to the one obtained in our study, regardless of the susceptibility profiles of the investigated strains. The study by Mitov et al. [27] also noted the differential occurrence of the nan1 gene, depending on the origin of the clinical material. These authors found that the nan1 gene was most prevalent among the strains isolated from blood samples (62.5%), which was not an aspect of our study due to the high diversity of the strains’ origins. In contrast to the results of our study, these authors also demonstrated a statistically significant difference in the occurrence of the nan1 gene between the MDR and MDS strains, being 40.2% and 13.2%, respectively [27]. This observation additionally illustrates differential trends in the gene’s distribution [27].

The distributions of the pilA gene among the MDR and MDS P. aeruginosa strains were similar, while the least frequent gene in the entire study population was the pilB gene. In addition, a positive, moderate correlation was found in regard to the occurrence of both genes in the MDR isolates. The tendencies of our results are opposite to those of the study conducted by Haghi et al. [34], where the level of the pilA gene’s prevalence among the MDR strains was much higher (24.7%) when compared to the pilB gene’s presence (17.2%). In addition, the study of the gene distribution among strains isolated from meat samples similarly confirmed the lower distribution of the pilA gene compared to pilB, corresponding to 6.9% and 24.1%, respectively [35]. This may be supported by the fact that the gene has a relatively low distribution in the P. aeruginosa population, regardless of the clinical or environmental origin. However, more studies on the differences between strains and their sites of isolation are required. Moreover, in the present study, the antimicrobial-sensitive strains demonstrated a weak negative correlation, r = −0.232670, between pilA and exoU genes in terms of their presence.

According to our research, the MDR strains harbored more virulence genes than the MDS strains. These results stand in contrast with those reported by Deptuła et al. [36], who found that the antimicrobial-resistant strains were less virulent than their drug-sensitive counterparts. However, as the authors noted, the study should be confirmed by the implementation of molecular biology techniques. Our previous studies on the determination of the presence of the exoenzyme S-encoding gene in P. aeruginosa strains with different antibiotic sensitivities also indicated the predominance of this gene in the MDS strains (without a statistically significant difference) [37]. On the other hand, in their study, Sonbol et al. [38] showed a correlation between the occurrence of virulence genes and the resistance mechanisms. Other reports also suggest the high plasticity of the P. aeruginosa genome, providing evidence for the replacement of genes encoding virulence factors with those showing antibiotic resistance or the opposite [16,17,18].

The diverse distribution of virulence profiles among the tested strains allowed for an analysis of the dominant genotypes. The dominant genotype among the MDR strains was the III-R genotype, covering 35.1% of the isolates. The III-R genotype contained the lasB, plC N, plC H, and exoU genes. Among the MDS strains, 29.7% of the strains belonged to the genotype VII-S, which contained the lasB, plC N, and plC H genes. This result confirms the previously discussed versatility of the occurrence of these genes, regardless of the origins and resistance profiles of the investigated isolates. The study by Hassuna et al. [39] also indicated high proportions of lasB and exoU, additionally identifying the simultaneous occurrence of the aprA and exoS genes in different configurations of the genomes of the studied MDR clinical P. aeruginosa strains. Meanwhile, the results obtained by Gajdács et al. [40] showed no correlation between the presence of the virulence genes and antibiotic resistance profiles when the studied virulence factors were the pigments and motility of the strains. On the other hand, a study by Hwang et al. [41] demonstrated the non-virulence of the MDR strains of P. aeruginosa. The diverse scientific reports on this subject may result from variations in the origins of the strains (clinical vs. environmental), the types of clinical material, or the geographic localization. The continuous monitoring of the dynamics of gene ratio changes in the P. aeruginosa strains may contribute to the development of an effective predictive tool based on the most common genes in both the MDR and MDS strains [34,39,41].

4. Materials and Methods

4.1. The Examined Strains

In total, 74 MDS and 57 MDR clinical isolates of P. aeruginosa strains isolated between 2015 and 2019 were included in the study. The clinical samples were treated using a standard procedure of microbiological diagnostic investigation in our unit. All the samples were initially plated on Columbia agar base supplemented with 5% sheep blood, MacConkey agar, Sabouraud agar (all from Becton Dickinson, Franklin Lakes, NJ, USA), and Cetrimide agar (bioMérieux, Marcy L’Etoile, France). The cultures were kept overnight at 37 °C.

An initial identification was conducted based on the bacterial morphology (Gram stain), performed directly using specimens derived from purulent material and respiratory tract and pre-culture blood samples with a BacTec FX device (Becton Dickinson).

The culture-based methods revealed a typical growth of the bacteria on the selective medium and the biochemical reaction results (oxidase and catalase). The final identification was performed using the MALDI-TOF MS method, performed using a MALDI Biotyper device (Bruker, Mannheim, Germany). All the strains were isolated and collected in the Clinical Microbiology Laboratory of Doctor Antoni Jurasz University Hospital No. 1 in Bydgoszcz, Poland. After the identification step, the strains were stored in brain heart infusion with 20% glycerol at −80 °C.

The strains were isolated from various clinical samples derived from different patients and additionally checked for their similarity using pulsed-field gel electrophoresis. Our goal was to exclude undistinguishable restriction patterns and avoid the investigation of repeated isolates. The P. aeruginosa strains ATCC 27853 (obtained from the American Type Culture Collection) and PAO1 isolate (kindly provided by the National Medicines Institute in Warsaw, Poland) were used as PCR positive controls for the investigation of particular genes.

4.2. Antimicrobial Susceptibility Testing and Strain Selection Criteria

During the antimicrobial susceptibility testing (AST) step, the following methods were used: the disc diffusion method on Mueller–Hinton agar (Becton Dickinson) for ticarcillin/clavulanate, with microdilution for the colistin MIC evaluation tests (SensiTest Colistin, Liofilchem, Roseto degli Abruzzi, Italy) and NMIC-402 panels of a PhoenixTM M50 device (Becton Dickinson) for the remaining antimicrobials. Although the strains were isolated between 2015 and 2019, the results of the AST were interpreted according to the current European Committee on Antimicrobial Susceptibility Testing recommendations (EUCAST, Breakpoint tables for bacteria, Clinical breakpoints—bacteria v 12.0, 2022) in order to unify the strains’ susceptibility categories.

The strains that were phenotypically resistant to at least one of the representatives of at least three independent groups of antimicrobials were assigned to the MDR, as suggested by international experts of the European Centre for Disease Prevention and Control and the Centers for Disease Control and Prevention [42]. Those not fulfilling these criteria were assigned as MDS (sensitive to most of the antimicrobial groups).

4.3. Bacterial DNA Isolation

A Genomic Mini kit (A&A Biotechnology, Gdynia, Poland) was used for the DNA isolation, performed according to the manufacturer’s protocol. All the DNA samples were stored at −20 °C before their further use according to the purpose of the study.

4.4. Virulence Factors Genes Detection

The prevalence of 7 virulence-factor-encoding genes was determined by PCR in a separate reaction for each gene. The genes were amplified with primers selected on the basis of the published PAO1 strain genome sequence and the P. aeruginosa ATCC 27853 isolate, and the amplification procedure was carried out as previously described [43,44,45]. The reactions were performed in 0.2 mL test tubes (Eppendorf, Hamburg, Germany) with a final volume of 20 μL. Briefly, Taq polymerase was used with a total activity of 1 U per reaction in 1× concentrated polymerase buffer with 1.5 mM MgCl2 (Go Taq G2 Polymerase, Promega, Germany, FirePol DNA Polymerase, Solis BioDyne, Tartu, Estonia) and 200 μM deoxynucleotide triphosphates (Promega, Walldorf, Germany, Solis BioDyne, Tartu, Estonia). The primers were used at the final amount of 12.5 pmol per reaction (Integrated DNA Technologies, Coralville, IA, USA, Sigma, Darmstadt, Germany or Genomed, Warsaw, Poland). The primer sequences and the PCR annealing temperatures for each gene amplification are presented in Table 3. The DNA isolated from the P. aeruginosa PAO1 strain and the P. aeruginosa ATCC 27853 isolate served as the PCR positive controls. In the amplification procedure, a thermal cycler GeneAmp® PCR System 2700 (Applied Biosystems, Foster City, CA, USA) was used. The presence of amplicons in the particular genes was evaluated visually through the application of gel electrophoresis (1.5% agarose, Bio-Rad, Feldkirchen, Germany) based on the product size and control strain DNA amplification (Supplementary material, Figures S1–S7). For the arbitrarily selected samples, PCR duplicates were performed to confirm the repeatability of the results, providing consistent results in each case.

Table 3.

Specification of the PCR primers and parameters applied in the present study.

Virulence Factor Detected Gene/PCR
Primer Name
Manufacturer Primer Sequence 5′→3′ Tm
(°C)
Annealing
Temperature (°C)
Amplicon Size (bp)
Exotoxin U exoU F Sigma CCGTTGTGGTGCCGTTGAAG 55.9 64 134
exoU R CCAGATGTTCACCGACTCGC 55.9
Phospholipase C (non-hemolytic) plC N F Integrated DNA
Technologies
GTTATCGCAACCAGCCCTAC 55.9 54 466
plC N R AGGTCGAACACCTGGAACAC 57.2
Phospholipase C (hemolytic) plC H F GAAGCCATGGGCTACTTCAA 55.1 50 307
plC H R AGAGTGACGAGGAGCGGTAG 58.2
Elastase B lasB F Genomed GGAATGAACGAAGCGTTCTC 51.8 50 300
lasB R GGTCCAGTAGTAGCGGTTGG 55.9
Pilin A pilA F ACAGCATCCAACTGAGCG 50.3 59 1675
pilA R TTGACTTCCTCCAGGCTG 50.3
Pilin B pilB F TCGAACTGATGATCGTGG 48.0 56 408
pilB R CTTTCGGAGTGAACATCG 48.0
Neuraminidase 1 nan1 F AGGATGAATACTTATTTTGAT 42.6 47 1316
nan1 R TCACTAAATCCATCTCTGACCCGATA 56.4

4.5. Statistical Methods

Spearman’s rank correlation coefficient was calculated to investigate the correlations between particular genes, in terms of their presence, in a group of MDS and MDR strains (α = 0.05). Fisher’s two-rank exact test was applied to investigate the differences between the presence of particular genes in a group of MDS and MDR strains (α = 0.05). The chi-square (χ2) test was used to investigate the statistical significance of the correlation between the presence of a particular genotype in a group of MDS or MDR strains (α 0.05). Due to the high diversity of the genotypic compositions, this calculation was performed only for the genotypes represented by at least 11 strains in the whole group of the examined P. aeruginosa population.

All the calculations were performed using the STATISTICA 13.1 (data analysis software system, Poland) program of StatSoft, Inc., Cracow, Poland (2017).

5. Conclusions

This study found a higher prevalence of genes determining virulence factors in the MDR strains, but more research is needed on the prevalence and expression levels of these genes in MDR strains. The presence of P. aeruginosa can be confirmed using the broad dissemination of these genes in the study population. However, the presence of the lasB and plC N genes amongst the majority of the P. aeruginosa isolates, including all the MDR P. aeruginosa, might be used as a specific marker for diagnostic purposes. Overall, a higher diversity of genotypes was found among the MDS strains (18 profiles) when compared to the MDR strains (nine genotypes). The monitoring of the variability in the resistance and virulence genotypes can provide a useful tool with which to control P. aeruginosa infections more effectively, at least in the case of those caused by the strains presenting the MDR phenotype.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24021269/s1.

Author Contributions

Conceptualization, T.B.; data curation, T.B.; formal analysis, T.B.; funding acquisition, T.B.; investigation, T.B., D.D., S.K., and M.R.; methodology, T.B.; project administration, T.B.; resources, T.B.; software, T.B.; supervision, T.B.; validation, T.B.; writing—original draft, T.B., J.H.L., and P.K.; writing—review and editing, T.B., D.D., S.K., A.R., P.K., M.R., J.H.L., A.D., and E.G.-K. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

This study was approved by the Bioethical Commission of Ludwik Rydygier Collegium Medicum at Bydgoszcz Nicolaus Copernicus University in Toruń under the approval codes KB 253/2017 (date of approval: 21 March 2017) and 287/2018 (date of approval: 24 April 2018).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This research was financially supported by the Nicolaus Copernicus University funds for the basic research activity of the Microbiology Department, Ludwik Rydygier Collegium Medicum in Bydgoszcz, Poland (PDB WF 839). The authors also acknowledge funding from FCT—Fundação para a Ciência e a Tecnologia, I.P., in the scope of the project UIDB/04565/2020 and UIDP/04565/2020 of the Research Unit Institute for Bioengineering and Biosciences—iBB and the project LA/P/0140/2020 of the Associate Laboratory Institute for Health and Bioeconomy—i4HB.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Myles I.A., Moore I.N., Castillo C.R., Datta S.K. Differing Virulence of Healthy Skin Commensals in Mouse Models of Infection. Front. Cell. Infect. Microbiol. 2019;8:451. doi: 10.3389/fcimb.2018.00451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Crone S., Vives-Flórez M., Kvich L., Saunders A.M., Malone M., Nicolaisen M.H., Martínez-García E., Rojas-Acosta C., Catalina Gomez-Puerto M., Calum H., et al. The Environmental Occurrence of Pseudomonas aeruginosa. APMIS. 2020;128:220–231. doi: 10.1111/apm.13010. [DOI] [PubMed] [Google Scholar]
  • 3.Thi M.T.T., Wibowo D., Rehm B.H.A. Pseudomonas aeruginosa Biofilms. Int. J. Mol. Sci. 2020;21:8671. doi: 10.3390/ijms21228671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Laborda P., Hernando-Amado S., Martínez J.L., Sanz-García F. Antibiotic Resistance in Pseudomonas. Adv. Exp. Med. Biol. 2022;1386:117–143. doi: 10.1007/978-3-031-08491-1_5. [DOI] [PubMed] [Google Scholar]
  • 5.Qin S., Xiao W., Zhou C., Pu Q., Deng X., Lan L., Liang H., Song X., Wu M. Pseudomonas aeruginosa: Pathogenesis, Virulence Factors, Antibiotic Resistance, Interaction with Host, Technology Advances and Emerging Therapeutics. Signal Transduct. Target. Ther. 2022;7:199. doi: 10.1038/s41392-022-01056-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Botelho J., Grosso F., Peixe L. Antibiotic Resistance in Pseudomonas aeruginosa—Mechanisms, Epidemiology and Evolution. Drug Resist. Updat. 2019;44:100640. doi: 10.1016/j.drup.2019.07.002. [DOI] [PubMed] [Google Scholar]
  • 7.Tuon F.F., Dantas L.R., Suss P.H., Tasca Ribeiro V.S. Pathogenesis of the Pseudomonas aeruginosa Biofilm: A Review. Pathogens. 2022;11:300. doi: 10.3390/pathogens11030300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.De Oliveira D.M.P., Forde B.M., Kidd T.J., Harris P.N.A., Schembri M.A., Beatson S.A., Paterson D.L., Walker M.J. Antimicrobial Resistance in ESKAPE Pathogens. Clin. Microbiol. Rev. 2020;33:e00181-19. doi: 10.1128/CMR.00181-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Miyoshi-Akiyama T., Tada T., Ohmagari N., Viet Hung N., Tharavichitkul P., Pokhrel B.M., Gniadkowski M., Shimojima M., Kirikae T. Emergence and Spread of Epidemic Multidrug-Resistant Pseudomonas aeruginosa. Genome Biol. Evol. 2017;9:3238–3245. doi: 10.1093/gbe/evx243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Pachori P., Gothalwal R., Gandhi P. Emergence of Antibiotic Resistance Pseudomonas aeruginosa in Intensive Care Unit; a Critical Review. Genes Dis. 2019;6:109–119. doi: 10.1016/j.gendis.2019.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Urbanowicz P., Gniadkowski M. “Ciężkozbrojny” Pseudomonas aeruginosa: Mechanizmy lekooporności i ich tło genetyczne. Kosmos. 2017;66:11–29. [Google Scholar]
  • 12.De Sousa T., Hébraud M., Dapkevicius M.L.N.E., Maltez L., Pereira J.E., Capita R., Alonso-Calleja C., Igrejas G., Poeta P. Genomic and Metabolic Characteristics of the Pathogenicity in Pseudomonas aeruginosa. Int. J. Mol. Sci. 2021;22:12892. doi: 10.3390/ijms222312892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Prioritization of Pathogens to Guide Discovery, Research and Development of New Antibiotics for Drug-Resistant Bacterial Infections, Including Tuberculosis. [(accessed on 19 November 2022)]. Available online: https://www.who.int/publications-detail-redirect/WHO-EMP-IAU-2017.12.
  • 14.Litwin A., Rojek S., Gozdzik W., Duszynska W. Pseudomonas aeruginosa Device Associated—Healthcare Associated Infections and Its Multidrug Resistance at Intensive Care Unit of University Hospital: Polish, 8.5-Year, Prospective, Single-Centre Study. BMC Infect. Dis. 2021;21:180. doi: 10.1186/s12879-021-05883-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Galdino A.C.M., de Oliveira M.P., Ramalho T.C., de Castro A.A., Branquinha M.H., Santos A.L.S. Anti-Virulence Strategy against the Multidrug-Resistant Bacterial Pathogen Pseudomonas aeruginosa: Pseudolysin (Elastase B) as a Potential Druggable Target. Curr. Protein Pept. Sci. 2019;20:471–487. doi: 10.2174/1389203720666190207100415. [DOI] [PubMed] [Google Scholar]
  • 16.Elmouaden C., Laglaoui A., Ennanei L., Bakkali M., Abid M. Virulence Genes and Antibiotic Resistance of Pseudomonas aeruginosa Isolated from Patients in the Northwestern of Morocco. J. Infect. Dev. Ctries. 2019;13:892–898. doi: 10.3855/jidc.10675. [DOI] [PubMed] [Google Scholar]
  • 17.Ratajczak M., Kamińska D., Nowak-Malczewska D.M., Schneider A., Dlugaszewska J. Relationship between Antibiotic Resistance, Biofilm Formation, Genes Coding Virulence Factors and Source of Origin of Pseudomonas aeruginosa Clinical Strains. Ann. Agric. Environ. Med. AAEM. 2021;28:306–313. doi: 10.26444/aaem/122682. [DOI] [PubMed] [Google Scholar]
  • 18.Al Dawodeyah H.Y., Obeidat N., Abu-Qatouseh L.F., Shehabi A.A. Antimicrobial Resistance and Putative Virulence Genes of Pseudomonas aeruginosa Isolates from Patients with Respiratory Tract Infection. Germs. 2018;8:31–40. doi: 10.18683/germs.2018.1130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Benie C.K.D., Dadié A., Guessennd N., N’gbesso-Kouadio N.A., Kouame N.D., N’golo D.C., Aka S., Dako E., Dje K.M., Dosso M. Characterization of Virulence Potential of Pseudomonas aeruginosa Isolated from Bovine Meat, Fresh Fish, and Smoked Fish. Eur. J. Microbiol. Immunol. 2017;7:55–64. doi: 10.1556/1886.2016.00039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kaszab E., Radó J., Kriszt B., Pászti J., Lesinszki V., Szabó A., Tóth G., Khaledi A., Szoboszlay S. Groundwater, Soil and Compost, as Possible Sources of Virulent and Antibiotic-Resistant Pseudomonas aeruginosa. Int. J. Environ. Health Res. 2021;31:848–860. doi: 10.1080/09603123.2019.1691719. [DOI] [PubMed] [Google Scholar]
  • 21.Monturiol-Gross L., Villalta-Romero F., Flores-Díaz M., Alape-Girón A. Bacterial Phospholipases C with Dual Activity: Phosphatidylcholinesterase and Sphingomyelinase. FEBS Open Bio. 2021;11:3262–3275. doi: 10.1002/2211-5463.13320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bogiel T., Depka D., Rzepka M., Mikucka A. Decoding Genetic Features and Antimicrobial Susceptibility of Pseudomonas aeruginosa Strains Isolated from Bloodstream Infections. Int. J. Mol. Sci. 2022;23:9208. doi: 10.3390/ijms23169208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rossi Gonçalves I., Dantas R.C.C., Ferreira M.L., Batistão D.W.F., Gontijo-Filho P.P., Ribas R.M. Carbapenem-Resistant Pseudomonas aeruginosa: Association with Virulence Genes and Biofilm Formation. Braz. J. Microbiol. 2016;48:211–217. doi: 10.1016/j.bjm.2016.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wolska K., Szweda P. Genetic Features of Clinical Pseudomonas aeruginosa Strains. Pol. J. Microbiol. 2009;58:255–260. [PubMed] [Google Scholar]
  • 25.Foulkes D.M., McLean K., Haneef A.S., Fernig D.G., Winstanley C., Berry N., Kaye S.B. Pseudomonas aeruginosa Toxin ExoU as a Therapeutic Target in the Treatment of Bacterial Infections. Microorganisms. 2019;7:707. doi: 10.3390/microorganisms7120707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Naik P., Pandey S., Gagan S., Biswas S., Joseph J. Virulence Factors in Multidrug (MDR) and Pan-Drug Resistant (XDR) Pseudomonas aeruginosa: A Cross-Sectional Study of Isolates Recovered from Ocular Infections in a High-Incidence Setting in Southern India. J. Ophthalmic Inflamm. Infect. 2021;11:36. doi: 10.1186/s12348-021-00268-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mitov I., Strateva T., Markova B. Prevalence of Virulence Genes among Bulgarian Nosocomial and Cystic Fibrosis Isolates of Pseudomonas aeruginosa. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 2010;41:588–595. doi: 10.1590/S1517-83822010000300008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Horna G., Amaro C., Palacios A., Guerra H., Ruiz J. High Frequency of the ExoU+/ExoS+ Genotype Associated with Multidrug-Resistant “High-Risk Clones” of Pseudomonas aeruginosa Clinical Isolates from Peruvian Hospitals. Sci. Rep. 2019;9:10874. doi: 10.1038/s41598-019-47303-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Subedi D., Vijay A.K., Kohli G.S., Rice S.A., Willcox M. Association between Possession of ExoU and Antibiotic Resistance in Pseudomonas aeruginosa. PLoS ONE. 2018;13:e0204936. doi: 10.1371/journal.pone.0204936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wolska K., Kot B., Mioduszewska H., Sempruch C., Borkowska L., Rymuza K. Occurrence of the nan1 gene and adhesion of Pseudomonas aeruginosa isolates to human buccal epithelial cells. Biol. Lett. 2012;49:59–64. doi: 10.2478/v10120-012-0011-6. [DOI] [Google Scholar]
  • 31.Soong G., Muir A., Gomez M.I., Waks J., Reddy B., Planet P., Singh P.K., Kaneko Y., Kanetko Y., Wolfgang M.C., et al. Bacterial Neuraminidase Facilitates Mucosal Infection by Participating in Biofilm Production. J. Clin. Invest. 2006;116:2297–2305. doi: 10.1172/JCI27920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Elmaraghy N., Abbadi S., Elhadidi G., Hashem A., Yousef A. Virulence Genes in Pseudomonas aeruginosa Strains Isolated at Suez Canal University Hospitals with Respect to the Site of Infection and Antimicrobial Resistance. Int. J. Clin. Microbiol. Biochem. Technol. 2019;2:8–19. doi: 10.29328/journal.ijcmbt.1001006. [DOI] [Google Scholar]
  • 33.Nikbin V.S., Aslani M.M., Sharafi Z., Hashemipour M., Shahcheraghi F., Ebrahimipour G.H. Molecular Identification and Detection of Virulence Genes among Pseudomonas aeruginosa Isolated from Different Infectious Origins. Iran. J. Microbiol. 2012;4:118–123. [PMC free article] [PubMed] [Google Scholar]
  • 34.Haghi F., Zeighami H., Monazami A., Toutouchi F., Nazaralian S., Naderi G. Diversity of Virulence Genes in Multidrug Resistant Pseudomonas aeruginosa Isolated from Burn Wound Infections. Microb. Pathog. 2018;115:251–256. doi: 10.1016/j.micpath.2017.12.052. [DOI] [PubMed] [Google Scholar]
  • 35.Rezaloo M., Motalebi A., Mashak Z., Anvar A. Prevalence, Antimicrobial Resistance, and Molecular Description of Pseudomonas aeruginosa Isolated from Meat and Meat Products. J. Food Qual. 2022;2022:1–11. doi: 10.1155/2022/9899338. [DOI] [Google Scholar]
  • 36.Deptuła A., Gospodarek E. Reduced Expression of Virulence Factors in Multidrug-Resistant Pseudomonas aeruginosa Strains. Arch. Microbiol. 2010;192:79–84. doi: 10.1007/s00203-009-0528-1. [DOI] [PubMed] [Google Scholar]
  • 37.Bogiel T., Mikucka A., Skalski T., Gospodarek E. Occurrence and susceptibility to antibiotics of carbapenem-resistant Pseudomonas aeruginosa strains between 1998 and 2009. Med. Dosw. Mikrobiol. 2010;62:221–229. [PubMed] [Google Scholar]
  • 38.Sonbol F., Khalil M., Mohamed A., Ali S. Correlation between Antibiotic Resistance and Virulence Of Pseudomonas aeruginosa Clinical Isolates. Turk. J. Med. Sci. 2015;45:568–577. doi: 10.3906/sag-1406-58. [DOI] [PubMed] [Google Scholar]
  • 39.Hassuna N.A., Mandour S.A., Mohamed E.S. Virulence Constitution of Multi-Drug-Resistant Pseudomonas aeruginosa in Upper Egypt. Infect. Drug Resist. 2020;13:587–595. doi: 10.2147/IDR.S233694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Gajdács M., Baráth Z., Kárpáti K., Szabó D., Usai D., Zanetti S., Donadu M.G. No Correlation between Biofilm Formation, Virulence Factors, and Antibiotic Resistance in Pseudomonas aeruginosa: Results from a Laboratory-Based In Vitro Study. Antibiotics. 2021;10:1134. doi: 10.3390/antibiotics10091134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hwang W., Yoon S.S. Virulence Characteristics and an Action Mode of Antibiotic Resistance in Multidrug-Resistant Pseudomonas aeruginosa. Sci. Rep. 2019;9:487. doi: 10.1038/s41598-018-37422-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Magiorakos A.-P., Srinivasan A., Carey R.B., Carmeli Y., Falagas M.E., Giske C.G., Harbarth S., Hindler J.F., Kahlmeter G., Olsson-Liljequist B., et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2012;18:268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
  • 43.Finnan S., Morrissey J.P., O’Gara F., Boyd E.F. Genome Diversity of Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients and the Hospital Environment. J. Clin. Microbiol. 2004;42:5783–5792. doi: 10.1128/JCM.42.12.5783-5792.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Lanotte P., Watt S., Mereghetti L., Dartiguelongue N., Rastegar-Lari A., Goudeau A., Quentin R. Genetic Features of Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients Compared with Those of Isolates from Other Origins. J. Med. Microbiol. 2004;53:73–81. doi: 10.1099/jmm.0.05324-0. [DOI] [PubMed] [Google Scholar]
  • 45.Ajayi T., Allmond L.R., Sawa T., Wiener-Kronish J.P. Single-Nucleotide-Polymorphism Mapping of the Pseudomonas aeruginosa Type III Secretion Toxins for Development of a Diagnostic Multiplex PCR System. J. Clin. Microbiol. 2003;41:3526–3531. doi: 10.1128/JCM.41.8.3526-3531.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The data presented in this study are available on request from the corresponding author.


Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES