Abstract
Arbuscular mycorrhizal fungi (AMF) form mutualistic symbiotic relationships with many land plants and play a key role in nitrogen (N) acquisition. NO3−-N and NH4+-N are the main sources of soil mineral N, but how extraradical mycelial transfer affects the different N forms and levels available to tomato plants is not clear. In the present study, we set up hyphal compartments (HCs) to study the efficiency of N transfer from the extramycelium to tomato plants treated with different N forms and levels of fertilization. Labeled 15NO3−-N or 15NH4+-N was placed in hyphal compartments under high and low N application levels. 15N accumulation in shoots and the expression of LeNRT2.3, LeAMT1.1, and LeAMT1.2 in the roots of tomato were measured. According to our results, both 15NO3−-N and 15NH4+-N were transported via extraradical mycelia to the shoots of plants. 15N accumulation in shoots was similar, regardless of the N form, while a higher 15N concentration was found in shoots with low N application. Compared with the control, inoculation with AMF significantly increased the expression of LeAMT1.1 under high N and LeNRT2.3 under low N. The expression of LeAMT1.1 under high N was significantly increased when NO3—N was added, while the expression of LeNRT2.3 was significantly increased when NH4+-N was added under low N. Taken together, our results suggest that the N transfer by extraradical mycelia is crucial for the acquisition of both NO3−-N and NH4+-N by the tomato plant; however, partial N accumulation in plant tissue is more important with N deficiency compared with a higher N supply. The expression of N transporters was influenced by both the form and level of N supply.
Keywords: arbuscular mycorrhizal fungi, nitrogen transfer, tomato, LeAMT1.1, LeNRT2.3
1. Introduction
Arbuscular mycorrhizal fungi (AMF) can form symbiotic relationships with more than 80% of land plants and play a key role in their nutrition [1,2]. After symbiosis is established, mycorrhizal roots with a “mycorrhizal nutrient absorption pathway” improve the mineral nutrient content of plants via a hyphal network known as the extramycelium (ERM), which is an extension of the plant root system [3,4]. Plants promote this symbiosis, as they are commonly limited by one of the two major nutrients, phosphorus (P) and nitrogen (N) [5]. Under such conditions, the mycorrhizal roots have two means of nutrient absorption: the plant pathway and the mycorrhizal pathway. The plant pathway involves the absorption of nutrients through high- or low-affinity absorption transporters in the epidermis or root hairs. For nutrients with low mobility in the soil, absorption through the plant pathway is usually limited by their depletion in the zone around the root. In contrast, the mycorrhizal pathway involves high-affinity nutrient transporters in the ERM, which take up nutrients and transport them along the hyphae to the rhizosphere hyphae (IRM) in the root cortex [1].
As one of the most important macronutrients, N accounts for 1–5% of the dry weight of plants. Over the last two decades, it has also been recognized that AMF plays a crucial role in the uptake by plants [6], while the soil nitrogen level is one of the factors affecting the inoculation effect of AMF [7]. The absorption of plant N transporters is induced by mycorrhization [1]. Isotopic labeling with 15N directly demonstrates that AMF hyphae can absorb and transport mineral N from the soil to their host plants [8]. As AMF can obtain enriched N sources, N transfer from hyphae to hosts may be huge [9]. However, compared with root absorption, AMF-derived N alone may be limited, as the potential N absorption and transport rates of mycelia are only higher than those of roots with low N (both NO3− or NH4+) content in their soil [10].
Both the amounts and forms of N in the cultivation medium can affect the mycorrhizal infection rate, the amount of N transported by AMF to host plants, and mycelial density [11]. In most soil environments, the main form of mineral N is NO3−; however, in wetlands or highly acidic soils, NH4+ is dominant [12]. Although both forms of N (NO3− or NH4+) can be absorbed by the external hyphae of AMF (Rhizophagus intraradices) and transported to the host plant [13,14,15,16], the hyphae preferentially absorb NH4+ [14,17,18]. The amount of N transferred to plants is high following an NH4+ fertilizer application [19]. However, applying only NH4+ reduces the activity of mycorrhiza compared with applying only NO3− [20,21].
Mycorrhizal formation can directly affect the process of plant nutrient absorption and metabolism; further, it can make the growth and development of plants more advantageous than non-mycorrhizal plants and improve crop yield and fruit quality [22]. The tomato plant (Lycopersicum esculentum L.) is the second most important vegetable crop worldwide; however, the effect of AMF on N uptake by tomato plants in relation to N availability and forms has yet to be identified.
At the molecular level, both the NH4+ and NO3− transporters of hosts are regulated in AMF symbiotic plants [23,24]. In tomatoes, the NH4+ transporters of LeAMT1.1 and LeAMT1.2 are expressed in root hairs and leaves under N-deficient conditions, while under hydroponic growing conditions, the transcript level of LeAMT1.2 in the roots increases after NO3− or NH4+ supplementation, whereas that of LeAMT1.1 is induced by N deficiency [25]. AMF excrete NH4+ to levels that can be sensed by tomato roots, and this is consistent with the induced expression of LeAMT1.2 by as little as ≥1 µM external NH4+ with root-associated N2-fixing bacteria [26]. Rice plants colonized by R. irregularis strongly induce the expression of an NH4+ transporter (OsAMT3.1) in roots under both low and high rates of N application. As AMF increases NH4+, AMT expression could be changed due to colonization.
However, as mycorrhizal-inducing N transporters are up-regulated, the expression of nitrate transporter genes changes in host plants, thus changing the ability of plants to obtain NO3− [24,27,28,29]. Hildebrandt et al. (2002) found that inoculation with R. irregularis up-regulated LeNRT2 in tomato roots [30]; in particular, LeNRT2.3 is related to mycorrhization and is abundantly expressed in root cells containing AMF structures, such as plexus branches and vesicles [30]. These results indicate that AMF colonization positively affects nitrate uptake from the soil and nitrate allocation to the plant partner, probably preferentially mediated by LeNRT2.3. So, LeNRT2.3 functions as a low-affinity transporter, whose activity allows higher N-use efficiency in tomatoes [31]; therefore, AMF colonization positively affects nitrate uptake from the soil and nitrate allocation to the plant partner, probably preferentially mediated by LeNRT2.3 [30].
How different N levels available and N forms in the mycorrhizal symbiosis system induce the expression of these nitrogen transporters is not fully understood. We hypothesized that N transport via AMF hyphae and LeNRT2.3, LeAMT1.1, and 1.2 expression might be correlated with N status and N forms in the hyphosphere. In the present study, hyphal compartments were used to explore the effects of two N levels and forms on mycorrhizal tomato plants. The colonization rates, plant nutrition, growth status, and LeNRT2.3, LeAMT1.1, and 1.2 expression were monitored.
2. Results
2.1. Effects of AMF on Nitrogen Uptake by AMF and 15N in Shoots
In Table 1, the data show that 15N abundances were detected (from 0.074‰ to 0.138‰) in all mycorrhizal plants with all N forms and levels. The results were significantly higher in mycorrhizal plants with NH4+ fertilization in HCs under lower-N fertilization (Table 1). There was a significant difference between N levels, from 078‰ to 0.118‰ of 15N in shoots, which, with the high-N fertilization of plants, was 20.4 µg plant-1, compared with low N, which was 16.3 µg per plant (Table 1).
Table 1.
Tomato shoot 15N abundance, different N levels and forms on tomato root colonization, and hyphal length of the fungal compartment after inoculation with AMF.
| Treatments | 15N Abundance | 15N Transported | AMF Colonization | Hyphal Density | |
|---|---|---|---|---|---|
| (‰) | (μg·plant−1) | (%) | (cm g−1 Substrate) | ||
| HN # | NO3− | 0.074 ± 0.006 b | 20.7 ± 2.13 a | 58.3 ± 5.18 a | 22.3 ± 4.70 a |
| NH4+ | 0.083 ± 0.014 b | 20.0 ± 4.00 a | 61.7 ± 1.65 a | 10.5 ± 1.97 a | |
| LN # | NO3− | 0.097 ± 0.011 ab | 14.2 ± 1.32 a | 53.3 ± 4.09 a | 16.2 ± 5.19 a |
| NH4+ | 0.138 ± 0.015 a | 18.4 ± 2.50 a | 58.3 ± 3.18 a | 16.1 ± 3.35 a | |
| N levels & | |||||
| HN | 0.078 ± 0.021 a | 20.4 ± 2.11 a | 60.0 ± 2.59 a | 16.4 ± 3.23 a | |
| LN | 0.118 ± 0.033 b | 16.3 ± 1.53 a | 55.8 ± 2.58 a | 16.1 ± 2.86 a | |
| N forms in HCs & | |||||
| NO3− | 0.086 ± 0.021 a | 17.5 ± 1.69 a | 55.8 ± 3.20 a | 19.2 ± 3.44 a | |
| NH4+ | 0.110 ± 0.040 a | 19.2 ± 2.21 a | 60.0 ± 1.77 a | 13.3 ± 2.08 a | |
| Significance | |||||
| N levels | ** | ns | ns | ns | |
| N forms | ns | ns | ns | ns | |
| N levels * N forms | * | ns | ns | ns | |
Note: HN means high-nitrogen treatment (160 mg L−1) in the root compartment, and LN means low-nitrogen treatment (94mg L−1) in the root compartment. HCs are hyphal compartments. #: The results are mean ± SE (n = 4). The error line is the standard error. &: The results are mean ± SD, n = 8. Multiple comparisons were performed by two-way ANOVA, and different letters indicate a significant difference between treatments (p < 0.05). The same letter indicates no significant difference between treatments. *, p < 0.05; **, p < 0.01; ns, non-significant, same as below.
With high-N fertilization, neither the N concentration nor the content per plant was affected by AMF inoculation, while under low N application, the N concentration was increased from 1.24% to 1.46%, and N uptake was increased from 114.4 mg to 140.1 mg per plant. The P concentration and uptake were not affected by the difference in N fertilization (Table 2). The N form added in HCs did not affect the N absorbed by plants (Table 2). Furthermore, the colonization levels of AMF and hyphal length were similar among N levels and forms. However, the ratio of the colonization rate to the hyphal length was 2.9 with NO3− and 4.5 with NH4+ in HCs (Table 1).
Table 2.
Effects of AMF and N form on tomato shoot N and P under different N levels.
| Treatments | HN | LN | ||||||
|---|---|---|---|---|---|---|---|---|
| N Concentration | N Uptake | P Concentration | P Uptake | N Concentration | N Uptake | P Concentration | P Uptake | |
| (%) | (mg plant−1) | (mg plant−1) | (mg plant−1) | (%) | (mg plant−1) | (mg plant−1) | (mg plant−1) | |
| Inoculation | ||||||||
| +AMF | 1.46 ± 0.10 a | 263.7 ± 23.4 a | 3.49 ± 0.23 a | 62.55 ± 1.88 a | 1.46 ± 0.03 a | 140.1 ± 4.76 a | 4.17 ± 0.06 a | 40.0 ± 1.08 a |
| −AMF | 1.49 ± 0.02 a | 259.3 ± 5.68 a | 3.31 ± 0.07 a | 57.85 ± 4.23 a | 1.24 ± 0.02 b | 114.4 ± 1.86 b | 4.24 ± 0.06 a | 39.3 ± 0.75 a |
| Nitrogen forms in HCs | ||||||||
| AMF HCs NO3− | 1.58 ± 0.19 a | 289.6 ± 44.0 a | 3.54 ± 0.37 a | 64.4 ± 7.67 a | 1.45 ± 0.03 a | 147.58 ± 6.66 a | 4.16 ± 0.11 a | 42.2 ± 1.40 a |
| AMF HCs NH4+ | 1.34 ± 0.01 a | 237.8 ± 13.0 a | 3.45 ± 0.33 a | 60.7 ± 4.75 a | 1.46 ± 0.06 a | 132.67 ± 4.93 a | 4.18 ± 0.07 a | 37.9 ± 0.73 b |
| Significance | ||||||||
| AMF | ns | ns | ns | ns | *** | *** | ns | ns |
| Nitrogen forms | ns | ns | ns | ns | ns | ns | ns | ns |
| AMF * Nitrogen forms | ns | ns | ns | ns | ns | ns | ns | * |
Note: The results are mean ± SD, n = 8. Multiple comparisons were performed by two-way ANOVA, and the same letter indicates no significant difference between treatments. *, p < 0.05; ***, p < 0.001.
Neither shoot nor root biomass was significantly affected by inoculation with AMF and did not significantly differ between mycorrhizal plants and non-inoculated plants (Table 3). There was a large difference owing to the N fertilization levels. The total biomass of tomato plants was 19.1–19.8 g plant−1 with high-N fertilization, while with low-N fertilization, it was 10.2–10.7 g plant−1. With AMF inoculation, the biomass was not significantly affected compared with uninoculated plants (Table 3). With low N application, both the shoot and total biomass were slightly increased owing to the NO3− added in HCs compared with NH4+ (Table 3).
Table 3.
Effects of AMF and N form on tomato plant biomass under different N levels.
| Treatments | HN | LN | ||||
|---|---|---|---|---|---|---|
| Shoots | Roots | Total Plant | Shoots | Roots | Total Plant | |
| (g plant−1) | (g plant−1) | (g plant−1) | (g plant−1) | (g plant−1) | (g plant−1) | |
| Inoculation | ||||||
| +AMF | 17.9 ± 0.61 a | 1.88 ± 0.09 a | 19.8 ± 0.61 a | 9.61 ± 0.29 a | 1.12 ± 0.06 a | 10.7 ± 0.03 a |
| −AMF | 17.5 ± 0.33 a | 1.68 ± 0.14 a | 19.1 ± 0.26 a | 9.25 ± 0.08 a | 1.01 ± 0.06 a | 10.3 ± 0.12 a |
| N forms in HC | ||||||
| NO3− | 18.1 ± 0.67 a | 1.89 ± 0.09 a | 20.0 ± 0.74 a | 10.20 ± 0.36 a | 1.05 ± 0.09 a | 11.2 ± 0.35 a |
| NH4+ | 17.8 ± 1.11 a | 1.86 ± 0.18 a | 19.6 ± 1.06 a | 9.08 ± 0.27 b | 1.20 ± 0.06 a | 10.3 ± 0.32 b |
| Significance | ||||||
| ±AMF | ns | ns | ns | ns | ns | ns |
| N forms | ns | ns | ns | ns | ns | ns |
| AMF *N forms | ns | ns | ns | * | ns | ns |
Note: HN means high-nitrogen treatment (160mg L−1) in the root compartment, and LN means low-nitrogen treatment (94mg L−1) in the root compartment. HCs are hyphal compartments. The results are mean ± SD, n = 8. Error line is the standard error. Multiple comparisons were performed by two-way ANOVA, and different letters indicate a significant difference between treatments (p < 0.05). The same letter indicates no significant difference between treatments. *, p < 0.05.
2.2. Effects of AMF on Nitrogen Transporter Expression
Transcript levels of the LeAMT1.1 and LeNRT2.3 genes were induced in the roots of mycorrhizal plants, and this differed among N levels and forms in HCs (Table 4). Inoculation with AMF (Funneliformis mosseae) significantly up-regulated the expression of LeAMT1.1 and LeNRT2.3 genes with high- and low-N fertilization, respectively. Significant up-regulation of LeAMT1.1 was observed with NO3−, while that of LeNRT2.3 was associated with NH4+ in HCs (Table 2).
Table 4.
Effects of AMF and N form on nitrogen transporter genes expression of tomato root under different N levels.
| Treatments | HN | LN | ||||
|---|---|---|---|---|---|---|
| LeNRT2.3 | LeAMT1.1 | LeAMT1.2 | LeNRT2.3 | LeAMT1.1 | LeAMT1.2 | |
| Inoculation | ||||||
| +AMF | 1.12 ± 0.29 a | 1.88 ± 0.44 a | 1.26 ± 0.17 a | 1.12 ± 0.23 a | 0.72 ± 0.28 a | 0.95 ± 0.32 a |
| −AMF | 0.58 ± 0.21 a | 0.83 ± 0.29 b | 1.11 ± 0.17 a | 0.51 ± 0.12 b | 1.30 ± 0.22 a | 1.10 ± 0.16 a |
| Nitrogen forms (HCs) | ||||||
| NO3− | 0.97 ± 0.29 a | 2.67 ± 0.56 a | 1.36 ± 0.36 a | 0.68 ± 0.17 b | 0.33 ± 0.03 a | 0.73 ± 0.09 a |
| NH4+ | 1.27 ± 0.56 a | 1.09 ± 0.14 b | 1.16 ± 0.10 a | 1.56 ± 0.23 a | 1.10 ± 0.50 a | 1.18 ± 0.68 a |
| Significance | ||||||
| ±AMF | ns | ** | ns | * | ns | ns |
| Nitrogen forms (HCs) | ns | * | ns | ns | ns | ns |
| ±AMF * Nitrogen forms | ns | * | ns | * | ns | ns |
Note: HN means high-nitrogen treatment (160mg L−1) in the root compartment, and LN means low-nitrogen treatment (94mg L−1) in the root compartment. HCs are hyphal compartments. The results are mean ± SD, n = 8. Error line is the standard error. Multiple comparisons were performed by two-way ANOVA, and different letters indicate a significant difference between treatments (p < 0.05). The same letter indicates no significant difference between treatments. *, p < 0.05; **, p < 0.01.
3. Materials and Methods
3.1. Experimental Site and Design
Experimental Protocol and Treatments
The substrate used was 3–5 mm of sterilized vermiculite with two compartments: one was the root compartment (RT), and the other was the hyphal compartment (HC) in each 3.5 L pot with an air gap separating the RT and HC. The extraradical mycelium (ERM) in fungal HCs had a volume of 250 mL surrounded by a 30 μm mesh membrane through which hyphae but not roots could grow, and each RT had a volume of 2.5 L. The 15N transfer between the colonized root compartment and the mycelial compartment only takes place via fungi: i.e., both diffusion and mass flow between the inner compartment and the pot were prevented due to the air gap between the RT and HC compartments [16,32]. As listed in Table 5, two levels and two forms of N fertilization were applied in the root compartments (root + fungal pots) and in HCs. NH4+ and NO3− were added as (15NH4)2SO4 and K15NO3. All HCs with treatments of NH4+ were supplemented with 1.2 mg of nitropyridine to prevent nitrification. The plants were fertilized with a nutrient solution modified following Hoagland and Arnon (1950) that supports the growth of tomato plants [33]. The substrates (per liter) comprised 160 mg of N and 100 mg of Ca added as KNO3 and Ca (NO3)2∙4H2O, 55 mg of P as KH2PO4, 220 mg of K and 65 mg of S as K2SO4, 50 mg of Mg as MgSO4∙7H2O, 10.4 mg of Fe as Fe-EDTA, 10 mg of Zn as ZnSO4 7H2O, and 10 mg of Cu as CuSO4∙5H2O based on dry substrates. Water was supplied based on the loss of weight according to the growth requirements of the plants. Due to mycorrhizal colonization resulting in the advantage of P nutrition, P fertilization in AMF plants was not a limiting factor.
Table 5.
Treatments of root compartments and hyphal compartments.
| Treatments | Root Compartment (RC) | Hyphal Compartment (HC) | |||||
|---|---|---|---|---|---|---|---|
| N | NH4+-N | NO3−-N | 15NH4+ | 15NO3− | |||
| (mg L−1) | (mg L−1) | (mg HC−1) | |||||
| HN | AMF | NH4+ | 160 | 94 | - | 10 | - |
| NO3− | 160 | - | 94 | - | 10 | ||
| NO-AMF | NH4+ | 160 | 94 | - | 10 | - | |
| NO3− | 160 | - | 94 | - | 10 | ||
| LN | AMF | NH4+ | 94 | 94 | - | 10 | - |
| NO3− | 94 | - | 94 | - | 10 | ||
| NO-AMF | NH4+ | 94 | 94 | - | 10 | - | |
| NO3− | 94 | - | 94 | - | 10 | ||
Note: HN means high-nitrogen treatment (160 mg L−1) in the root compartment, and LN means low-nitrogen treatment (94 mg L−1) in the root compartment.
In each pot, 50 g of the AM inoculum Funneliformis mosseae was added as sand containing 10 spores per gram to the AM treatments, while for the non-AM treatments, the same amounts of sterilized inoculum and washed microorganisms and nutrition were added to each control part. Sterilization of non-AM inoculums involved heating the inoculums to 121 °C for 20 min. The inoculums were filtered through 5–8 μm filter paper with distilled water to collect possible microorganisms, and the microorganism wash was added in no-AMF treatments [16]. The non-mycorrhizal plants had N in addition to HCs, but due to the air gap, there was no nutritional connection between the root compartments and HCs. Fifty grams of AM fungal inoculum was mixed into the respective potted matrix, containing 9 spores per gram of inoculum. Control plants (non-AM) received the same amount of autoclaved (121 °C, 20 min) inoculum.
There were eight treatments, and each treatment had four replicates (n = 4), with a total of 64 pots. The potted tomato plants were randomly placed on the seedbed. The position of the basin was rotated once a day to eliminate the influence of the placement position on the growth and weight, and the plants were watered every day. The temperature in the greenhouse was controlled at 23 ± 2/15 ± 2 °C day/night, and the light density was increased using lamps. Plants were harvested after an experimental period of 7 weeks.
The roots were extracted and washed, and the fresh weight was measured. Subsamples of fresh root material were taken to analyze AMF root colonization. Both shoots and subsamples of roots were dried at 65 °C, and the biomass was measured.
Shoot N and P concentrations were measured using a DC plasma Echelle Spectrometer (Beckman Instruments) and the Kjeldahl digestion method. The root colonization rate was determined according to a modified method of Phillips and Hayman (1970) [34]. 15N abundance was measured by an isoprene precisION isotope ratio mass spectrometer (IRMS). The average 15N abundance of standard sample acetanilide (n = 3) measured by the instrument was subtracted from the original data to obtain the 15N abundance of tomato shoots.
3.2. Hyphal Length in HCs
Referring to the vacuum pump microporous suction filtration method [35], 10 g of matrix sample was weighed in the mycelial chamber, 250 mL of deionized water was added and stirred in the agitator for 2 min, and then the sample was mixed evenly for more than 40 min with a 30 μM mesh screen so that the screen surface was slightly inclined. The suspension was passed through the stacked sieve, and the sample was gently rinsed with deionized water. The sieved product remaining on the screen surface was washed with 250 mL of deionized water, stirred quickly for 1 min, and then left to stand for 1 min. A vacuum pump was used for vacuum suction filtration. A 5 mL volume of 0.05% trypan blue solution was added to the filter membrane and soaked for 5 min; the vacuum pump was turned on to drain the dye, and the filter membrane was clamped with tweezers and placed on a slide. The stained filter membrane was placed under a 200X microscope for observation, 10 visual fields were counted, and the number of cross points between extramycelial hyphae and the grid was recorded; the length of the extraradical mycelium was determined [36].
3.3. Root Sampling and Relative Expression of Transporters
Tomato root samples for RNA extraction were taken randomly from each subplot a few days before harvesting the whole plants and were stored at −80 °C. Total RNA was isolated from these root tissues using a “Quick RNA Isolation Kit” (Huayueyang Biotechnology Co., Ltd., Beijing, China), after which their cDNA was synthesized using “FastKing cDNA Dispelling RT SuperMix” (Tiangen Biotech Co., Ltd., Beijing, China). The resulting RT reaction product was used as a template for real-time quantitative polymerase chain reaction (RT-qPCR) analysis. RT-qPCR was run on a QuantStudioTM 6 Flex System, for which the primers were designed in Primer Premier 6 software, and all amplicons were between 80 and 200 nucleotides in size. The specific primer sequences were as follows:
5′-CCGCCGCTTCATACATCTGCAA (forward),
5′-GCGAAACCAAGCTGCATGGAGA (reverse) for LeAMT1.1;
5′-TTCCCTCATCTCGGCAGCTCAG (forward),
5′-CCGCGTAGGTGGTGTTTGTGAG (reverse) for LeAMT1.2;
5′-GGGCTACTACACTTCCTCTGG (forward),
5′- CCTCCAGCTCCTGTCATACC (reverse) for LeNRT2.3;
5′-TCGTAAGGAGTGCCCTAATGCTGA (forward),
5′- CAATCGCCTCCAGCCTTGTTGTAA (reverse) for LeUBI [37].
The obtained product RNA extractions were used as a template for RT qPCR analysis. Real-time fluorescence quantitative PCR was performed on a Quantstudiotm 6 Flex System with “TB green”® Premix Ex Taq™. RT qPCR analysis was carried out with kit II (Baoriyi Biotechnology Beijing Co., Ltd. Beijing, China), and the reaction system was 10 µL, including 5 µL of Taq™, 2.0 µL of dye II, 0.2 µL of positive and negative specific primers, 3 µL of cDNA template, and 1.4 µL of ddH2O. The RT qPCR procedure involved a reaction at 95 ℃ for 30 s. The comparative threshold cycle method of ΔΔCt was adopted to quantify and analyze the relative RNA expression levels. The Ct values of the target genes imported by the system were normalized to the Ct values of ubiquitin by applying the following equation: ΔCt = Ct target − Ct housekeeping. The fold change was calculated from the equation 2−ΔΔCt, where ΔΔCt = ΔCt sample – ΔCt Control [38].
3.4. Statistical Analysis
The data were recorded in MS Excel sheets and analyzed using IBM SPSS 20.0 software to determine mean values and standard errors. The statistical results derived from the experiment were expressed as means ± SE. Differences among the means were analyzed via a one-way ANOVA followed by Fisher’s least significant difference (LSD) for the multiple comparison test (p ≤ 0.05) to determine whether significant differences existed between plants inoculated with AMF strains and the uninoculated control. Univariate analysis of variance was also performed to analyze the main effects observed for the AMF strains and the control sample. We did not compare the statistical differences in data between two growing seasons, owing to the use of completely different cultivars; one produced large fruit, and the other produced small fruit. Regression analysis used ANOVA, as regression was virtually identical to the underlying models. The test statistic F was used to test for the significance of the regression model. Multiple coefficients of determination R2 were used to test the overall effectiveness of the entire set of independent variables. In explaining the dependent variable, its interpretation was similar to that for simple linear regression: the percentage of variation in the dependent variable that was collectively explained by all of the independent variables.
4. Discussion
4.1. Nitrogen Transport and Acquisition via AMF with N Levels and Forms in HCs
Nitrogen acquisition in plant tissues was significantly correlated with N fertilizer application levels and AMF inoculation under conditions of low N application (Table 2). The concentrations of 15N binding were from 0.074‰ to 0.138‰ in the shoot tissues of all mycorrhizal plants; with high N application, 15N binding (0.078‰) was lower than that with low N application (0.118‰) (Table 1). However, the total 15N transported via the extramycelium to shoot parts showed no significant difference between N levels, even with 20.4 µg per plant with high levels of N, compared with 16.3 µg at low levels of N (Table 1). Under high N application, there were no differences in either the N concentration or N content between mycorrhizal and non-inoculated plants (Table 2). In contrast, with low N application, the N concentration was increased by mycorrhization by 17.7% (from 1.24% to 1.46%), almost to the same level as plants with high N application. The N uptake by plants was 22.5%, increasing from 114.4 mg to 140.1 mg per plant, owing to the double effects of biomass and concentration.
Although 15N binding was not significantly different between NH4+ and NO3− applications in HCs, the actual 15N transfer was 14.2 µg per plant with NO3− application and 18.4 µg with NH4+ with low N application (Table 3). This difference implies that more 15NH4+ was transported from HCs to host plants via the hyphae compared with NO3− (Table 1). This difference had no further effects on biomass accumulation in tomato plants; however, the biomass was increased when NO3− was added to HCs (Table 3). These results suggest that almost the same amount of N transfer via MP, in the case of NO3−, had a greater influence on biomass accumulation as compared to that of NH4+ supplied to the extramycelium. With NO3− in HCs, P uptake was significantly increased by 11.3% as the result of higher biomass at the low-N fertilization level (Table 3). It is reported that AMF contributes substantially to the N nutrition of their host plants [6]. Hyphae can directly and effectively utilize inorganic compounds and transfer a large amount of N to the roots of host plants [19,39]. The direct labeling of 15N has shown the flux of N through AM fungal hyphae to plants (Andropogon gerardii) [40].
In the present study, no differences in N uptake were shown with the two levels of N application in the HCs; however, 15N binding was higher with low N application than with high N application. This demonstrated that N transfer from the fungus to the host plant was similar at high and low levels of N application; however, with a lower N application, the HP becomes more important than with higher N rates. These results indicate that mycorrhization plays a substantial role in the absorption of plants regardless of N availability (Table 2 and Table 3). Under lower N availability, the mycorrhizal pathway becomes more important compared with the root pathway. A similar result has been reported, showing that high amounts of N application can significantly decrease N uptake by mycorrhizal plants from the soil [15]. When nutrients were insufficient, the advantages of mycorrhizal symbionts were reflected because the nutrients absorbed by plant roots were insufficient to support normal growth, while sufficient nutrients often inhibited the infection of fungi in the root system of host plants [5]. In summary, it may be concluded that a substantial amount of N can be adsorbed and transported from fungi to their host plants, and only the N uptake by hyphae, i.e., the hyphae pathway related to the root pathway, is influenced by the interaction of the N nutritional status in the environment of both the roots and fungi. This agrees with the previous hypothesis that the hyphae of AMF may absorb NH4+ preferentially over NO3−, but that the export of N from the hyphae to the roots and shoots may depend on the amount of N supplied/available for uptake [41]. However, in the present study, increased growth was not accompanied by greater concentrations of N and P in the shoots of plants. Taking biomass into account, the total content of P in shoots was increased.
4.2. Transporter Genes LeAMT1.1, LeAMT1.2, and LeNRT2.3 Were Regulated by Inoculation with AMF in the Root Tissue of Tomato Plants
As previously reported, the expression of the encoded LeNRT2.3 protein is related to AMF colonization [30]. In our study, the expression of LeNRT2.3 in roots was significantly increased following inoculation with AMF compared with the control plants at low N levels (Table 4). Although it is a low-affinity transporter, a difference in expression was not detected between the two N levels (Table 4). LeNRT2.3 expression was not correlated with the N form with high N application but had a significantly higher expression level with NH4+ compared with that of NO3− with N deficiency (Table 4). As N is a major limiting factor for plant growth and yield, genes affect plant growth through nitrate uptake or remobilization. The higher expression levels of LeNRT2.3 in flowers and leaves indicate that LeNRT2.3 plays a pivotal role in shoot development [31]. LeNRT2.3 is also suggested to play a key role in the xylem transport of N from roots to shoots and in N uptake by roots [31]. Taken together, the expression of LeNRT2.3 driven by symbiosis could be important for N-use efficiency in tomatoes, and its induced expression indicates a higher N-use efficiency in tomatoes [42].
The expression of only LeNRT2.3 among the transporters assayed was higher in AMF-colonized tomato roots than in non-colonized controls. AMF colonization caused the significant expression of a nitrate reductase gene of G. intraradices. The results may mean that AMF colonization positively affected nitrate uptake from the soil and nitrate allocation to the plant partner, probably preferentially mediated by LeNRT2.3. In addition, part of the nitrate taken up is reduced by the fungal partner itself and, if in excess, may then be transferred as glutamine to the symbiotic plant partner [30]. The expression of LeNRT2.3 is negatively controlled by ammonium but, remarkably, not by glutamine [30].
The specific expression of these up-regulated AMT genes in arbuscule-colonized cortical root cells has been shown in M. truncatula [29], L. japonicus [28], G. max [24], and S. bicolor [43]. In the present study, regarding the two important high-affinity NH4+ transporters in roots, LeAMT1.1 was up-regulated by inoculation with AMF, especially with NO3− feed in HCs with high N application, while there were no significant differences in LeAMT1.2 between treatments (Table 4). Other research work has reported strong inductions of LeAMT1.1 and LeAMT1.2 gene expression in mycorrhizal roots, evidence that host plants had NH4+ transporters that were up-regulated under AMF colonization, with the specific expression of the up-regulated AMTs genes in arbuscule-colonized cortical root cells shown in M. truncatula [29], L. japonicus [28], G. max [24], and S. bicolor [43]. In particular, AMF symbiosis down-regulated OsAMT1.1 expression under low-N conditions (1.825 mM NO3−) but not under high-N (7.5 mM NO3−) conditions [44]. In the present study, LeAMT1.1 was significantly increased by inoculation with AMF and high N application and particularly up-regulated by the addition of NO3− in HCs (Table 4).
LeAMT1.1 and LeAMT1.2 are differentially regulated by N and contribute to root-hair-mediated NH4+ acquisition from the rhizosphere; the transcript levels of LeAMT1.2 increased after NH4+ or NO3± application, while LeAMT1.1 was induced by N deficiency [45]. LeAMT1.2, an important high-affinity NH4+ transporter, was reported to have contrasting responses to LeAMT1.1 and was induced by N application [45]. By contrast, in the present study, the expression of LeAMT1.2 was affected by neither mycorrhization nor the N level or form (Table 4). LeAMT1.2 mRNA levels are controlled in a concentration-dependent manner by the NH4+ concentration or the plant N status, and peak expression occurs at 2–5 µM NH4+, with a further increase in NH4+ causing a reduction [26]. In our previous study, the expression of LeAMT1.2 was significantly induced by AMF inoculation in an isolation-specific manner [46].
As N is a major factor determining plant growth and yield, it likely influences plant growth by modulating N uptake rates or remobilization activity [31]. The induction of N transporters varied with the level of N application and the N form in HCs; however, their increasing expression indicated a higher N-use efficiency in tomatoes. This plays a key role in the xylem transport of nitrate from roots to shoots and uptake in roots [31]. In AMF symbiosis, several studies indicate that plants absorb a large amount of N through the mycorrhizal pathway [12,19]. In the present study, AMF hyphae absorbed and transported both nitrate and ammonium N to the shoots of tomato plants with both high and low levels of N application, while under low N levels, the transported N became more important with a higher N application rate, although almost the same amount of N was transported via extraradical mycelia. Inoculation with AMF significantly increased the expression of LeNRT2.3 and LeAMT1.1, which was also related to the N level and form in hyphal compartments. In conclusion, substantial amounts of both NO3−-N and NH4+-N can be transferred via extramycelia to their tomato hosts with the colonization of AMF. Under a low N supply in root environments, the partially transferred N in the plant’s total N uptake is more important than under high N supply. The expression of LeAMT1.1 and LeNRT2.3 were differentially influenced due to N supply levels.
Acknowledgments
We are grateful for the financial support provided under the Project of Rural Development of Beijing (project number: BJXCZX20221229) and the Beijing Innovation Consortium of Agriculture Research System (project number: BAIC01-2022). We also appreciate the reviewers’ recommendations and inputs.
Author Contributions
X.X., field research work, data collection, and writing; Z.H., molecular analysis; W.L., H.Z., G.H. and R.L., identification of isolates; X.L., soilless tomato production technique; Z.L., supervision of the research work and writing. All authors have read and agreed to the published version of the manuscript.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
Funding Statement
Beijing Innovation Consortium of Agriculture Research System (project number: BAIC01-2022).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Smith S.E., Smith F.A. Roles of arbuscular mycorrhizas in plant nutrition and growth: New paradigms from cellular to ecosystem scales. Annu. Rev. Plant Biol. 2011;62:227–250. doi: 10.1146/annurev-arplant-042110-103846. [DOI] [PubMed] [Google Scholar]
- 2.Balestrini R., Lumini E. Focus on mycorrhizal symbioses. Appl. Soil Ecol. 2017;123:299–304. doi: 10.1016/j.apsoil.2017.09.001. [DOI] [Google Scholar]
- 3.Smith S.E., Smith F.A., Jakobsen I. Mycorrhizal fungi can dominate phosphate supply to plants irrespective of growth responses. Plant. Physiol. 2003;133:16–20. doi: 10.1104/pp.103.024380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ryan M.H., Tibbett M., Edmonds-Tibbett T., Suriyagoda L.D.B., Lambers H. Carbon trading for phosphorus gain: The balance between rhizosphere carboxylates and arbuscular mycorrhizal symbiosis in plant phosphorus acquisition. Plant Cell Environ. 2012;35:2170–2180. doi: 10.1111/j.1365-3040.2012.02547.x. [DOI] [PubMed] [Google Scholar]
- 5.Nouri E., Breuillin-Sessoms F., Feller U., Reinhardt D. Phosphorus and nitrogen regulate arbuscular mycorrhizal symbiosis in petunia hybrida. Public Libr. Sci. 2014;9:e90841. doi: 10.1371/journal.pone.0090841. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Mensah J.A., Koch A.M., Antunes P.M., Kiers E.T., Hart M., Bücking H. High functional diversity within species of arbuscular mycorrhizal fungi is associated with differences in phosphate and nitrogen uptake and fungal phosphate metabolism. Mycorrhiza. 2015;25:533–546. doi: 10.1007/s00572-015-0631-x. [DOI] [PubMed] [Google Scholar]
- 7.Treseder K.K. A meta-analysis of mycorrhizal responses to nitrogen, phosphorus, and atmospheric CO2 in field studies. New Phytol. 2004;164:347–355. doi: 10.1111/j.1469-8137.2004.01159.x. [DOI] [PubMed] [Google Scholar]
- 8.Hodge A., Storer K. Arbuscular mycorrhiza and nitrogen: Implications for individual plants through to ecosystems. Springer Int. Publ. 2015;386:1–19. doi: 10.1007/s11104-014-2162-1. [DOI] [Google Scholar]
- 9.Leigh J., Hodge A., Fitter A.H. Arbuscular mycorrhizal fungi can transfer substantial amounts of nitrogen to their host plant from organic material. New Phytol. 2009;181:199–207. doi: 10.1111/j.1469-8137.2008.02630.x. [DOI] [PubMed] [Google Scholar]
- 10.Hodge A. Plant nitrogen capture from organic matter as affected by spatial dispersion, interspecific competition and mycorrhizal colonisation. New Phytol. 2003;157:303–314. doi: 10.1046/j.1469-8137.2003.00662.x. [DOI] [PubMed] [Google Scholar]
- 11.Hawkins H.J., George E. Effect of plant nitrogen status on the contribution of arbuscular mycorrhizal hyphae to plant nitrogen uptake. Physiol. Plant. 1999;105:694–700. doi: 10.1034/j.1399-3054.1999.105414.x. [DOI] [Google Scholar]
- 12.Bücking H., Kafle A. Role of arbuscular mycorrhizal fungi in the nitrogen uptake of plants: Current knowledge and research gaps. Agronomy. 2015;5:587–612. doi: 10.3390/agronomy5040587. [DOI] [Google Scholar]
- 13.Johansen A., Jakobsen I., Jensen E.S. Hyphal transport by a vesicular-arbuscular mycorrhizal fungus of N applied to the soil as ammonium or nitrate. Biol. Fertil. Soils. 1993;16:66–70. doi: 10.1007/BF00336518. [DOI] [Google Scholar]
- 14.Govindarajulu M., Pfeffer P.E., Jin H., Abubaker J., Douds D.D., Allen J.W., Bücking H., Lammers P.J., Shachar-Hill Y. Nitrogen transfer in the arbuscular mycorrhizal symbiosis. Nature. 2005;435:819–823. doi: 10.1038/nature03610. [DOI] [PubMed] [Google Scholar]
- 15.Miransari M. Arbuscular mycorrhizal fungi and nitrogen uptake. Arch. Microbiol. 2011;193:77–81. doi: 10.1007/s00203-010-0657-6. [DOI] [PubMed] [Google Scholar]
- 16.Ngwene B., Gabriel E., George E. Influence of different mineral nitrogen sources (NO3--N vs. NH4+-N) on arbuscular mycorrhiza development and N transfer in a Glomus intraradices–-cowpea symbiosis. Mycorrhiza. 2013;23:107–117. doi: 10.1007/s00572-012-0453-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Johansen A., Finlay R.D., Olsson P.A. Nitrogen metabolism of external hyphae of the arbuscular mycorrhizal fungus Glomus intraradices. New Phytol. 1996;133:705–712. doi: 10.1111/j.1469-8137.1996.tb01939.x. [DOI] [Google Scholar]
- 18.Jin H., Pfeffer P.E., Douds D.D., Piotrowski E., Lammers P.J., Shachar-Hill Y. The uptake, metabolism, transport and transfer of nitrogen in an arbuscular mycorrhizal symbiosis. New Phytol. 2005;168:687–696. doi: 10.1111/j.1469-8137.2005.01536.x. [DOI] [PubMed] [Google Scholar]
- 19.Tanaka Y., Yano K. Nitrogen delivery to maize via mycorrhizal hyphae depends on the form of N supplied. Plant Cell Environ. 2005;28:1247–1254. doi: 10.1111/j.1365-3040.2005.01360.x. [DOI] [Google Scholar]
- 20.Valentine A.J., Kleinert A. Respiratory costs of P uptake in arbuscular mycorrhizal roots supplied with NH4+and NO3- nutrition. Symbiosis. 2006;41:119–125. [Google Scholar]
- 21.Ngwene B., George E., Claussen W., Neumann E. Phosphorus uptake by cowpea plants from sparingly available or soluble sources as affected by nitrogen form and arbuscular-mycorrhiza-fungal inoculation. J. Plant Nutr. Soil Sci. 2010;173:353–359. doi: 10.1002/jpln.200900203. [DOI] [Google Scholar]
- 22.Baum C., El-Tohamy W., Gruda N. Increasing the productivity and product quality of vegetable crops using arbuscular mycorrhizal fungi: A review. Sci. Hortic. 2015;187:131–141. doi: 10.1016/j.scienta.2015.03.002. [DOI] [Google Scholar]
- 23.Burleigh S.H. Relative quantitative RT-PCR to study the expression of plant nutrient transporters in arbuscular mycorrhizas. Plant Sci. 2001;160:899–904. doi: 10.1016/S0168-9452(00)00460-X. [DOI] [PubMed] [Google Scholar]
- 24.Kobae Y., Tamura Y., Takai S., Banba M., Hata S. Localized expression of arbuscular mycorrhiza-inducible ammonium transporters in soybean. Plant Cell Physiol. 2010;51:1411–1415. doi: 10.1093/pcp/pcq099. [DOI] [PubMed] [Google Scholar]
- 25.Ono F., Frommer W.B., von Wirén N. Coordinated Diurnal Regulation of Low- and High-Affinity Nitrate Transporters in Tomato. Plant Biology. 2000;2:17–23. doi: 10.1055/s-2000-297. [DOI] [Google Scholar]
- 26.Becker D., Stanke R., Fendrik I., Frommer W.B., Hedrich R. Expression of the NH4+-transporter gene LeAMT1;2 is induced in tomato roots upon association with N2-fixing bacteria. Planta. 2002;215:424–429. doi: 10.1007/s00425-002-0773-x. [DOI] [PubMed] [Google Scholar]
- 27.Koegel S., Lahmidi N.A., Arnould C., Chatagnier O., Walder F., Ineichen K., Boller T., Wipf D., Wiemken A., Courty P.E. The family of ammonium transporters (AMT) in Sorghum bicolor: Two AMT members are induced locally, but not systemically in roots colonized by arbuscular mycorrhizal fungi. New Phytol. 2013;198:853–865. doi: 10.1111/nph.12199. [DOI] [PubMed] [Google Scholar]
- 28.Guether M., Neuhauser B., Balestrini R., Dynowski M., Ludewig U., Bonfante P. A mycorrhizal-specific ammonium transporter from Lotus japonicus acquires nitrogen released by arbuscular mycorrhizal fungi. Plant Physiol. 2009;150:73–83. doi: 10.1104/pp.109.136390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gomez S.K., Javot H., Deewatthanawong P., Torres-Jerez I., Tang Y., Blancaflor E.B., Udvardi M.K., Harrison M.J. Medicago truncatula and Glomus intraradices gene expression in cortical cells harboring arbuscules in the arbuscular mycorrhizal symbiosis. BMC Plant Biol. 2009;9:10. doi: 10.1186/1471-2229-9-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Hildebrandt U., Schmelzer E., Bothe H. Expression of nitrate transporter genes in tomato colonized by an arbuscular mycorrhizal fungus. Physiologia Plantarum. 2002;115:125–136. doi: 10.1034/j.1399-3054.2002.1150115.x. [DOI] [PubMed] [Google Scholar]
- 31.Fu Y.L., Yi H.Y., Bao J., Gong J.M. LeNRT2.3 functions in nitrate acquisition and long-distance transport in tomato. FEBS Lett. 2015;589:1072–1079. doi: 10.1016/j.febslet.2015.03.016. [DOI] [PubMed] [Google Scholar]
- 32.Neumann E., George E. Extraction of extraradical arbuscular mycorrhizal mycelium from compartments filled with soil and glass beads. Mycorrhiza. 2005;15:533–537. doi: 10.1007/s00572-005-0361-6. [DOI] [PubMed] [Google Scholar]
- 33.Hoagland D.R., Arnon D.I. The Water-Culture Method for Growing Plants without Soil. Calif. Agric. Exp. Stn. Circular. 1950;347:1–32. [Google Scholar]
- 34.Phillips J.M. Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Br. Mycol. Soc. 1970;55:158-IN18. doi: 10.1016/S0007-1536(70)80110-3. [DOI] [Google Scholar]
- 35.Jakobsen I., Abbott LKRobson A.D. External hyphae of vesicular-arbuscular mycorrhizal fungi associated with Trifolium subterraneum L. New Phytol. 1992;120:371–380. doi: 10.1111/j.1469-8137.1992.tb01077.x. [DOI] [Google Scholar]
- 36.Miller R.M., Jastrow J.D., Reinhardt D.R. External hyphal production of vesicular-arbuscular mycorrhizal fungi in pasture and tallgrass prairie communities. Oecologia. 1995;103:17–23. doi: 10.1007/BF00328420. [DOI] [PubMed] [Google Scholar]
- 37.Mascia T., Santovito E., Gallitelli D., Cillo F. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 2010;11:805–816. doi: 10.1111/j.1364-3703.2010.00646.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Livak K.J., Schmittgen T. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCt method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 39.Jackson L.E., Burger M., Cavagnaro T.R. Roots, nitrogen transformations, and ecosystem services. Annu. Rev. Plant. Biol. 2008;59:341–363. doi: 10.1146/annurev.arplant.59.032607.092932. [DOI] [PubMed] [Google Scholar]
- 40.Paymaneh Z., Gryndler M., Konvalinková T., Benada O., Borovička J., Bukovská P., Püschel D., Řezáčová V., Sarcheshmehpour M., Jansa J. Soil Matrix Determines the Outcome of Interaction Between Mycorrhizal Symbiosis and Biochar for Andropogon gerardii Growth and Nutrition. Front. Microbiol. 2018;27:2862. doi: 10.3389/fmicb.2018.02862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Ngwene B., Mertens J., Splettster T., Gabriel E., George E. Influence of mineral nitrogen sources (NO3 − -N vs. NH 4 + -N) on arbuscular mycorrhiza development and N transfer in a Rhizophagus irregularis symbiosis; Proceedings of the Eighth International Conference on Mycorrhizas (ICOM8); Flagstaff, AZ, USA. 3–7 August 2015. [Google Scholar]
- 42.Fan X.R., Tang Z., Tan Y.W., Zhang Y., Luo B.B., Yang M., Lian X.M., Shen Q.R., Miller A.J., Xu G.H. Overexpression of a pH-sensitive nitrate transporter in rice increases crop yields. Proc. Natl. Acad. Sci. USA. 2016;113:7118–7123. doi: 10.1073/pnas.1525184113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Koegel S., Boller T., Lehmann M.F., Wiemken A., Courty P.E. Rapid nitrogen transfer in the Sorghum bicolor-Glomus mosseae arbuscular mycorrhizal symbiosis. Plant Signal. Behav. 2013;8:e25229. doi: 10.4161/psb.25229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Pérez-Tienda J., Corrêa A., Azcón-Aguilar C., Ferrol N. Transcriptional regulation of host NH4+ transporters and GS/GOGAT pathway in arbuscular mycorrhizal rice roots. Plant Physiol. Biochem. 2014;75:1–8. doi: 10.1016/j.plaphy.2013.11.029. [DOI] [PubMed] [Google Scholar]
- 45.Lima J.E., Kojima S., Takahashi H., Von Wiren N. Ammonium triggers lateral root branching in arabidopsis in an ammonium transporter1;3-dependent manner. Plant Cell. 2010;22(11):3621–3633. doi: 10.1105/tpc.110.076216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Feng J., Lv W.X., Xu J., Huang Z., Rui W.J., Lei X.H., Ju X.H., Li Z.F. Overlapping Root Architecture and Gene Expression of Nitrogen Transporters for Nitrogen Acquisition of Tomato Plants Colonized with Isolates of Funneliformis mosseae in Hydroponic Production. Plants. 2022;11:1176. doi: 10.3390/plants11091176. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Not applicable.
