A First Clinical and Molecular Study of Rare IVS-II-806 (G > C) (HBB:c.316-45G > C) Variant in the β-globin Gene: A Possibly Benign Variant

Abstract

Introduction

β-thalassemia is a common genetic disease affecting a single gene, disease with a high incidence in South China. We hereby, aim to provide the clinical and hematological features of a rare β-globin gene variant in the Chinese population.

Methods

Ten subjects from three unrelated Chinese families were enrolled in this study. Hematological analysis and thalassemia gene testing were preformed to screen for common α and β-thalassemia variants. Gap-polymerase chain reaction (Gap-PCR) and DNA sequencing were utilized to examine the rare or novel thalassemia variants.

Results

Six cases were identified carrying the rare IVS-II-806 (G > C) (HBB:c.316-45G > C) variant in the β-globin gene. The proband in family 1 carry three rare β-globin gene mutations including CD39 (C > T), IVS-II-81 (C > T) and IVS-II-806 (G > C) combined with a --^SEA/αα deletion, exhibiting the β-thalassemia trait. Further pedigree investigation indicated that the genotype of the proband in family 1 was --^SEA/αα, β^{CD39 (C>T), IVS−II−81(C>T)}/β^{IVS−II−806(G>C)}. Meanwhile, the twin girls in family 1 carrying the IVS-II-806 (G > C) mutation demonstrated a normal hematological phenotype. In family 2, the proband and his sister carry the IVS-II-806 (G > C) mutation, eliciting high levels of Hb A2 and slightly low levels of MCV and MCH. Moreover, the proband in family 3 carrying the same mutation exhibited a slightly low MCV level as well.

Conclusions

In this study, clinical and hematological analysis of the IVS-II-806 (G > C) mutation was first conducted within the Chinese population, with results indicating that it may be a benign variant.

Background

Thalassemia is a common inherited disorder, characterized by episodes of hemolytic anemia resulting from an inherited impairment in globin chains synthesis [1]. Thomas Cooley and Pear Lee first described this severe anemia that occurring in children in Italy 90 years ago [2]. Generally, α-thalassaemia is mainly caused by deletion of the α-globin gene, while β-thalassemia is mainly caused by point mutations in the β-globin gene. Thalassemia is highly prevalent in tropical and subtropical regions, such as the sub-Saharan Africa, the Mediterranean region and Middle East, the Indian subcontinent, as well as East and Southeast Asia [3–6]. In China, the Southern region of Yangtze River, such as Guangdong, Guangxi, Hainan, Guizhou, and Fujian province have the highest incidence of thalassemia [7–12]. Moreover, a recent study has shown an increasing trend in the prevalence of thalassemia in Fujian province [13].

To date, more than 300 β-globin gene mutations have been described [14]. Previous studies have delineated the great complexity and diversity of thalassemia mutations in the Fujian province of Southeast China using DNA sequencing technologies [13,15−16], which further highlighted the value of DNA sequencing in the investigation of rare or novel thalassemia mutations.

Our study presented three unrelated families carrying the rare variant of the IVS-II-806(G > C) mutation in the β-globin gene, aiming to reveal the clinical and hematological features of the rare variant. Moreover, a patient who harbor three rare β-globin gene mutations [CD39 (C > T), IVS-II-81 (C > T) and IVS-II-806 (G > C)], and co-inherited with a --^SEA/αα deletion was first reported in the Chinese population.

Materials and methods

Subjects

Ten subjects from three unrelated families in the Fujian Province of Southeast China were enrolled in this study. All the subjects underwent hematology screening and thalassemia gene testing. DNA sequencing was further performed to identify rare or novel thalassemia mutations. All the subjects in this study denied a history of blood transfusion. This study was reviewed and approved by the Ethics Committee of Quanzhou Women’s and Children’s Hospital (2020No.8).

Hematological analysis

In this study, 4 ml of peripheral blood was collected from the subjects into an EDTA anticoagulated tube. Firstly, 2 ml peripheral blood was used for routine hematology examinations by automated cell counter (Sysmex XS-1000i; Sysmex Co., Ltd., Kobe, Japan). Subsequently, 2 ml peripheral blood was used for hemoglobin analysis by hemoglobin capillary electrophoresis (Sebia, Evry Cedex, France). A mean corpuscular volume (MCV) of < 82 fL, and/or a mean corpuscular hemoglobin (MCH) concentration of < 27 pg, and/or hemoglobin (Hb) A2 > 3.4% or Hb A2 < 2.6% or Hb F > 2.0% were defined as a positive case of thalassemia screening.

Conventional thalassemia gene testing

Next, 2 ml peripheral blood was collected from the enrolled subjects for conventional thalassemia gene testing. The subjects’ genomic DNA were obtained using an automatic nucleic acid extractor (Ruibao Biological Co., Ltd). The PCR reverse dot hybridization technique (PCR-RDB) was used to detect the common thalassemia mutations in the Chinese population [17], including the deletional (-α^3.7, -α^4.2, --^SEA) and non-deletional α-thalassemia mutations (αα^CS, αα^QS and αα^Westmead), and 17 common β-thalassemia mutations: [CD41-42(-TCTT), IVS-II-654(C > T), − 28(A > G), CD71/72(+ A), CD17(AAG > TAG), CD26(GAG > AAG), CD43(GAG > TAG), − 29(A > G), CD31(-C), − 32(C > A), IVS-I-1(G > T), CD27/28(+ C), − 30(T > C), CD14-15(+ G), Cap + 40–43(–AAAC), initiation codon(ATG > AGG) and IVS-I-5(G > C)] (Yaneng Biological technology Co., Ltd., Shenzhen).

Rare or novel thalassemia mutation analysis

Rare α-thalassemia genotype-screening kits (--^THAI, -α^27.6, -α^21.9) and the rare β-thalassemia genotype-screening kits (Taiwanese, ^Gγ⁺(^Aγδβ)⁰, SEA-HPFH) were used to identify the rare deletional α and β-thalassemia variants. DNA sequencing was conducted for the cases suspected to carry a rare or novel thalassemia mutation. Specific primers were designed to detection rare or novel globin gene mutations. The primer sequences were illustrated in Table 1. The DNA sequencing protocol was performed according to the previous study [16]. The results were compared with the standard sequence (NG_000007) in GenBank and the detected mutations were further confirmed by Sanger sequencing.

Table 1.

The specific primers designed for α, β and δ-globin gene DNA sequencing

Genes	Names	Primers sequence (5’-3’)
α1	HBA1-F	CCCGTGCTTTTTGCGTCCTGGTGTT
	HBA1-R	CCTCCCGCCCCTGCCTTTTCCTACC
α2	HBA2-F	AGTGGCGGGTGGAGGGTGGAGACGT
	HBA2-R	TCCCATACTCCCTGCAGTTCTCCCT
β	HBB-F	CCAAGGACAGGTACGGCTGTCATC
	HBB-R	GCATATGCATCAGGGGCTGTTG
δ	HBD-F	AGATATGTAGAGGAGAACAGGGTT
	HBD-R	GCTCTTTGGAGGTAGAAGTGTC

Results

As delineated in Table 2, the proband in family 1 displayed low MCV, and MCH levels, but high levels of HbA2, which was suspected to be a β-thalassemia carrier. However, the proband’s husband and her twin girls exhibited normal hematological phenotype (Table 2). The hematological results of family 2 were illustrated in Table 3. The proband in family 2 was indicated to be a β-thalassemia carrier with increased Hb A2 levels. The proband’s wife in family 2 exhibited decreased levels of Hb A2 and was suspected to be an α-thalassemia carrier. Moreover, in family 2, the proband’s brother and sister also exhibited increased Hb A2 levels, while, the proband’s son presented a normal hematological phenotype. In family 3, the proband elicited a slightly low MCV level (78.3 fl.), and normal MCH (27.5pg) and Hb A2 (2.6%) levels.

Table 2.

The hematological screening and molecular analysis of thalassemia in family 1

Parameters	Proband	Husband	Daughter1	Daughter2
Sex-age	F-35	M-37	F-12	F-12
RBC(1012/L)	4.62	5.35	4.53	4.61
Hb(g/L)	112	160	138	135
MCV(fl.)	77.7	87.7	92.1	87.9
MCH(pg)	24.6	29.9	30.5	29.3
Hb A(%)	94.9	97.1	97.1	97.1
Hb A2(%)	5.1	2.9	2.9	2.9
Hb F(%)	0	0	0	0
α Genotype	--SEA/αα	αα/αα	αα/αα	αα/αα
β Genotype	βCD39, IVS−II−81/βIVS−II−806	βN/βN	βIVS−II−806/βN	βIVS−II−806/βN

Table 3.

The hematological screening and molecular analysis results in family 2

Parameters	Proband	Wife	Son	Brother	Sister
Sex-age	M-30	F-29	M-6	M-32	F-34
RBC(1012/L)	5.43	3.72	4.47	4.68	4.49
Hb(g/L)	139	93	127	125	120
MCV(fl.)	75.7	80.0	82.1	79.7	80.2
MCH(pg)	25.6	25.0	28.3	26.8	26.8
Hb A(%)	93.9	95.9	96.2	94.4	94.4
Hb A2(%)	6.1	2.5	2.8	5.6	5.6
Hb F(%)	0	1.6	1.0	0	0
Serum iron (µmol/L)	5.2	-	25.5	9.1	15.9
Serum ferritin (µg/L)	366.8	7	22.1	220.6	21.9
α Genotype	αα/αα	αα/αα	αα/αα	αα/αα	αα/αα
β Genotype	βIVS−II−806/βN	βN/βN	βN/βN	βN/βN	βIVS−II−806/βN

Using the PCR-RDB technology, a total of 23 types of common thalassemia variants were screened in the enrolled families. In the family 1, none of the common thalassemia mutations was present, except for the proband who had a heterozygous deletion of --^SEA. Nonetheless, the thalassemia gene testing result was inconsistent with the increased levels of Hb A2 in the proband, which indicated the co-inheritance of rare or novel β-thalassemia mutations. None of the common mutations were detected in family 2 via PCR-RDB detection. However, the proband in family 2 was indicated to be a β-thalassemia carrier with high levels of Hb A2. Moreover, the proband’s wife of family 2 displaying low levels of Hb A2 was suspected to harbor an α-thalassemia variant. Technology platforms for molecular diagnosis should be implemented to further investigate the rare thalassemia mutations in the family members who had abnormal hematological results.

In the present study, none of the rare deletional thalassemia variants were detected using the rare thalassemia genotype-screening kits. Subsequently, genomic DNA of the families were prepared for α and β-globin gene DNA sequencing using the specific primers. In the family 1, the proband with β-thalassemia trait was suspected to harbor rare or novel β-thalassemia mutations, then DNA sequencing results elicited three rare β-globin mutations including CD39 (C > T), IVS-II-81 (C > T) and IVS-II-806 (G > C) in the proband (Fig. 1). The pedigree analysis in Table 2 shows that the twin girls in family 1 carried the IVS-II-806 (G > C) mutation, indicating that the mutations of CD39 (C > T) and IVS-II-81 (C > T) were located in cis, and the rare IVS-II-806 (G > C) variant was located in trans. Finally, the genotypes of the proband in family 1 were described as --^SEA/αα, β^{CD39(C>T), IVS−II−81(C>T)}/β^{IVS−II−806(G>C)}. Furthermore, none of α and β-thalassemia variants were observed in the husband of the proband in family (1) Further DNA sequencing of δ-globin gene was carried out to determine whether the δ-globin gene mutation was co-inherited in the twin girls of family 1 who had the IVS-II-806 (G > C) mutation with normal levels of Hb A2, but none of the δ-globin gene mutation were observed. In family 2, as illustrated in Table 3, the rare IVS-II-806 (G > C) mutation was identified in the proband with high levels of Hb A2, as well as the proband’s sister. However, the proband’s brother with increased levels of Hb A2 did not carry the IVS-II-806 (G > C) mutation. None of the α and β-thalassemia variants were observed in the proband’s wife and his son of family (2) In proband 3, the rare IVS-II-806 (G > C) mutation was identified with none of the δ-globin gene mutation co-inherited, though the pedigree analysis was not available in this study.

Fig. 1.

DNA Sequencing was performed to detect the HBB gene mutations. A: The rare β-thalassemia mutation of Codon 39 (C > T) (HBB:c.118 C > T). B: The rare IVS-II-81 (C > T) (HBB:c.315 + 81 C > T) mutation in the β-globin gene. C: The rare IVS-II-806 (G > C) (HBB:c.316-45G > C) mutation in the β-globin gene

Discussion

β-thalassemia is a hemolytic anemia caused by insufficient (β⁺) or complete lack (β⁰) of β-globin peptide chain due to β-globin gene point mutation or structural variants. The frequency and genotype of β-thalassemia variants revealed obvious differences within regions [18]. In the Fujian province of Southeast China, the prevalence of β-thalassemia is 1.87% [13]. In current practice, combination of the hematological parameter Hb A2 with DNA sequencing yields a great value in the investigation of β-thalassemia mutations. In our study, three unrelated Chinese families carrying a rare IVS-II-806 (G > C) mutation in the β-globin gene were identified by multiple technologies for molecular diagnosis. Besides, the proband in family 1 carrying three rare β-globin mutations [CD39 (C > T), IVS-II-81 (C > T) and IVS-II-806 (G > C)] was first identified in the Chinese population.

In the present study, the genotype of the proband in family 1 was confirmed as --^SEA/αα, β^{CD39 (C>T), IVS−II−81(C>T)}/β^{IVS−II−806(G>C)} by subsequent pedigree analysis. Among them, the rare β-thalassemia mutation CD39 (C > T) (HBB:c.118 C > T) was first identified in the Fujian province. The CD39 (C > T) mutation is a nonsense mutation that changes the glutamine codon to a stop codon, leading to premature termination of protein translation and finally results in β⁰-thalassemia. The CD39 (C > T) and IVS-I-110 (G > A) mutations are more prevalent in the Mediterranean regions ^[19–20]. Moreover, the CD39 (C > T) mutation is the most prevalent β-thalassemia mutation in the Western Mediterranean (North African and Southern European countries) [21]. To date, the CD39 (C > T) mutation was rarely reported within the Chinese population, with only one case reported available to the best of our knowledge [22].

Few reports are available on the mutation of IVS-II-81 (C > T) (HBB:c.315 + 81 C > T), which was first described in Quanzhou region. The IVS-II-81 (C > T) mutation was a deep intronic variant, which was first identified by Riham et al. [23] in the Iraqi population and described as a benign mutation. In China, the IVS-II-81 (C > T) mutation was first identified in the Guangdong province, and was eventually found to be a benign mutation, with some carriers exhibiting normal hematological phenotype, while others exhibit microcytic hypochromic anemia [24]. In this study, the CD39 (C > T) and IVS-II-81 (C > T) mutations were located in the cis position, thus making it difficult to determine whether the IVS-II-81 (C > T) mutation would lead to a silent β-globin variant or not.

In the present study, three families with the deep intronic IVS-II-806 (G > C) variant were identified in the Chinese population, with no related data available in the HbVar database, but it was defined as a benign/likely benign variant in the ClinVar database. The study conducted by Chen et al. [25] first reported the rare variant in the Fujian province but lacked of further clinical and pedigree analysis. The other case reported by Zhong et al. [26] documented a Chinese female carrying the IVS-II-806 (G > C) variant who elicited silent hematologic features including normal MCV, MCH and HbA2 levels. In our study, clinical and hematological analysis of the IVS-II-806 (G > C) mutation was first conducted. The IVS-II-806 (G > C) mutation was located trans, with a CD39 (C > T) mutation (β⁰-thalassemia) in the proband of family 1 and only exhibited slightly decreased MCV and MCH levels, suggesting that the IVS-II-806 (G > C) variant was more likely to be a benign β-globin variant. Additionally, the twin girls in family 1 that carry the rare variant also showed normal levels of MCV, MCH and Hb A2, which further support the hypothesis that the IVS-II-806 (G > C) mutation may be a silent mutation, which is consistent with the previous study [26]. Meanwhile, the proband in family 3 also exhibited normal levels of Hb A2. Previous studies indicated that β-globin silent mutations commonly elicit normal or borderline Hb A2 levels [27]. Moreover, using Alamut and MutationTaster, the previous in silico analysis confirmed that the IVS-II-806 (G > C) mutation could be a polymorphic variant with no effect on splicing [26]. However, the proband and his sister in family 2 who carry the rare mutation demonstrated increased levels of Hb A2 and slightly low MCV and MCH levels. Nevertheless, the proband’s brother of family 2 delineating increased of Hb A2 levels did not harbor the IVS-II-806 (G > C) mutation, which implies that the increased levels of Hb A2 may not ascribe to the deep intronic variant. More work needs to be done to investigate the reason for the increased level of Hb A2 in family 2, such as duplicated α-globin genes or other disease.

In current practice, previous studies have indicated the application value of next generation sequencing technologies on molecular characterization of thalassemia gene detection [28–30]. Along with our study, we proposed that next generation sequencing or DNA sequencing should be employed in the molecular diagnosis of thalassemia mutations when the hematological phenotypes were inconsistent with conventional thalassemia gene testing results.

Conclusions

In this study, clinical and hematological analysis of the IVS-II-806 (G > C) mutation was conducted for the first time. Our study first identified an individual carrying three rare β-globin gene mutations [CD39 (C > T), IVS-II-81 (C > T) and IVS-II-806 (G > C)] with co-inherited α-thalassemia within the Chinese population. Finally, our study results indicated that the rare IVS-II-806 (G > C) mutation may be a benign β-globin variant, and further strengthened the application value of DNA sequencing in the molecular diagnosis of rare thalassemia variants.

Contributors

JZ designed the study and wrote the article. JZ and YW performed routine thalassemia analysis; QL, YC, SZ and SL enrolled participants and analyzed the data; meanwhile YJ and JZ revised and polished the paper. All authors approved the final manuscript.

Funding

This research was supported by Quanzhou City Science and Technology Project (2020N049s) and Huaqiao University Joint of Hospital and University Innovation Project (2021YX005).

Data Availability

The datasets used and analysed during the current study available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

This study was approved by the ethics committee of The Women’s and Children’s Hospital of Quanzhou (2020No.8).

Consent for publication

We confirmed that all subjects participated in this study signed a written informed consent for publication of their own and their children’s genetic data and other relevant information.

Competing interests

The authors declare that the research was conducted without any commercial or financial relationship that could be construed as a potential conflict of interest. The authors declare they have no conflict of interests.

Acknowledges

We express our appreciation to patients that participate to this study. We also thank the Quanzhou Science and technology bureau and Huaqiao University joint hospital and University innovation project for funding this work.