Skip to main content
Indian Journal of Hematology & Blood Transfusion logoLink to Indian Journal of Hematology & Blood Transfusion
. 2022 Jun 1;39(1):25–32. doi: 10.1007/s12288-022-01540-2

Twist1 Promoter Methylation Regulates the Proliferation and Apoptosis of Acute Myeloid Leukemia Cells via PI3K/AKT Pathway

Aihong Gong 1, Xiaojia Wang 1, Xuewei Wang 1, Ying Zhao 2, Yanan Cui 1,
PMCID: PMC9868029  PMID: 36699440

Abstract

Twist-related protein 1 (Twist1) is a widely recognized oncogene in acute myeloid leukemia (AML), and its promoter methylation is related with the progression of solid tumors. However, the association between Twist1 promoter methylation and AML has not been well studied. Twist1 mRNA expression was detected using quantitative real-time polymerase chain reaction (qRT-PCR). The protein levels of Twist1 and phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) signal were measured via western blotting. Methylation-specific PCR was performed to detect the methylation status of Twist1 promoter. CCK-8 assay and flow cytometry were used to reveal cellular biological effects. Twist1 expression and promoter methylation level were significantly upregulated in AML tissues and cell lines and were further downregulated in demethylating agent 5′-azacitidine (5-Aza)-treated cells. Ectopic expression of Twist1 increased AML cell viability, while reducing apoptosis, and attenuated the effects of 5-Aza on the proliferation and apoptosis. We also found that the PI3K/AKT signaling pathway was positively regulated by Twist1. Our findings revealed that Twist1 accelerates the tumorigenesis of AML cells by promoting its promoter methylation via the activation of PI3K/AKT signaling pathway.

Keywords: Acute myeloid leukemia, PI3K/AKT, Promoter methylation, Twist1

Introduction

Acute myeloid leukemia (AML) is a life-threatening hematological malignancy involving the abnormal proliferation and differentiation of hemopoietic progenitor cells [1, 2]. Although allogeneic hematopoietic cell transplantation is the major curative option for AML, many patients do not have the opportunity to receive the transplant due to the lack of matched donors [3, 4]. Although the etiology of AML has been studied in recent years, and a series of more specific therapeutic agents have emerged, the prognosis of AML is still poor [5, 6]. Therefore, it is of great significance to understand the pathogenesis of AML, and to find a better targeted therapy for improving the treatment of AML.

Twist-related protein 1 (Twist1), an oncogene encoded by a basic helix-loop-helix transcription factor (bHLH) transcription factor, plays a pivotal role in the tumorigenesis, especially in malignant tumors [7] and proliferative diseases of the hematopoietic system [8, 9]. Twist1 has been demonstrated to be frequently expressed in AML, which led to increased resistance to apoptosis and higher potentials of proliferation and migration [1012]. Moreover, the aberrant expression of Twist1 may be related to the therapeutic failure in hematological maglignancies [12]. In addition, Twist1 is believed to affect tumor cell apoptosis, and plays an important role in tumor invasion and metastasis as a key regulator in the process of epithelial-mesenchymal transition (EMT) [13, 14]. Although the abnormal DNA methylation of Twist1 promoter has been reported in several solid tumors [1518], the association between Twist1 methylation and the malignant biological properties of AML cells remain uncertain.

This project was undertaken to investigate whether Twist1 regulates AML cell growth through DNA methylation and the downstream signal molecules, which might provide a promising therapeutic target for AML treatment.

Materials and Methods

Patients and Clinical Specimens

Bone marrow specimens were collected from 30 AML patients and 30 healthy controls. Each subject provided the written informed consent. This study was approved by the Ethics Committee of General Hospital of Ningxia Medical University.

Cell Culture

Two AML cell lines (HL-60 and THP-1) and an human cell line CD34 + were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). All cells were maintained in RPMI-1640 media (Life Technologies, Carlsbad, CA, USA) containing 10% fetal bovine serum at 37 °C in humidified air containing 5% CO2. For DNA demethylation treatment, HL-60 and THP-1 cells were exposed to 10 μM of 5'-azacitidine (5-Aza; Sigma-Aldrich, St. Louis, MO, USA) for 72 h.

Cell Transfection

Twist1 overexpression plasmid was constructed by inserting the amplified cDNA into pcDNA 3.1 vector (Invitrogen, Carlsbad, CA, USA). Meanwhile, empty vectors were used as the negative controls. All plasmids were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China).

Prior to transfection, HL-60 and THP-1 cells were planted in 6-well plates and incubated at 37 °C for 24 h. At 70% confluence, cell transfection was performed with Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions.

RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Total RNA was isolated from bone marrow or cultured cells using TRIzol reagent (Invitrogen), and added for cDNA synthesis using PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara Biomedical Technology, Beijing, China). The amplification of PCR was performed on the 7500 FAST real-time PCR System (Applied Biosystems, Carlsbad, CA, USA), with GAPDH as the loading control. Primers used in the PCR reaction were listed as follows: Twist1, forward: 5′-TGTCCGCGTCCCACTAGC-3′; reverse: 5′-TGTCCATTTTCTCCTTCTCTGGA-3′ and GAPDH, forward: 5′-TGCACCACCAACTGCTTAGC-3′; reverse: 5′-GGCATGGACTGTGGTCATGAG-3′. A comparative cycle threshold (Ct) method was used to analyze the TWIST1 expression level.

DNA Isolation and Methylation-Specific PCR (MSP) Analysis

The genomic DNA extraction kit (Beyotime Biotechnology, Shanghai, China) was used to extract genomic DNA from bone marrow and cultured cells. Then, bisulfite-modified DNA was used as the template for MSP analysis of the level of Twist1 methylation. The methylated primers were forward, 5′‐TTTCGGATGGGGTTGTTATC‐3′; reverse, 5′‐AAACGACCTAACCCGAACG‐3′. The unmethylated primers were forward, 5′‐TTTGGATGGGGTTGTTATTGT‐3′; reverse, 5′‐CCTAACCCAAACAACCAACC‐3′. The PCR reaction conditions were 95 °C for 6 min, 60 °C for 1 min, 30 cycles for 1 min at 72 °C, and 72 °C for 7 min. PCR products were then subjected to 2% agarose gel electrophoresis.

Western Blotting

The cultured cells were lysed with RIPA lysis buffer (Beyotime Biotechnology). Protein concentrations of the cell lysates were measured by a BCA Protein Assay Kit (Beyotime Biotechnology). Proteins (30 μg) were separated by electrophoresis, transferred to polyvinylidenedifluoride membranes and incubated with primary antibodies (all from Cell Signaling Technology, Boston, MA, USA; 1:1000 dilution) to Twist1 (#69,366), p-PI3K (#17,366), PI3K (#4249), p-AKT (#4060), AKT (#4685), and GAPDH (#5174) and goat anti-rabbit IgG secondary antibody (#7074; 1:2000 dilution). These bands were visualized by enhanced chemiluminescence.

Cell Viability Assay

After 48 h transfection, the number of surviving HL-60 and THP-1 cells was assessed after adding the commercial CCK-8 kit (Beyotime Biotechnology) for 1 day, 2 days, 3 days, 4 days and 5 days. The absorbance at 450 nm was measured after incubation with CCK-8 for 2 h.

Flow Cytometry (FCM)

After 48 h transfection, HL-60 and THP-1 cells were washed with PBS, followed by centrifugation. Then, the cells were suspended in PBS and stained with eBioscience™ Annexin V-FITC Apoptosis Detection Kit (Invitrogen) at 4 °C under darkness for 30 min. The apoptotic cells were recorded using flow cytometry (Beckman Coulter, Fullerton, CA, USA).

Statistical Analysis

All data were expressed as the means ± standard deviation (SD). Statistical analysis was performed by GraphPad Prism 6.0 (GraphPad Software Incorporated, USA). Comparisons between groups were performed using paired Student’s t-tests and one-way ANOVA. The linear association was assessed by Pearson's correlation analysis. P < 0.05 was considered to be statistically significant difference.

Results

Twist1 and its Promoter Methylation are Upregulated in AML Tissues and Cells

To analyze whether Twist1 expression is associated with the pathogenesis of AML, we detected Twist1 mRNA and methylation level in AML patients and healthy controls. The qRT-PCR results showed that Twist1 mRNA levels were overexpressed in AML tissues relative to the healthy group (Fig. 1A). According to MSP assay, Twist1 methylation level was significantly higher in AML tissues than that in the normal tissues (Fig. 1B). As shown in Fig. 1C positive relationship was observed between Twist1 promoter methylation and its mRNA expression in AML tissues. Similarly, the mRNA and protein levels of Twist1 were also significantly increased in AML cell lines (HL-60 and THP-1) compared to CD34 + cells (Fig. 2A–C). The results (Fig. 2D) indicated that the methylation level of Twist1 promoter region was significantly enhanced in HL-60 and THP-1 cells than that in CD34 + cells.

Fig. 1.

Fig. 1

Expression of Twist1 and its promoter methylation in AML tissues. A Twist1 mRNA expression in AML tissues and normal controls was analyzed by qRT-PCR. B The promoter methylation level of Twist1 in AML tissues and normal controls was examined by MSP analysis. C The linear correlation between Twist1 promoter methylation and its mRNA expression in AML tissues. Data were expressed as the means ± SD, n = 30. Comparisons between two groups were conducted by means of paired Student’s t-tests. ***P < 0.001

Fig. 2.

Fig. 2

Expression of Twist1 and its promoter methylation in AML cells. A The mRNA of Twist1 in AML cells (HL-60 and THP-1) and normal CD34 + cells were examined by qRT-PCR. BC The representative bands and the protein levels of Twist1 in AML cells (HL-60 and THP-1) and normal CD34 + cells were examined by western blotting. D The methylation level of Twist1 promoter region in HL-60, THP-1 and CD34 + cells. Data were expressed as the means ± SD. Comparisons among multiple groups were assessed by one-way ANOVA. The experiment was independently repeated three times. **P < 0.01, ***P < 0.001

Twist1 Promoter Methylation Promotes the Proliferation of AML Cells

To further determine the influence of Twist1 on the multiplication capacity of AML cells, Twist1 were overexpressed in HL-60 and THP-1 cells. The results of western blot showed that the protein expression of Twist1 was significantly upregulated in these two cells transfected with Twist1 overexpression vector (Fig. 3A). The results of CCK-8 assay (Fig. 3B–C) demonstrated that overexpression of Twist1 promoted cell viability in HL-60 and THP-1 cells. To ascertain whether Twist1 expression was regulated by its promoter methylation in AML cells, HL-60 and THP-1 cells were then treated with the demethylating agent, 5-Aza. As demonstrated by MSP analysis, the methylation level of Twist1 promoter was markedly decreased in HL-60 and THP-1 cells treated by 5-Aza (Fig. 3D). Meanwhile, the mRNA and protein levels of Twist1, p-PI3K and p-AKT were remarkably downregulated after 5-Aza treatment, but there were no significant differences in the mRNA and protein expression of PI3K and AKT (Fig. 3E–F). As displayed in Fig. 3G–H, 5-Aza-treated cells appeared a significant decrease in cell viability, whereas Twist1 upregulation notably increased cell viability in 5-Aza-exposed HL-60 and THP-1 cells.

Fig. 3.

Fig. 3

Effects of Twist1 promoter methylation on the proliferation of AML cells. A Transfection efficiency of Twist1 overexpression was confirmed by western blotting. BC Cell viability of HL-60 and THP-1 cells with Twist1 overexpression was examined by CCK-8 assay. D The methylation level of Twist1 were determined in HL-60 and THP-1 cells treated by 5-Aza. EF the mRNA and protein levels of Twist1, p-PI3K, PI3K, p-AKT and AKTwere determined in HL-60 and THP-1 cells treated by 5-Aza. GH Cell viability of 5-Aza-exposed HL-60 and THP-1 cells with Twist1 overexpression was examined by CCK-8 assay. Data were expressed as the means ± SD. Comparisons were assessed by paired Student’s t-tests or one-way ANOVA. The experiment was independently repeated three times. **P < 0.01, ***P < 0.001

Twist1 Promoter Methylation Inhibits the Apoptosis of AML Cells

Afterwards, FCM was employed to examine the effects of Twist1 on AML cell apoptosis. In HL-60 and THP-1 cells, the enforced expression of Twist1 reduced the apoptotic ratio (Fig. 4A). Moreover, more apoptotic cells were observed in 5-Aza-triggered cells than that in untreated cells, while Twist1 overexpression reversed 5-Aza-induced pro-apoptotic effects (Fig. 4B).

Fig. 4.

Fig. 4

Effects of Twist1 promoter methylation on the apoptosis of AML cells. A Cell apoptosis of HL-60 and THP-1 cells with Twist1 overexpression was examined by flow cytometry. B Cell apoptosis of 5-Aza-exposed HL-60 and THP-1 cells with Twist1 overexpression was examined by flow cytometry. Data were expressed as the means ± SD. Comparisons were assessed by paired Student’s t-tests or one-way ANOVA. The experiment was independently repeated three times. *P < 0.05, **P < 0.01

Twist1 Promoter Methylation Activates PI3K/AKT Signal

Next, we further explored the association between Twist1 methylation and PI3K/AKT signaling pathway in AML progression. As shown in Fig. 5A, Twist1 transfection observably enhanced the phosphorylation of PI3K and AKT proteins instead of the total proteins. In addition, Twist1 overexpression rescued the decrease in the phosphorylated levels of PI3K and AKT induced by 5-Aza treatment (Fig. 5B).

Fig. 5.

Fig. 5

Effects of Twist1 promoter methylation on PI3K/AKT signal activiation. A PI3K and AKT total and phosphorylated levels in HL-60 and THP-1 cells with Twist1 overexpression was examined by western blotting. B PI3K and AKT total and phosphorylated levels in 5-Aza-exposed HL-60 and THP-1 cells with Twist1 overexpression was examined by western blotting. Data were expressed as the means ± SD. Comparisons were assessed by paired Student’s t-tests or one-way ANOVA. The experiment was independently repeated three times. *P < 0.05, **P < 0.01

Discussion

In the present study, our findings revealed that Twist1 is activated due to promoter methylation and exerts a tumor-promoting role in AML through the PI3K/AKT signaling pathway. Increasing evidence has shown that Twist1 is abnormally overexpressed, and plays a crucial role in the development of various types of cancers. For instance, Twist1 was highly expressed in pancreatic cancer, and facilitated tumor cell aerobic glycolysis through transcriptional regulation [19]. In breast cancer, the upregulation of Twist1 is a positive regulator of cell proliferation and EMT progression [20, 21]. In the present study, we found that Twist1 was frequently upregulated in AML tissues and cells, which was consistent with previous reports [10, 22]. Further research confirmed that the overexpression of Twist1 strengthened AML cell proliferation, but impeded cell apoptosis. These data further confirmed the carcinogenic effect of Twist1 in AML progression.

As a widely-studied epigenetic modification, DNA methylation is essential for the silencing of tumor suppressor genes or the upregulation of oncogenes [23, 24]. The development of a variety of hematological malignancies including AML is associated with DNA methylation modification and the associated dysregulation of transcription [25, 26]. Herein, to our knowledge, it was the first time to illustrate that Twist1 promoter methylation was frequently observed in AML tissues and cells. As far as we know, the enforced overexpression of Twist1 by promoter methylation is recognized as a common event in malignant cancers, such as breast cancer [15], colorectal cancer [18], head and neck squamous cell carcinoma [27], and so on. Thus, we proposed a hypothesis that the expression of Twist1 was affected by aberrant promoter methylation. Inhibition of Twist1 promoter methylation was found in 5-Aza-treated AML cells, which was accompanied by decreased mRNA and protein expression, suggesting that DNA methylation may be the primary reason for the upregulation of Twist1. Furthermore, Twist1 overexpression could antagonize the anti-proliferative and pro-apoptotic effects of 5-Aza in AML cells. It is possible that Twist1 was overexpressed by promoter methylation, and participate in AML tumor progression.

It has been shown that the PI3K/AKT signaling pathway plays a key role in cellular biological process, including proliferation, apoptosis, angiogenesis and cell cycle progression by affecting the activation state of a variety of downstream effectors [2830]. PI3K/AKT signal pathway is frequently activated and implicated in the malignant progression of a variety of human tumors, including AML [3133]. Previous studies have reported that Twist1 performs drug resistance mechanism in chronic myeloid leukemia by acting on PI3K/AKT pathway [34]. Our results showed that the phosphorylation level of PI3K and AKT was decreased by 5-Aza treatment in AML cells. In contrast, PI3K/AKT signal pathway was activated when Twist1 was overexpressed. These results are similar to those reported that Twist1 recruits DNMT3a to methylate promoter regions of CDKN1A/C, resulting in inhibition of CDKN1A/C expression, which reverses G0/G1 arrest and promotes cell proliferation [12]. The PI3K/AKT signaling pathway is a critical intracellular pathway that regulates cell cycle and it is activated by Twist1 to effect the drug resistance in chronic myeloid leukemia cells [34]. Therefore, Twist1 might inhibit the PI3K/Akt pathway to control the proliferation and apoptosis abilities of AML cells, which needs to be further explored.

In conclusion, the present study demonstrates that Twist1 promoter methylation contributed to AML cell growth by activating the PI3K/AKT pathway. Twist1 might be an epigenetic target for AML.

Author Contributions

AHG conducted most of the experiments and wrote the manuscript; XJW, XWW and YZ conducted the experiments and analyzed the data, YNC designed the study and revised the manuscript. All authors have read and approved the manuscript.

Funding

The present study was supported by Ningxia Natural Science Foundation, [2020AAC03369].

Data Availability

All data in this study can be obtained by proper request from the authors.

Declarations

Conflict of interest

The authors declare there is no conflict of interest in this study.

Ethics Approval and Consent to Participate

The present study was approved by the ethic committee of General Hospital of Ningxia Medical University of science and technology.

Consent for Publication

All authors agreed the submission and the policy of the journal and copyright.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.De Kouchkovsky I, Abdul-Hay M. Acute myeloid leukemia: a comprehensive review and 2016 update. Blood Cancer J. 2016;6(7):e441. doi: 10.1038/bcj.2016.50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Pelcovits A, Niroula R. Acute myeloid leukemia: a review. R I Med J (2013) 2020;103(3):38–40. [PubMed] [Google Scholar]
  • 3.Kassim AA, Savani BN. Hematopoietic stem cell transplantation for acute myeloid leukemia: a review. Hematol Oncol Stem Cell Ther. 2017;10(4):245–251. doi: 10.1016/j.hemonc.2017.05.021. [DOI] [PubMed] [Google Scholar]
  • 4.Takami A. Hematopoietic stem cell transplantation for acute myeloid leukemia. Int J Hematol. 2018;107(5):513–518. doi: 10.1007/s12185-018-2412-8. [DOI] [PubMed] [Google Scholar]
  • 5.Medeiros BC. Is there a standard of care for relapsed AML? Best Pract Res Clin Haematol. 2018;31(4):384–386. doi: 10.1016/j.beha.2018.09.006. [DOI] [PubMed] [Google Scholar]
  • 6.Zhang G, et al. High ETS2 expression predicts poor prognosis in acute myeloid leukemia patients undergoing allogeneic hematopoietic stem cell transplantation. Ann Hematol. 2019;98(2):519–525. doi: 10.1007/s00277-018-3440-4. [DOI] [PubMed] [Google Scholar]
  • 7.Zhao Z, et al. Multiple biological functions of Twist1 in various cancers. Oncotarget. 2017;8(12):20380–20393. doi: 10.18632/oncotarget.14608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liu X, et al. Niche TWIST1 is critical for maintaining normal hematopoiesis and impeding leukemia progression. Haematologica. 2018;103(12):1969–1979. doi: 10.3324/haematol.2018.190652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dong CY, et al. Twist-1, a novel regulator of hematopoietic stem cell self-renewal and myeloid lineage development. Stem Cells. 2014;32(12):3173–3182. doi: 10.1002/stem.1803. [DOI] [PubMed] [Google Scholar]
  • 10.Chen CC, et al. Favorable clinical outcome and unique characteristics in association with Twist1 overexpression in de novo acute myeloid leukemia. Blood Cancer J. 2015;5:e339. doi: 10.1038/bcj.2015.67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Xu J, et al. DNMT3A mutation leads to leukemic extramedullary infiltration mediated by TWIST1. J Hematol Oncol. 2016;9(1):106. doi: 10.1186/s13045-016-0337-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Li H, et al. Elevated TWIST1 expression in myelodysplastic syndromes/acute myeloid leukemia reduces efficacy of hypomethylating therapy with decitabine. Haematologica. 2020;105(10):e502. doi: 10.3324/haematol.2019.235325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zhu QQ, et al. The role of TWIST1 in epithelial-mesenchymal transition and cancers. Tumour Biol. 2016;37(1):185–197. doi: 10.1007/s13277-015-4450-7. [DOI] [PubMed] [Google Scholar]
  • 14.Alaaeldin R, et al. Modulation of apoptosis and epithelial-mesenchymal transition E-cadherin/TGF-beta/Snail/TWIST pathways by a new ciprofloxacin chalcone in breast cancer cells. Anticancer Res. 2021;41(5):2383–2395. doi: 10.21873/anticanres.15013. [DOI] [PubMed] [Google Scholar]
  • 15.Gort EH, et al. Methylation of the TWIST1 promoter, TWIST1 mRNA levels, and immunohistochemical expression of TWIST1 in breast cancer. Cancer Epidemiol Biomark Prev. 2008;17(12):3325–3330. doi: 10.1158/1055-9965.EPI-08-0472. [DOI] [PubMed] [Google Scholar]
  • 16.Ruppenthal RD, et al. TWIST1 promoter methylation in primary colorectal carcinoma. Pathol Oncol Res. 2011;17(4):867–872. doi: 10.1007/s12253-011-9395-6. [DOI] [PubMed] [Google Scholar]
  • 17.Kwon MJ, et al. TWIST1 promoter methylation is associated with prognosis in tonsillar squamous cell carcinoma. Hum Pathol. 2013;44(9):1722–1729. doi: 10.1016/j.humpath.2013.03.004. [DOI] [PubMed] [Google Scholar]
  • 18.Galvan JA, et al. TWIST1 and TWIST2 promoter methylation and protein expression in tumor stroma influence the epithelial-mesenchymal transition-like tumor budding phenotype in colorectal cancer. Oncotarget. 2015;6(2):874–885. doi: 10.18632/oncotarget.2716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wang XX, et al. TWIST1 transcriptionally regulates glycolytic genes to promote the Warburg metabolism in pancreatic cancer. Exp Cell Res. 2020;386(1):111713. doi: 10.1016/j.yexcr.2019.111713. [DOI] [PubMed] [Google Scholar]
  • 20.Xu Y, et al. Twist1 promotes breast cancer invasion and metastasis by silencing Foxa1 expression. Oncogene. 2017;36(8):1157–1166. doi: 10.1038/onc.2016.286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Liu YQ, et al. MiR-526b suppresses cell proliferation, cell invasion and epithelial-mesenchymal transition in breast cancer by targeting Twist1. Eur Rev Med Pharmacol Sci. 2020;24(6):3113–3121. doi: 10.26355/eurrev_202003_20678. [DOI] [PubMed] [Google Scholar]
  • 22.Zhao C, et al. Increased NFATC4 correlates With poor prognosis of AML through recruiting regulatory T cells. Front Genet. 2020;11:573124. doi: 10.3389/fgene.2020.573124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lao TD, Nguyen TN, Le TAH. Promoter hypermethylation of tumor suppressor genes located on short arm of the chromosome 3 as potential biomarker for the diagnosis of nasopharyngeal carcinoma. Diagnostics (Basel) 2021;11(8):1404. doi: 10.3390/diagnostics11081404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Fain JS, et al. Transcriptional overlap links DNA hypomethylation with DNA hypermethylation at adjacent promoters in cancer. Sci Rep. 2021;11(1):17346. doi: 10.1038/s41598-021-96844-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lee E, et al. recent clinical update of acute myeloid leukemia: focus on epigenetic therapies. J Korean Med Sci. 2021;36(13):e85. doi: 10.3346/jkms.2021.36.e85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Samimi H, et al. DNA methylation analysis improves the prognostication of acute myeloid leukemia. EJHaem. 2021;2(2):211–218. doi: 10.1002/jha2.187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Fan Z, et al. Targeting methyltransferase PRMT5 retards the carcinogenesis and metastasis of HNSCC via epigenetically inhibiting Twist1 transcription. Neoplasia. 2020;22(11):617–629. doi: 10.1016/j.neo.2020.09.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wu X, et al. The miR-302s/367 cluster inhibits the proliferation and apoptosis in sheep fetal fibroblasts via the cell cycle and PI3K-Akt pathways. Mamm Genome. 2021;32(3):183–194. doi: 10.1007/s00335-021-09873-5. [DOI] [PubMed] [Google Scholar]
  • 29.Chen Q, Wang M, Shen C. Bauerane induces S-phase cell cycle arrest, apoptosis, and inhibition of proliferation of A549 human lung cancer cells through the phosphoinositide 3-kinase (PI3K)/AKT and signal transducer and activator of transcription 3 (STAT3) signaling pathway. Med Sci Monit. 2020;26:e919558. doi: 10.12659/MSM.919558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Gao H, et al. Yiqi-Huoxue granule promotes angiogenesis of ischemic myocardium through miR-126/PI3K/Akt axis in endothelial cells. Phytomedicine. 2021;92:153713. doi: 10.1016/j.phymed.2021.153713. [DOI] [PubMed] [Google Scholar]
  • 31.Huang J, et al. MicroRNA93 knockdown inhibits acute myeloid leukemia cell growth via inactivating the PI3K/AKT pathway by upregulating DAB2. Int J Oncol. 2021;59(4):1–14. doi: 10.3892/ijo.2021.5260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Shi M, et al. LncRNA-SNHG16 promotes proliferation and migration of acute myeloid leukemia cells via PTEN/PI3K/AKT axis through suppressing CELF2 protein. J Biosci. 2021;46:1–13. doi: 10.1007/s12038-020-00127-1. [DOI] [PubMed] [Google Scholar]
  • 33.Zhou C, et al. GLI1 reduces drug sensitivity by regulating cell cycle through PI3K/AKT/GSK3/CDK pathway in acute myeloid leukemia. Cell Death Dis. 2021;12(3):231. doi: 10.1038/s41419-021-03504-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Yuan R, Chang J, He J. Effects of Twist1 on drug resistance of chronic myeloid leukemia cells through the PI3K/AKT signaling pathway. Cell Mol Biol (Noisy-le-grand) 2020;66(6):81–85. doi: 10.14715/cmb/2020.66.6.15. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data in this study can be obtained by proper request from the authors.


Articles from Indian Journal of Hematology & Blood Transfusion are provided here courtesy of Springer

RESOURCES