Abstract
Background and Objectives
The COVID-19 pandemic that emerged in China in late 2019 and spread rapidly around the world. There is evidence that COVID-19 infection can be influenced by genetic variations in the host. The aim of this study was to investigate the association between ACE InDel polymorphism and COVID-19 in Northern Cyprus.
Patients and methods
This study included 250 patients diagnosed with COVID-19 and 371 healthy controls. Genotyping for the ACE InDel gene polymorphism was performed by polymerase chain reaction.
Results
The frequency of ACE DD homozygotes was significantly increased in COVID-19 patients compared to the control group (p = 0.022). The difference in the presence of the D allele between the patient and control groups was statistically significant (57.2% and 50.67%, respectively, p < 0.05). Individuals with the genotype II were found to have a higher risk of symptomatic COVID-19 (p = 0.011). In addition, chest radiographic findings were observed more frequently in individuals with the genotype DD compared to individuals with the genotypes ID and II (p = 0.005). A statistically significant difference was found when the time of onset of symptoms for COVID-19 and duration of treatment were compared with participants’ genotypes (p = 0.016 and p = 0.014, respectively). The time of onset of COVID-19 was shorter in individuals with the genotype DD than in individuals with the genotype II, while the duration of treatment was longer.
Conclusion
In conclusion, the ACE I/D polymorphism has the potential to predict the severity of COVID-19.
Keywords: ACE I/D polymorphism, Genetic polymorphisms, COVID-19 infection, SARS-CoV-2
Abstract
Antecedentes y objetivos
La pandemia de COVID-19 surgió en China a fines de 2019 y se extendió rápidamente por todo el mundo. Existe evidencia de que la infección por COVID-19 puede verse influenciada por variaciones genéticas en el huésped. El objetivo de este estudio fue investigar la asociación entre el polimorfismo ACE InDel y COVID-19 en el norte de Chipre.
Pacientes y métodos
Se incluyeron 250 pacientes diagnosticados de COVID-19 y 371 controles sanos. El genotipado del polimorfismo del gen ACE InDel se realizó mediante reacción en cadena de la polimerasa.
Resultados
La frecuencia de homocigotos ACE DD aumentó significativamente en pacientes con COVID-19 en comparación con el grupo de control (p = 0,022). La diferencia en la presencia del alelo D entre los grupos de pacientes y control fue estadísticamente significativa (57,2% y 50,67%, respectivamente, p < 0,05). Las personas con el genotipo II tenían un mayor riesgo de COVID-19 sintomático (p = 0,011). Además, los hallazgos radiográficos de tórax se observaron con mayor frecuencia en individuos con el genotipo DD en comparación con los individuos con los genotipos ID y II (p = 0,005). Se encontró una diferencia estadísticamente significativa cuando se comparó el tiempo de aparición de los síntomas de COVID-19 y la duración del tratamiento con los genotipos de los participantes (p = 0,016 y p = 0,014, respectivamente). El tiempo de aparición de COVID-19 fue más corto en individuos con genotipo DD que en individuos con genotipo II, mientras que la duración del tratamiento fue más prolongada.
Conclusiones
El polimorfismo ACE I/D podría predecir la gravedad de la COVID-19.
Palabras clave: Polimorfismo ACE I/D, Polimorfismos genéticos, Infección por COVID-19, SARS-CoV-2
Introduction
The Coronavirus Disease-19 (COVID-19) pandemic was caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which emerged in China in late 2019 and spread rapidly worldwide.1 COVID-19 shows considerable regional variation in prevalence and mortality. Epidemiological studies have shown that mortality due to COVID-19 is higher in Europe than in China.2
COVID-19 has a complex etiology and presents with a wide range of signs and symptoms including fever, cough, headache and fatigue.3 Advanced old age, underlying comorbidities such as hypertension, diabetes and obesity are some of the risk factors associated with the progression of COVID-19. In addition, socioeconomic status, lifestyle, geographic location, ethnicity are some of the factors that influence the individual outcomes.4
Importantly, the interaction between host and SARS-CoV-2 in COVID-19 pathogenesis is not yet fully elucidated.5, 6 There is evidence that COVID-19 infection can be influenced by genetic variations in the host.2
It has been pointed out that the risk of developing COVID-19 and adverse events associated with COVID-19 may be caused by acquired and inherited factors that affect the expression and function of Renin–Angiotensin–Aldosterone system (RAAS) components.7 Researchers have paid close attention to RAAS in the COVID-19 pandemic because angiotensin-converting enzyme 2 (ACE2) is the primary receptor for SARS-CoV-2 on alveolar epithelial cells.8
RAAS is an important regulator of systemic blood pressure and renal function and a major player in renal and cardiovascular disease. Also, the function of its components (ACE, ACE2) can directly or indirectly affect the function of the lung, heart, kidney, brain and immune system.9 Importantly, Angiotensin-converting enzyme (ACE or ACE1) is responsible for catalyzing the synthesis of Angiotensin-II (Ang-II) from Ang-I and ACE2 has a role in the hydrolysis of Ang-II into Ang-1-7 and at the sametime it is responsible from proteolysis of bradykanin. Ang-II binds to the AT1 receptor and controls some of the responses such as fibrosis, vasoconstriction, thrombosis, and inflammation.10 On the other hand, Ang-1-7 binds to the AT2 receptor, increasing vasodilation and decreasing fibrosis, inflammation, and thrombosis.7
It has been indicated that the imbalance between ACE and ACE2 affects the risk of developing different diseases including hypertension and cardiovascular disease.11, 12 Importantly increased activity of Ang II/AT1R axis due to the a hyperactivity of ACE increases the risk of developing cardiovascular and lung diseases.11, 12
Specifically, the ACE gene is found on chromosome 17q23 and includes an insertion/deletion (InDel, I/D) polymorphism (rs4646994) of a 287-bp Alu repeat sequence in intron 16 which results in three different genotypes; DD or II homozygotes or ID heterozygotes.9, 13 Among the ACE polymorphisms, the ACE I/D polymorphism (rs4646994) is one of the best studied polymorphisms.9, 14 The ACE I/D polymorphism has been associated with some of the underlying comorbidities of COVID-19 such as hypertension, cardiovascular disease, and diabetes mellitus. Furthermore, in several studies, this polymorphism has been associated with venous thrombosis, acute respiratory distress syndrome (ARDS) outcome and progression of pneumonia in SARS.7, 15, 16
In many studies, the D allele of the ACE I/D polymorphism is associated with increased levels of serum and tissue ACE concentration and increased production of the vasopressor angiotensin II.17 The study carried out by Cambien et al.18 showed that 47% of the ACE serum difference can be explained by ACE I/D gene variation. Furthermore, ACE I/D has been shown to affect the ACE activity. Several studies have demonstrated that individuals with DD genotype were found to have higher blood ACE levels compare to individuals with II and ID genotypes.10 Importantly increased expression of ACE could explain the higher risk of cardiovascular and respiratory diseases in individuals with DD genotype.7
Furthermore, in a study which aimed to find a possible association between the ACE I/D polymorphism and COVID-19, the D allele frequency of ACE was compared with COVID-19 mortality in 25 different European countries, and a significant association was found between COVID-19 related deaths and the prevalence of the ACE D allele.2 Additionally, due to ACE and ACE2 have opposite roles, the decrease in ACE2 receptor gene expression result in increased ACE expression. So, it was hypothesized that the deletion allele of ACE I/D polymorphism is associated with decreased expression of ACE2, which is crucial since coronaviruses (SARS-CoV and SARS-CoV-2) are able to bind to their target cells through the ACE2 receptor. Therefore, the D allele can affect the course of COVID-19 by decreasing the ACE2 receptor level.2, 19
Variants at ACE and ACE2 genes have been associated with the differences in gene expression and protein function. Previously, it was pointed out that the ACE I/D polymorphism, although located in a noncoding region, affects gene expression and protein function and that its presence is directly related to the regulation of the renin–angiotensin system and associated with pathological conditions.7, 9 Therefore, the ACE I/D polymorphism may explain individual predisposition to disease symptoms and risk of hospitalization and adverse events. Finally, it has been suggested that allele frequencies in different regions may explain the different incidence and mortality rates of COVID-19.7 Nevertheless, in the literature, a limited number of studies have been undertaken to explain the association between ACE I/D polymorphism and COVID-19. This particular study aims to investigate the association between the ACE I/D polymorphism and COVID-19 in Northern Cyprus.
Materials & methods
Subjects & study design
This study included 250 subjects who tested positive for the presence of SARS-CoV-2 infection (PCR test from nasopharynx and oropharynx combination swab) and had recovered at the time of sample collection. Samples from the subjects were collected between June 2021 and March 2022. Patients had mostly severe cough, fever, difficulty breathing, loss of smell and taste, runny nose, headache, sore throat, chest pain, fatigue, back pain and joint pain. In addition, 371 healthy subjects were included in the control group. Clinical data was obtained from patients diagnosed with COVID-19. Also, a questionnaire was administered to each subject to obtain information about their personal characteristics such as ethnicity, age, socioeconomic background, and general health. All study participants were residents of Northern Cyprus. Written informed consent was obtained from all subjects who participated in the study. The study protocol was approved by the Near East University ethics committee (application no NEU/2021/90-1342).
In addition, after control tests and medical examination by clinicians, healthy individuals without any systemic disease were included in the study. Furthermore, due to the small size of the population and the high number of relatives in Northern Cyprus, individuals who were relatively related were excluded from the study.
Molecular genotyping
Antecubital venous blood was drawn from the subjects in test tubes containing ethylenediaminetetraacetic acid (EDTA). Genomic DNA was isolated from EDTA-treated whole blood using the QIAamp DNA Blood Mini Kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions. To minimize the risk of contamination during genomic DNA isolation and PCR amplification, a class II laminar flow hood, special pipettes and UV-treated solutions were used. DNA concentration was measured using the NanoDrop™ 2000/2000c spectrophotometer at a wavelength of 260/280 (Thermofisher Scientific, USA). The ACE I/D polymorphism (rs4646994) in intron 16 was genotyped by polymerase chain reaction (PCR) followed by agarose gel electrophoresis. Amplification was performed in a 25 μl volume containing just under 50 ng of template DNA, 10 μM of each primer (Intron Health Product, Turkey) (Forward: 5′CTGGAGACCACTCCCATCCTTTCT3′; Reverse: 5′GATGTGGCCATCACATTCGTCAGAT-3′), 12.5 μl PCR Master Mix (2×) (Thermo Fisher Scientific, USA). The PCR cycling conditions were as follows: an initial denaturation at 95 °C for 2 min, then the reaction mixture was subjected to 30 cycles consisting of 1 min denaturation at 95 °C, 1 min annealing at 60 °C, 1 min extension at 72 °C and a final extension for 7 min at 72 °C. PCR products were applied to a 2% agarose gel and visualized by ethidium bromide staining under UV light. (Cleaver Scientific Ltd, UK). D or I alleles were determined by the presence of 190 or 490 bp fragments, respectively. The heterozygous ID genotype shows the presence of two bands at 490 bp and one band at 190 bp.
Statistical analysis
IBM ® SPSS ® Statistics program was used for statistical analysis in the study. Allelic frequencies were estimated by genotypic distribution of polymorphisms and tested for Hardy–Weinberg equilibrium (HWE) by X 2 analysis. Chi-square test was used to compare categorical variables. Kruskal–Wallis test was used to compare continuous variables. A p-value < 0.05 was considered statistically significant.
Results
Table 1 shows the distribution of ACE I/D polymorphism in the COVID-19 patient group and control group. When the genotypes were compared between the patient and healthy group, a statistically significant difference was found. The frequency of ACE DD homozygotes was significantly increased in COVID-19 patients compared with that in control group (p = 0.022). The difference in the presence of the D allele between the patient and control groups was statistically significant (57.2% vs. 50.67%, respectively, p < 0.05) (Table 1).
Table 1.
The distribution of the genotypes in COVID-19 and control group.
| Genotype | COVID-19 group | Control group | X2 | p value | OR | 95 CI% |
|---|---|---|---|---|---|---|
| DD | 92(36.80%) | 98 (26.42%) | ||||
| DI | 102 (40.80%) | 180(48.52%) | 7.066 | 0.022* | ||
| II | 56 (22.40%) | 93 (25.07%) | ||||
| Allele | ||||||
| D | 286 (57.2) | 376 (50.67) | 5.111 | 0.024* | 1.301 | 1.035–1.634 |
| I | 214 (42.8) | 366 (49.33) | ||||
Statistically significant p < 0.05.
X2: Pearson chi square test.
A significant difference was found between the different genotypes in terms of gender, smoking/alcohol consumption and chronic diseases. The frequency of females was lower in individuals with the genotype II (p = 0.006). In addition, individuals with the II genotype were found to have lower cigarette and alcohol consumption than individuals with the DD genotype (p = 0.006). Finally, chronic diseases are more common in individuals with the ID genotype than in individuals with the II genotype (p = 0.008) (Table 2 ).
Table 2.
Sociodemographic characteristics of the COVID-19 patients.
| DD |
ID |
II |
X2 | p | ||||
|---|---|---|---|---|---|---|---|---|
| n | % | n | % | n | % | |||
| Gender | ||||||||
| Female | 42 | 45.65 | 36 | 35.29 | 11 | 19.64 | 10.279 | 0.006* |
| Male | 50 | 54.35 | 66 | 64.71 | 45 | 80.36 | ||
| Age group | ||||||||
| 35 years and younger | 45 | 48.91 | 44 | 43.14 | 31 | 55.36 | 2.327 | 0.676 |
| 36–50 years | 29 | 31.52 | 37 | 36.27 | 15 | 26.79 | ||
| 51 years and older | 18 | 19.57 | 21 | 20.59 | 10 | 17.86 | ||
| BMI | ||||||||
| Normal | 32 | 34.78 | 39 | 38.24 | 22 | 39.29 | 3.010 | 0.556 |
| Slightly fat | 36 | 39.13 | 42 | 41.18 | 26 | 46.43 | ||
| Obese | 24 | 26.09 | 21 | 20.59 | 8 | 14.29 | ||
| Smoking/alcohol consumption | ||||||||
| No | 53 | 57.61 | 65 | 63.73 | 34 | 60.71 | 18.065 | 0.006* |
| Only smoking | 6 | 6.52 | 17 | 16.67 | 12 | 21.43 | ||
| Only alcohol | 21 | 22.83 | 15 | 14.71 | 10 | 17.86 | ||
| Smoking and alcohol | 12 | 13.04 | 5 | 4.90 | 0 | 0.00 | ||
| Chronic disease | ||||||||
| No | 66 | 71.74 | 60 | 58.82 | 46 | 82.14 | 9.744 | 0.008* |
| Yes | 26 | 28.26 | 42 | 41.18 | 10 | 17.86 | ||
| Medication use | ||||||||
| No | 69 | 75.00 | 68 | 66.67 | 45 | 80.36 | 3.778 | 0.151 |
| Yes | 23 | 25.00 | 34 | 33.33 | 11 | 19.64 | ||
Statistically significant p < 0.05.
X2: Pearson chi square test.
A statistically significant difference was found when the severity of COVID -19 symptoms and chest radiograph findings were compared with the genotype of the participants (p = 0.011 and p = 0.005, respectively). Individuals with the genotype II were found to have a higher risk of developing severe COVID -19 symptoms. In addition, findings in the chest radiograph findings were observed more frequently in individuals with the DD genotype compared to individuals with the ID and II genotypes (Table 3 ).
Table 3.
Comparision of the severity of COVID-19 symptoms, chest radiographic findings, and hospitalization status according to participants’ genotypes.
| DD |
ID |
II |
X2 | p | ||||
|---|---|---|---|---|---|---|---|---|
| n | % | n | % | n | % | |||
| Severity of COVID-19 symptoms | ||||||||
| Asymptomatic | 11 | 11.96 | 15 | 14.71 | 17 | 30.36 | 9.029 | 0.011* |
| Symptomatic | 81 | 88.04 | 87 | 85.29 | 39 | 69.64 | ||
| Chest radiographic findings | ||||||||
| No | 50 | 54.35 | 72 | 70.59 | 44 | 78.57 | 10.510 | 0.005* |
| Yes | 42 | 45.65 | 30 | 29.41 | 12 | 21.43 | ||
| Hospitalization status | ||||||||
| No | 79 | 85.87 | 87 | 85.29 | 47 | 83.93 | 0.105 | 0.949 |
| Yes | 13 | 14.13 | 15 | 14.71 | 9 | 16.07 | ||
Statistically significant p < 0.05.
X2: Pearson chi-square test.
A statistically significant difference was found when the time of onset of symptoms for COVID-19 and duration of treatment were compared with participants’ genotypes (p = 0.016 and p = 0.014, respectively). The time of onset of COVID-19 was shorter in individuals with the genotype DD than in individuals with the genotype II, while the duration of treatment was longer. No statistically significant difference was found when the genotypes of the participants were compared with the recovery rate (p > 0.05) (Table 4 ).
Table 4.
Comparison of time of onset of symptom for COVID-19, recovery rate and duration of treatment according to the participants’ genotypes.
| Genotype | n | s | M | SO | X2 | p | Difference | ||
|---|---|---|---|---|---|---|---|---|---|
| Time of onset of symptoms for COVID-19 | DD | 81 | 3.54 | 2.00 | 3 | 94.43 | 8.216 | 0.016* | DD-II |
| ID | 87 | 3.52 | 1.40 | 3 | 102.83 | ||||
| II | 39 | 4.26 | 1.80 | 4 | 126.47 | ||||
| Recovery rate | DD | 92 | 11.88 | 4.40 | 11 | 126.69 | 0.396 | 0.820 | |
| ID | 102 | 11.64 | 4.84 | 11 | 122.28 | ||||
| II | 56 | 11.96 | 5.40 | 11 | 129.41 | ||||
| Duration of treatment | DD | 92 | 8.43 | 5.93 | 5.5 | 141.02 | 8.473 | 0.014* | DD-II |
| ID | 102 | 6.75 | 5.37 | 5 | 121.11 | ||||
| II | 56 | 6.64 | 7.75 | 5 | 108.01 | ||||
p < 0.05.
X2: Kruskal–Wallis H test.
Discussion
The I/D polymorphism within the gene ACE is one of the inherited variants that has been studied due to its potential impact on the susceptibility and severity of COVID-19 since the onset of the COVID-19 outbreak.20, 21 However, most of these studies do not include direct patient data and conclusions are conflicting. Therefore, this particular study aimed to investigate the association between ACE I/D polymorphism and COVID-19 in Northern Cyprus.
In a previous study, ethnicities with higher frequency of the ACE I allele have been shown to be less susceptible to COVID-19. On the other hand, in another study, higher prevalence of ACE I has been associated with the increased risk of developing of COVID-19.22, 23
In the literature, a higher incidence of pneumonia was observed in patients carrying the D allele in SARS-CoV-1 infection.20 Similarly, in some studies, the ACE DD was associated with the outcome of ARDS. In contrast, in other studies, no significant association was found between ACE DD and respiratory diseases.13, 24 For instance, in a study conducted in the Vietnamese population, this polymorphism was examined in 44 Vietnamese SARS cases and 103 healthy controls who had contact with SARS patients and 50 controls without contact with SARS patients. The results of this study showed that there were no significant differences in DD incidence between the groups. In short, it was found that this polymorphism was not associated with the risk of SARS-CoV infection. Although no association was found between the ACE I/D polymorphism and SARS-CoV infection, the frequency of the D allele was significantly higher in hypoxemic patients than in nonhypoxemic patients. Thus, the D allele was found to contribute to the progression of pneumonia in SARS.24
Similarly, in another study conducted on Caucasians, no differences in DD frequencies were found between COVID-19 patients and healthy controls. It was concluded that there was no association between this polymorphism and the risk of developing COVID-19 symptoms. In addition, males were found to be at significantly higher risk for a severe form of COVID-19. Importantly, the DD genotype was associated with the risk of developing hypertension in male patients. It was suggested that the deleterious effect of the ACE polymorphism on COVID-19 was most likely due to its association with hypertension.7
In contrast to the study by Gómez et al.7 this particular study included asymptomatic patients. The frequency of D/D genotype was found significantly higher in COVID-19 patients compared with the control group. Individuals with the D allele had a 1.3 fold increased risk of developing COVID-19 (Table 1). In addition, individuals with ACE I/I were found at increased risk of developing symptomatic COVID-19. In addition, findings in the chest radiograph were observed more frequently in individuals with the DD genotype compared to individuals with the ID and II genotypes.
Furthermore, the study conducted by Hubacek et al.21 in the Czech population investigated the association between the ACE I/D polymorphism and COVID-19 in 408 SARS-CoV-2-positive COVID-19 patients (163 asymptomatic and 245 symptomatic) and compared them with a population-based DNA bank of 2.559 subjects. The results of the study showed that the frequency of ACE I/I homozygotes was significantly higher in COVID-19 patients, especially in symptomatic COVID-19 patients compared to controls
In addition, Jacobs et al.25 demonstrated the association between the ACE I/D polymorphism and the infectivity and pathogenicity of SARS-Cov-2 virus. It was pointed out that individuals with I/I genotype have elevated ACE2 protein levels in the lung epithelium, which may facilitate virus entry into the host organism.
A different study reported that ACE DD genotype may be associated with susceptibility to COVID-19 in the elderly population.1 It has been suggested that levels of ACE or the Del/Del polymorphism should be studied as predictive biomarkers of COVID-19 severity, as is already the case in ARDS patients.
Importantly, the increased mortality in patients may also be attributed to the increased incidence of some comorbidities such as coronary artery disease, hypertension, diabetes mellitus, and dyslipidemia in the presence of the D allele.7 In this particular study, a significant difference was found between the different genotypes in terms of gender, smoking/alcohol consumption and chronic diseases. Chronic diseases were more common in individuals with the ID genotype than in individuals with the II genotype. However, no statistical analysis was performed to investigate the association between comorbidities and COVID -19 severity. Thus, it is difficult to relate disease severity to comorbidities. Therefore, large-scale studies are needed to analyze the effect of comorbidities on COVID-19 severity.
Furthermore, the study conducted by Aladag et al.20 in Turkish population showed that severe pneumonia was more frequent in patients with the DI allele (31%) than in DD (8%) and II (0%) (p = 0.021). In addition, the association between mortality rate, time to discharge, hospitalization and ACE I/D polymorphism was investigated. However, no statistical difference was found between genotype groups. It was concluded that ID genotype of ACE I/D polymorphism was associated with infection rate, especially severe pneumonia.
In contrast, a meta-analysis was performed to investigate the association between the ACE I/D polymorphism and the severity of SARS-CoV-2 infection in hospitalized patients. The results of the study showed that individuals with ACE DD genotype were at higher risk for developing severe COVID-19 infection requiring hospitalization.26
Similar to the results of Aladag et al.,20 no significant association was found between participants’ genotypes and their hospitalization status in our study (Table 3). Mortality rate or deferral was not examined in this particular study. Instead, the association between time of onset of symptoms for COVID-19, duration of treatment, recovery rate and participant genotype was examined. It was found that the time of onset of symptoms is shorter in individuals with DD genotype compare to individuals with II genotype (p < 0.05). In addition, duration of treatment was found longer in participants with DD genotype (p < 0.05). However there was no association found between the recovery rate and participants genotypes. In contrary to our findings, the results of an ecologic meta-regression analysis showed an association between ACE I/D polymorphism and recovery rate of COVID-19. It has been indicated that recovery rate was faster in individuals with I/D genotype.
Another study conducted in 84 adults (Germans of Caucasian descent) with acute respiratory distress syndrome ARDS found that the ACE I/D polymorphism was an independent prognostic marker for 30-day survival. Patients with a homozygous DD genotype were found to have a higher risk of death.27 On the other hand, a meta-analysis including 532 patients with acute lung injury (ALI)/ARDS, 3032 healthy controls, and 1432 patients without ALI/ARDS revealed that there is a possible association between ACE ID genotype and risk of death from ALI/ARDS in Asians.13
Although Delanghe et al.2 suggested that genetics plays a role in COVID-19 prevalence and mortality, it was found that only 40% of the total variance in mortality due to COVID-19 can be explained by the ACE I/D polymorphism. Other factors such as demographics, seasonality, local health organization must also be considered when analysing survival rates in COVID-19 infection.
In a study, the Allele Frequency Database (ALFRED) was reviewed to determine the frequency of the ACE I/D polymorphism (rs4646994) in a total of 349 global population samples. The frequency of the ACE D allele was observed higher in European, Asian and African cohorts. The presence of the ACE DD polymorphism with COVID-19 infection was found to increase ACE/Ang- II activity, affecting the severity of COVID-19 morbidities and disease outcomes. It was highlighted that the ethnic prevalence of ACE DD polymorphism could explain the severity of COVID-19 and elucidate the use of Angiotensin-Converting Enzyme Inhibitors/Angiotensin Receptor Blockers (ACE-I/ARBs) to improve outcomes.9, 28
Dysregulation of the RAAS due to increased levels of ACE may serve as an explanation for the increased susceptibility of the elderly to COVID-19, as the ACE DD polymorphism is particularly prominent in the elderly.1
While several studies have been conducted in the literature to understand the role of the ACE I/D polymorphism in some comorbidities such as hypertension and diabetes, not as many studies have been conducted to investigate the association between the ACE I/D (rs4646994) polymorphism and COVID-19. It has been suggested that allele frequencies in different regions could explain the different incidence and mortality rates of COVID-19.7
The ACE I/D polymorphism is associated with an increase in the number of cases and unfavorable clinical outcomes in patients with SARS-CoV-2 infection. In this study, the II genotype of the ACE I/D polymorphism has been associated with symptomatic COVID-19 (Table 3). In addition, chest radiographic findings were frequently noted in patients with DD genotype. It was also found that symptoms appeared earlier in individuals with the DD genotype than in individuals with the II genotype. Moreover, this study found that the duration of treatment was longer in individuals with the DD genotype. The results of this study suggest that genotyping for the ACE I/D polymorphism could be used to determine disease risk and severity to improve prognosis and treatment.
To the best of our knowledge, there are not many studies that have investigated the ACE I/D polymorphism in COVID-19 patients that include wet-lab data. Because not much is known about the genetic basis of COVID-19, analysis of genetic polymorphisms provides important information. In particular, to explain personal variations in COVID-19 pathogenesis, further studies should be planned to analyze the association between COVID-19 and other genes involved in the etiology of COVID-19 in different ethnicities and populations.
Conclusion
In conclusion, ACE I/D polymorphism has potential to predict the severity of COVID-19 in Northern Cyprus. Genotype II of ACE I/D polymorphism is associated with symptomatic COVID-19. Chest radiographic findings were observed more frequently in individuals with the genotype DD compared to individuals with the genotypes ID and II. The time of onset of COVID-19 was found shorter in individuals with the genotype DD than in individuals with the genotype II, while the duration of treatment was found longer. Further studies should be planned to analyze the association between ACE I/D and COVID-19 and other gene polymorphisms involved in the etiology of COVID-19 in different ethnicities and populations.
Authors’ contribution
Conceived and designed the analysis: H.C., M.C.E.; Collected the data: H.C., E.U.E., H.E., K.S., O.B., M.C.E.; Contributed data or analysis tools: H.C., E.U.E., H.E., K.S., O.B., M.C.E; Performed the analysis: H.C., M.C.E.; Wrote the paper: H.C.; revised the paper: H.C., E.U.E., H.E., K.S., O.B., M.C.E.; supervised the project: M.C.E.
Data availability statement
The data is available upon request.
Ethical consideration
The study protocol was approved by the Near East University ethics committee (application no NEU/2021/90-1342). Informed consent was obtained from all individuals included in this study.
Funding
There is no funding for this study.
Conflict of interest
The authors do not have any conflict of interest to declare.
References
- 1.Bellone M., Calvisi S.L. ACE polymorphisms and COVID-19-related mortality in Europe. J Mol Med (Berl) 2020;98:1505–1509. doi: 10.1007/s00109-020-01981-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Delanghe J.R., Speeckaert M.M., De Buyzere M.L. ACE polymorphism and COVID-19 outcome. Endocrine. 2020;70:13–14. doi: 10.1007/s12020-020-02454-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Chiappelli F. CoViD-19 susceptibility. Bioinformation. 2020;16:501–504. doi: 10.6026/97320630016501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gao Y.D., Ding M., Dong X., Zhang J.J., Azkur A.K., Azkur D., et al. Risk factors for severe and critically ill COVID-19 patients: a review. Allergy. 2021;76:428–455. doi: 10.1111/all.14657. [DOI] [PubMed] [Google Scholar]
- 5.Khan A., Bashar A., Islam K. SARS-CoV-2 proteins exploit host's genetic and epigenetic mediators for the annexation of key host signaling pathways. Front Mol Biosci. 2021;7:598583. doi: 10.3389/fmolb.2020.598583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ovsyannikova I.G., Haralambieva I.H., Crooke S.N., Poland G.A., Kennedy R.B. The role of host genetics in the immune response to SARS-CoV-2 and COVID-19 susceptibility and severity. Immunol Rev. 2020;296:205–219. doi: 10.1111/imr.12897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gómez J., Albaiceta G.M., García-Clemente M., López-Larrea C., Amado-Rodríguez L., Lopez-Alonso I., et al. Angiotensin-converting enzymes (ACE, ACE2) gene variants and COVID-19 outcome. Gene. 2020;762:145102. doi: 10.1016/j.gene.2020.145102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hoffmann M., Kleine-Weber H., Schroeder S., Krüger N., Herrler T., Erichsen S., et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 2020;181:271–280.e8. doi: 10.1016/j.cell.2020.02.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Sarangarajan R., Winn R., Kiebish M.A., Bountra C., Granger E., Narain N.R. Ethnic prevalence of angiotensin-converting enzyme deletion (D) polymorphism and COVID-19 risk: rationale for use of angiotensin-converting enzyme inhibitors/angiotensin receptor blockers. J Rac Ethn Health Disparit. 2021;8:973–980. doi: 10.1007/s40615-020-00853-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Nouryazdan N., Adibhesami G., Birjandi M., Heydari R., Yalameha B., Shahsavari G. Study of angiotensin-converting enzyme insertion/deletion polymorphism, enzyme activity and oxidized low density lipoprotein in Western Iranians with atherosclerosis: a case–control study. BMC Cardiovasc Disord. 2019;19:184. doi: 10.1186/s12872-019-1158-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Annoni F., Orbegozo D., Rahmania L., Irazabal M., Mendoza M., De Backer D., et al. Angiotensin-converting enzymes in acute respiratory distress syndrome. Intensive Care Med. 2019;45:1159–1160. doi: 10.1007/s00134-019-05600-6. [DOI] [PubMed] [Google Scholar]
- 12.Gemmati D., Tisato V. Genetic hypothesis and pharmacogenetics side of renin–angiotensin-system in COVID-19. Genes (Basel) 2020;11:1044. doi: 10.3390/genes11091044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Matsuda A., Kishi T., Jacob A., Aziz M., Wang P. Association between insertion/deletion polymorphism in angiotensin-converting enzyme gene and acute lung injury/acute respiratory distress syndrome: a meta-analysis. BMC Med Genet. 2012;13:76. doi: 10.1186/1471-2350-13-76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Simsek S., Tekes S., Turkyilmaz A., Tuzcu A.K., Kılıc F., Culcu N.N., et al. Angiotensin-converting enzyme gene insertion/deletion polymorphism with metabolic syndrome in Turkish patients. J Endocrinol Invest. 2013;36:860–863. doi: 10.3275/8967. [DOI] [PubMed] [Google Scholar]
- 15.Hemeed R.N., Al-Tu’ma F.J., Al-Koofee D.A.F., Al-Mayali A.H. Relationship of angiotensin converting enzyme (I/D) polymorphism (rs4646994) and coronary heart disease among a male Iraqi population with type 2 diabetes mellitus. J Diabetes Metab Disord. 2020;19:1227–1232. doi: 10.1007/s40200-020-00632-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Mazaheri H., Saadat M. Association between insertion/deletion polymorphism in angiotension converting enzyme and susceptibility to schizophrenia. Iran J Public Health. 2015;44:369–373. [PMC free article] [PubMed] [Google Scholar]
- 17.Woods D.R., Humphries S.E., Montgomery H.E. The ACE I/D polymorphism and human physical performance. Trends Endocrinol Metab. 2000;11:416–420. doi: 10.1016/s1043-2760(00)00310-6. [DOI] [PubMed] [Google Scholar]
- 18.Cambien F., Poirier O., Lecerf L., Evans A., Cambou J.P., Arveiler D., et al. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641–644. doi: 10.1038/359641a0. [DOI] [PubMed] [Google Scholar]
- 19.Yan R., Zhang Y., Li Y., Xia L., Guo Y., Zhou Q. Structural basis for the recognition of SARS-CoV-2 by full-length human ACE2. Science. 2020;367:1444–1448. doi: 10.1126/science.abb2762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Aladag E., Tas Z., Ozdemir B.S., Akbaba T.H., Akpınar M.G., Goker H., et al. Human Ace D/I polymorphism could affect the clinicobiological course of COVID-19. J Renin Angiotensin Aldosterone Syst. 2021;2021:5509280. doi: 10.1155/2021/5509280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Hubacek J.A., Dusek L., Majek O., Adamek V., Cervinkova T., Dlouha D., et al. ACE I/D polymorphism in Czech first-wave SARS-CoV-2-positive survivors. Clin Chim Acta. 2021;519:206–209. doi: 10.1016/j.cca.2021.04.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Salem A.H., Batzer M.A. High frequency of the D allele of the angiotensin-converting enzyme gene in Arabic populations. BMC Res Notes. 2009;2:99. doi: 10.1186/1756-0500-2-99. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Verma S., Abbas M., Verma S., Khan F.H., Raza S.T., Siddiqi Z., et al. Impact of I/D polymorphism of angiotensin-converting enzyme 1 (ACE1) gene on the severity of COVID-19 patients. Infect Genet Evol. 2021;91:104801. doi: 10.1016/j.meegid.2021.104801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Itoyama S., Keicho N., Hijikata M., Quy T., Phi N.C., Long H.T., et al. Identification of an alternative 5′-untranslated exon and new polymorphisms of angiotensin-converting enzyme 2 gene: lack of association with SARS in the Vietnamese population. Am J Med Genet A. 2005;136:52–57. doi: 10.1002/ajmg.a.30779. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Jacobs M., Lahousse L., Van Eeckhoutte H.P., Wijnant S.R.A., Delanghe J.R., Brusselle G.G., et al. Effect of ACE1 polymorphism rs1799752 on protein levels of ACE2, the SARS-CoV-2 entry receptor, in alveolar lung epithelium. ERJ Open Res. 2021;7:00940–2020. doi: 10.1183/23120541.00940-2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Oscanoa T.J., Vidal X., Coto E., Romero-ortuno R. ACE gene I/D polymorphism and severity of SARS-CoV-2 infection in hospitalized patients: a meta-analysis. Arterial Hypertension. 2021;25:112–118. [Google Scholar]
- 27.Adamzik M., Frey U., Sixt S., Knemeyer L., Beiderlinden M., Peters J., et al. ACE I/D but not AGT (-6)A/G polymorphism is a risk factor for mortality in ARDS. Eur Respir J. 2007;29:482–488. doi: 10.1183/09031936.00046106. [DOI] [PubMed] [Google Scholar]
- 28.Albini A., Di Guardo G., Noonan D.M., Lombardo M. The SARS-CoV-2 receptor, ACE-2, is expressed on many different cell types: implications for ACE-inhibitor- and angiotensin II receptor blocker-based cardiovascular therapies. Intern Emerg Med. 2020;15:759–766. doi: 10.1007/s11739-020-02364-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data is available upon request.