Skip to main content
NCBI home page
Journal of Advanced Veterinary and Animal Research logoLink to Journal of Advanced Veterinary and Animal Research
. 2022 Nov 19;9(4):601–609. doi: 10.5455/javar.2022.i629

Multidrug-resistant Staphylococcus aureus isolated from chicken nuggets sold at superstores in Mymensingh, Bangladesh

Qurra-Tul Ain 1, Mohammad Arif 1, Fateha Akther Ema 1, Most Shumi Akhter Shathi 1, Md Ariful Islam 1, Mst Minara Khatun 1
PMCID: PMC9868783  PMID: 36714519

Abstract

Objective:

This study was conducted to determine the colony forming units (CFU) to isolate, identify, and antibiotic sensitivity of Staphylococcus aureus from chicken nuggets (CN).

Materials and Methods:

Sixty CN samples from two brands were collected from different superstores in Mymensingh, Bangladesh. Uncooked, oven-cooked (OC), or gas stove-cooked (GSC) CN samples were inoculated onto mannitol salt agar and blood agar.

Results:

The total staphylococcal count (TSC) for uncooked CN ranged from log 4.68 to log 5.11 CFU/gm. For OC CN, TSC ranged from log 3.29 to log 3.62 CFU/gm. For GSC CN, TSC ranged from log 3.09 to log 3.49 CFU/gm. Relative to uncooked CN, microwave oven-cooked and GSC samples significantly reduced the TSC of CN (p < 0.01). Using the polymerase chain reaction assay and standard biochemical testing, only 8 out of 60 CN samples contained S. aureus. Staphylococcus aureus were resistant to Ampicillin (100%), Amoxicillin (100%), Oxacillin (75%), Cefixime (87.5%), Doxycycline (75%), intermediately sensitive to Erythromycin (25%), Cephalexin (12.5%), Ciprofloxacin (25%), Gentamicin (12.5%), Doxycycline (12.5%) and sensitive to Oxacillin (25%), Azithromycin (100%), Erythromycin (75%) Cephalexin (87.5%), Cefixime (12.5%), Chloramphenicol (100%), Ciprofloxacin (75%), Gentamicin (87.5%), Doxycycline (12.5%), and Vancomycin (100%).

Conclusion:

This study reports the first isolation and identification of S. aureus from CN in Bangladesh. GSC CN was better than OC and uncooked CN. Data also suggest that CN is contaminated with multidrug-resistant S. aureus, which poses a public health hazard.

Keywords: Multidrug-resistant, Staphylococcus aureus, chicken nugget, antibiotic sensitivity, Mymensingh

Introduction

Antimicrobials are widely used in the livestock sector, where most of the time they are applied sub-therapeutically for growth promotion and routine disease prevention [1]. This practice contributes to the production and spread of multidrug-resistant (MDR) bacteria. Food that can be prepared and served very quickly or sold in a restaurant or store using preheated or precooked ingredients is known as fast food [2]. Bangladesh’s upper and middle classes are quickly finding that fast food is a tasty and easy way to get food. People who live in towns are more likely to consume fast food than those who live in rural areas. The busy and hectic life schedules of urban people encourage them to consume various fast foods in their diet [3] as they have less time to make food at home [2]. KFC, McDonald’s, Pizza Hut, Shawarma House, and Domino’s Pizza are well-known fast-food sellers of pizza, burgers, soups, fried chicken, chicken fingers, and chicken nuggets (CN), the most popular fast foods in Bangladesh.

CN are one of the most popular fast foods enjoyed by people of all ages due to their excellent nutritional content and delicious taste. A CN contains valuable nutritional ingredients like fat, protein, vitamins, and minerals. The CN is made of slurry chicken breasts that can be shaped and breaded or battered, and after mixing with egg white and bread crumbs, they are deep fried or baked. Unfortunately, Staphylococcus aureus can potentially exist and thrive in the CN due to the unfortunate short heat processing time (approximately 4 min). Furthermore, unsanitary preparation, handling, and packaging practices can easily contaminate CN [4,5]. Food contamination with microorganisms can shorten the shelf life of food and put people’s health at risk by exposing them to food-borne infections and poisonings [6,7]. It can also hurt the economy because food spoils.

Staphylococcal food poisoning (SFP) is happening too often around the world as a very common food-borne disease with the highest occurrence next to salmonellosis [8]. Staphylococcus aureus is an important food-borne pathogen that causes everything from minor skin infections to serious conditions like pneumonia and septicemia [9]. Staphylococcus aureus is mainly found on the skin, in sores, infected eyes, and in the nose, throat, saliva, and fecal matter of humans. Food contaminated with S. aureus or its toxins can cause food poisoning. The contamination may occur from faulty preservation methods, unhygienic handling practices, cross-contamination from food handling instruments, or people carrying S. aureus in their nares and on their skin [10,11]. SFP can cause many of the same symptoms as other foodborne illnesses, including nausea, abdominal cramps, vomiting, or diarrhea [12]. Staphylococcus aureus causes infections like bacteremia, pneumonia, myocarditis, osteomyelitis, acute endocarditis, pericarditis, encephalitis, meningitis, mastitis, and scalded skin syndrome [13].

Antimicrobial resistance (AMR) poses a significant risk to public health worldwide and has emerged as a substantial clinical practice and healthcare [14]. AMR is caused by the misuse and overuse of antibiotics, which has led to the evolution of antibiotic-resistant bacteria and genes in all types of animal farming environments in Bangladesh. These predisposing factors include insufficient veterinary healthcare, monitoring, and regulatory services; intervention from numerous informal animal health service providers; and farmers’ lack of knowledge regarding drugs. MDR bacteria with extreme resistance against antibiotics recommended for use in animals and humans have been reported to be a potential public health hazard in Bangladesh [15]. Many of the S. aureus isolates are found to be resistant to a variety of antibiotics, and due to the emergence of these multidrug-resistant bacterial strains, public health is facing a great significant issue. Methicillin-resistant S. aureus (MRSA) and vancomycin-resistant S. aureus (VRSA) are examples of common types of drug-resistant Staphylococcus. Humans can contract resistant bacteria from animals by consuming animal products like milk, meat, eggs, etc., through direct or close contact with them, or by being exposed to unsanitary environments [16]. Based on the information above, this study was done to estimate the total amount of Staphylococcus in CN, isolate and identify S. aureus from CN, and figure out how susceptible the isolated strains are to antibiotics.

Materials and Methods

Collection and processing of samples

For bacteriological analysis, 60 CN samples from brands, such as Brand 1 = 30 CN and Brand 2 = 30 CN were purchased from different superstores in Mymensingh, Bangladesh. CN samples were placed in an ice box and immediately transported to the laboratory of the Department of Microbiology and Hygiene, Bangladesh Agricultural University (BAU), Mymensingh, and evaluated within an h of collection. Before bacteriological analysis, CN samples were divided into three categories:

(i) Uncooked CN (n = 20)—taken from the packet directly as it is produced.

(ii) Oven-cooked (OC) CN (n = 20)—it was treated at 250°C for 3 min (800 w) in an oven at the central lab.

(iii) Gas stove-cooked (GSC) CN (n = 20)—it was treated with oil at medium-high heat (230°C ) for 5–10 min.

All three types of samples were uniformly homogenized using sterile Phosphate-buffer solution (PBS) in a sterilized mortar and pestle as per the recommendation of ISO [17] by placing a 10-gm sample of each CN into 90 ml PBS. Later on using the vortex mixture machine (VM-2000, Digisystem Laboratory Instruments Inc, Taiwan), 10-fold serial dilutions followed ranging from 10−2 to 10−5 and were cultured by the standard plating method of ISO [17].

Enumeration of total Staphylococcal count (TSC)

About 0.2 ml from each 10-fold serial dilution was transferred and immediately spread on mannitol salt agar (MSA) and incubated at 37°C for 24 h. After incubation, plates containing 30–300 colonies were counted. The TSC was calculated according to standard protocol [17]. The number of colony forming units (CFU) per gram of CN samples was used to express the results of the TSC.

Isolation and identification of Staphylococcus spp.

Following Ceesbrough’s recommended procedure [18,19], bacteria were isolated and identified. Samples were inoculated into the nutrient broth and incubated at 37°C for 24 h. The overnight enriched culture was streaked in duplicate plates onto MSA and blood agar (BA). The inoculated plates were incubated at 37°C for 24 h. One colony was subcultured repeatedly until the pure culture was produced. The identification of bacteria was performed based on colony morphology such as size, shape, color, and texture, Gram’s staining reaction, hemolysis test, and biochemical tests like sugar fermentation test (dextrose, maltose, lactose, sucrose, and mannitol), methyl red (MR), Voges–Prauskauer (VP) tests, and catalase and coagulase tests as described by Cheesbrough [19].

Confirmation of S. aureus by polymerase chain reaction (PCR)

By utilizing a boiling process to lyse the bacterium, template DNA was created [20]. The staphylococcal enterotoxin A (sea) gene, the staphylococcal nuc gene, and the 16S rRNA gene of Staphylococcus spp. were all identified by PCR using three sets of primers (Table 1) to specifically identify S. aureus strains that produce enterotoxins. Genus-specific PCR reactions for the detection of Staphylococcus spp. were performed using a thermocycler with the following program: 1 cycle of initial denaturation at 94°C for 5 min, 35 cycles each consisting of denaturation with 94°C for 1 min, annealing at 68°C for 45 sec, extension at 72°C for 1 min, and a final extension step of 10 min at 72°C. On the other hand, molecular detection of enterotoxin-producing S. aureus was performed with 1 cycle of initial denaturation at 94°C for 5 min, 30 cycles each consisting of denaturation at 94°C for 2 min, annealing at 55°C for 2 min, extension at 72°C for 1 min, and a final extension step of 10 min at 72°C. In both cases, amplified PCR products were passed through electrophoresis in 1.5% agarose gel for 30 min at 100 volts, followed by staining with ethidium bromide and finally visualized under a UV trans-illuminator.

Table 1. List of oligonucleotide primers used in this study.

Primer Sequence (5’ to 3’) Size (bp) References
Staphylococcus sp. 16S F- GGAGGAAGGTGGGGATGACG 241 [21]
R- ATGGTGTGACGGGCGGTGTG
S. aureus nuc F- GCGATTGATGGTGATACGGTD 279 [22]
R- AGCCAAGCCTTGACGAACTAA AGC
Staphylococcus sp. sea F- TTGGAAACGGTTAAAACGAA 120 [23]
R- GAACCTTCCCATCAAAAACA
Open in a new tab

Antibiotic sensitivity assay

Antibiotic sensitivity tests were conducted against all Staphylococcus spp. isolates to determine their pattern of bacterial resistance. According to the recommendations of the Clinical and Laboratory Standard Institute [24], all isolates were tested using the disc diffusion method against 12 different commonly used antibiotics (Amoxicillin, Ciprofloxacin, Erythromycin, Azithromycin, Chloramphenicol, Ampicillin, Gentamicin, Doxycycline, Cefixime, Cephalexin, Oxacillin, and Vancomycin). The diameter of the zone of inhibition was measured, and the results were compared with the values from the National Committee on Clinical and Laboratory Standards for interpretation. Staphylococcus isolates were then classified as resistant, intermediate, or sensitive against a particular antibiotic. Isolates that are non-susceptible to at least one antimicrobial agent in three or more antimicrobial classes were recorded as MDR phenotype [25].

Statistical analysis of experimental data

The data of TSC of CN samples were analyzed for statistical significance using p-value and Duncan’s multiple range test. Data were analyzed by Statistical Package for the Social Sciences (SPSS) version 11.5 (SPSS Inc., Chicago, IL).

Results and Discussion

Total staphylococcal count of CN

Staphylococcus aureus is one of the leading etiologic agents of food poisoning causing human gastrointestinal illness [26]. Staphylococcus causes various pathological conditions like bacteremia, urinary system infections, systemic diseases, and osteomyelitis in humans and animals [27]. In most cases, bacterial food poisoning results from the toxin produced by S. aureus [28]. Most individuals and animals have Staphylococcus spp. on their skin and noses, which can contaminate food when handled by people who do not practice good hygiene. Bacterial growth is accompanied by the generation of toxins in food if Staphylococcus spp. contaminates the food. Although the pathogen is killed by cooking, the heat-stable toxins are not destroyed and will still be able to cause illness. Foods like sliced meats, pastries, puddings, fast food, and sandwiches become very risky for consumers if they get contaminated with Staphylococcus spp. because these foods are not cooked after handling.

In this study, out of 60 CN samples, 8 were found positive for S. aureus, and 52 were found positive for other Staphylococcus spp. The TSC from two different places is presented in Figure 1.

Figure 1. TSC of CN. Results are expressed as mean log CFU/gm. In uncooked CN, OC CN, and GSC CN, the mean log CFU/gm of TSC from brand-1 samples was 4.92, 3.45, and 3.31, respectively. Similarly, the TSC values from the brand-2 chicken nugget samples were 4.93, 3.46, and 3.30, respectively.

Figure 1.

Open in a new tab

Samples were cultured on MSA to determine the TSC. The mean ± SD value (CFU ± SD/gm) of TSC from brand-1 samples were 4.92 ± 0.168, 3.45 ± 0.133, and 3.31 ± 0.163 in uncooked CN, OC CN, and GSC CN, respectively. Similarly, the TSC values were found as 4.93 ± 0.133, 3.46 ± 0.126, and 3.30 ± 0.123 respectively from the CN samples of brand-2. These results are nearly similar to the findings of Wimalasekara and Gunasena [29] who had found 104 CFU/gm in meat-based fast-food samples in Colombo, Sri Lanka. Similarly, recent findings are in strong agreement with the research findings of total TSC from street-vended fast food in Bangladesh conducted by Hoque et al. [30], Adimasu et al. [31], and Sabuj et al. [32]. Akhi et al. [33] found 68% (17/25) of S. aureus from chicken meat samples.

From the findings of this study, it is clear that the highest Staphylococcal count was obtained from the uncooked CN samples of both brands which may lead to possible health hazards through the production of a significant amount of enterotoxin within a very short time [30]. The mean log CFU of GSC CN is lowest and OC CN is lower compared to uncooked CN which is statistically significant (p < 0.001), (significant at 1% level of probability, p < 0.01). Hence it can be concluded that heat treatment with a gas stove can decrease the Staphylococcal CFU/gm from the CN by 10-fold.

Staphylococcus spp. in CN samples suggests potential contamination from the food workers’ mouths, eyes, noses, or other skin-contact areas [32]. Tambekar et al. [34] stated that food contamination might be more likely if sellers have contaminated hands and lack knowledge of personal hygiene, hygiene procedures, and food safety.

Identification of bacteria

Different tests were used to identify Staphylococcus spp. from the CN samples. The results of cultural characteristics, Gram stain, biochemical tests, and molecular identification by genus and staphylococcal enterotoxin A (sea) gene-specific PCR identified the microorganisms were similar to previous research findings [34,35].

Hemolytic characteristics

On 5% of sheep BA, S. aureus produces β-hemolysis, similar to the findings of Jahan et al. [36]. Among 60 CN samples, only 8 exhibited β-hemolysis, and the remaining 52 samples grew as bright white colonies on BA without any hemolysis.

In this study, out of 60 CN samples, 8 were found positive for S. aureus, and 52 were found positive for other staphylococci. In the case of brand-1, out of 10 uncooked CN samples, 4 were found positive for S. aureus. Out of 10 OC CN samples from brand-1, two were positive for S. aureus. In the case of brand 2, two out of 10 raw CN samples were found positive for S. aureus which was confirmed by cultural examination, biochemical test, and PCR. A summary of the isolation of S. aureus and other Staphylococci is presented in Figure 2.

Figure 2. Summary of isolation of S. aureus and Staphylococcus spp. from two different brands of CN. Out of 60 CN samples, 8 tested positive for S. aureus and 52 tested positive for other Staphylococci. In the case of brand-1, 4 of the 10 uncooked CN samples were confirmed to be S. aureus positive. 2 of the 10 OC CN samples from brand-1 were revealed to be S. aureus positive. For brand 2, two out of ten uncooked CN samples were found positive for S. aureus. Legend: CN-Chicken nugget.

Figure 2.

Open in a new tab

Gram stain characteristics

In Gram stain, the organism showed violet in color, Gram-positive, and cocci in shape and arranged in clusters resembling grapes under a light microscope; these characteristics were identical to those mentioned by Ema et al. [37].

Biochemical profile

In the coagulase test, S. aureus converts rabbit fibrinogen to fibrin and clotting occurs. Out of 60 samples, 8 samples showed a positive coagulase test, and 52 samples were found negative in the coagulase test. All the tested isolates fermented dextrose, maltose, lactose, sucrose, and mannitol and produced only acid. Acid production was indicated by the color change from reddish to yellowish. All isolates were positive in catalase and MR-VP tests and were found negative in the indole production test.

Molecular detection of S. aureus by PCR

The identification of Staphylococcus spp. and S. aureus was validated molecularly by the 16S rRNA and nuc gene-based PCR technique by amplifying 241 bp and 279 bp fragments of DNA. The results of PCR are displayed in Figures 3 and 4. These results concur with those of Khandoker et al. [35].

Figure 3. Identification of Staphylococcus spp. by amplification of 16S rRNA gene by PCR. Lane M: 1kb DNA ladder; Lane 1-5: DNA of bacteria isolated from chicken nugget; Lane 6: Positive control; Lane 7: Negative control.

Figure 3.

Open in a new tab

Figure 4. Identification of S. aureus by amplification of nuc gene by PCR. Lane M: 1kb DNA ladder; Lane 1–5: DNA of bacteria isolated from chicken nugget; Lane 6: Positive control; Lane 7: Negative control.

Figure 4.

Open in a new tab

PCR by sea gene-specific primer

None of the isolates were found positive for the sea gene suggesting that they do not produce enterotoxin (picture not shown).

Results of antibiotic sensitivity assay

Eight isolates of S. aureus were tested against 12 antibiotics using disk diffusion methods. Among them, Ampicillin (100%) and Amoxicillin (100%) showed the highest resistant pattern followed by Cefixime (87.5%), Oxacillin (75%), and Doxycycline (75%). The highest sensitivity pattern was observed for Azithromycin (100%), Vancomycin (100%), and Chloramphenicol (100%) followed by Cephalexin (87.5%), Gentamicin (87.5%), Erythromycin (75%), Ciprofloxacin (75%), Oxacillin (25%), Cefixime (12.5%), and Doxycycline (12.5%), and intermediately sensitive to Erythromycin (25%), Ciprofloxacin (25%), Cephalexin (12.5%), Gentamicin (12.5%) and Doxycycline (12.5%). The results of the antibiotic sensitivity assay are shown in (Table 2 and Fig. 5).

Table 2. Antibiogram profile of S. aureus.

Antimicrobial class Antimicrobial agents No. of isolates (%)
Resistant Intermediate Sensitive
Penicillins Ampicillin (AMP)
Amoxicillin (AMX)
Oxacillin (OX)		 8 (100%) 0 (0.0%) 0 (0.0%)
8 (100%) 0 (0.0%) 0 (0.0%)
6 (75.0%) 0 (0.0%) 2 (25.0%)
Macrolide Azithromycin (AZM)
Erythromycin (E)		 0 (0.0%) 0 (0.0%) 8 (100%)
0 (0.0%) 2 (25.0%) 6 (75.0%)
Cephalosporin Cefalexin (CN)
Cefixime (CFM)		 0 (0.0%) 1 (12.5%) 7 (87.5%)
7 (87.5%) 0 (0.0%) 1 (12.50%)
Chloramphenicol Chloramphenicol (C) 0 (0.0%) 0 (0.0%) 8 (100%)
Fluoroquinolone Ciprofloxacin(CIP) 0 (0.0%) 2 (25.0%) 6 (75.0%)
Aminoglycoside Gentamicin (GEN) 0 (0.0%) 1 (12.5%) 7 (87.5%)
Tetracyclines Doxycycline (DO) 6 (75.0%) 1 (12.5%) 1 (12.5%)
Glycopeptide Vancomycin(VAN) 0 (0.0%) 0 (0.0%) 8 (100%)
Open in a new tab

Figure 5. Summary of antibiogram profile of S. aureus against 12 antibiotics. Staphylococcus aureus were resistant to Ampicillin (100%), Amoxicillin (100%), Cefixime (87.5%), Doxycycline (75%), and Oxacillin (75%); intermediately sensitive to Cephalexin (12.5%), Ciprofloxacin (25%), Gentamicin (12.5%), Doxycycline (12.5%), and Erythromycin (25%); and sensitive to Azithromycin (100%), Cephalexin (87.5%), Chloramphenicol (100%), Ciprofloxacin (75%), Gentamicin (87.5%), Cefixime (12.5%), Doxycycline (12.5%), Erythromycin (75%), Oxacillin (25%), and Vancomycin (100%).

Figure 5.

Open in a new tab

These study findings agree with the previous study conducted by Ema et al. [37], Sultana et al. [38], Martins et al. [39], Singh et al. [40], Tagoe et al. [41], Pyzik and Marek [42], Sharma and Mazumdar [43], and Pekana and Green [44]. They found the highest resistance rate for Amoxicillin, Ampicillin, and Tetracycline against S. aureus. Sabuj et al. [32] reported that all the isolated Staphylococcus spp. from street-vended fast foods in Mymensingh demonstrated sensitivity to Ciprofloxacin, Gentamycin, Azithromycin, and Chloramphenicol which is identical to our present research findings. Staphylococcus spp. was reported as Vancomycin-resistant by Kalantari et al. [45], Yurdakul et al. [46], Tabashsum et al. [47], Eromo et al. [48]; in this study, the Staphylococcus was found sensitive to Vancomycin. One possible explanation is that Vancomycin is not widely used in Bangladesh. Parvin et al. [49] reported a significant incidence of MDR MRSA in frozen chicken flesh samples. The findings show that CN marketed in local markets is contaminated with MDR S. aureus, which could be a risk to public health and a potential cause of resistant Staphylococcal food-borne poisoning.

Conclusion

This is the first report on the isolation and identification of S. aureus from CN in Bangladesh. GSC CN reduced the TSC more than OC and uncooked CN. S. aureus from CN samples is considered a major foodborne pathogen causing severe gastroenteritis due to the production of heat-resistant enterotoxin in the human intestine. In addition, this study has also found that these CN samples are contaminated with MDR Staphylococcus spp. This is very alarming as the pathogen represents a public health hazard. The results of this study highlight the significance of enhancing hygienic practices for both consumers and handlers and raising public knowledge of sanitation at all stages of production, handling, transportation, and processing of CN to prevent the contamination and spread of resistant bacteria and also to prevent food-borne illness.

Acknowledgments

The author would like to acknowledge the Bangladesh Agricultural University Research System (BAURES, Project no. 2013/05/BAU) for funding this research work. The authors also like to acknowledge Dr. Stephen M. Boyle (USA) for their editorial comments.

List of Abbreviations

CFU, Colony forming unit; CN, Chicken nugget; GSC, Gas stove cooked; MDR, Multi drug resistant; OC, Oven cooked; PBS, Phosphate-buffer solution; PCR, polymerase chain reactions; TSC, Total staphylococcal count.

Conflict of interest

The authors declare no conflict of interest.

Authors’ contributions

QTA carried out the experiment and wrote the manuscript; MA analyzed the data and created the graph; FAE and MSAS edited the manuscript; MAI supervised and guided the experiment; and MMK designed the study and revised the manuscript.

References

  • [1].Gilchrist MJ, Greko C, Wallinga DB, Beran GW, Riley DG, Thorne PS. The potential role of concentrated animal feeding operations in infectious disease epidemics and antibiotic resistance. Environ Health Perspect. 2006;115(2):313–16. doi: 10.1289/ehp.8837. https://doi.org/10.1289/ehp.8837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Harun MA, Ahmed F, Maniruzzaman. Customer hospitality: the case of fast food industry in Bangladesh. World J Soc Sci. 2013;3(6):88–04. [Google Scholar]
  • [3].Easa SMH. Microorganisms found in fast and traditional fast food. J Am Sci. 2010;6(10):515–31. [Google Scholar]
  • [4].Isara AR, Isah EC, Lofor PVO, Ojide CK. Food contamination in fast food restaurants in Benin City, Edo State, Nigeria: implications for food hygiene and safety. Public Health. 2010;124(8):467–71. doi: 10.1016/j.puhe.2010.03.028. https://doi.org/10.1016/j.puhe.2010.03.028. [DOI] [PubMed] [Google Scholar]
  • [5].Noor R, Feroz F. Food safety in Bangladesh: a microbiological perspective. Stamford J Microbiol. 2016;6(1):1–6. https://doi.org/10.3329/sjm.v6i1.33509. [Google Scholar]
  • [6].Oliver SP, Jayarao BM, Almeida RA. Foodborne pathogens in milk and the dairy farm environment: food safety and public health implications. Foodborne Pathog Dis. 2005;2(2):115–29. doi: 10.1089/fpd.2005.2.115. https://doi.org/10.1089/fpd.2005.2.115. [DOI] [PubMed] [Google Scholar]
  • [7].Rawat S. Food spoilage: microorganisms and their prevention. Asian J Plant Sci Res. 2015;5(4):47–56. [Google Scholar]
  • [8].Argaw S, Addis M. A review on staphylococcal food poisoning. Food Sci Quality Manag. 2015;40:59–71. [Google Scholar]
  • [9].Lowy FD. Staphylococcus aureus infections. N Engl J Med. 1998;339(8):520–32. doi: 10.1056/NEJM199808203390806. https://doi.org/10.1056/NEJM199808203390806. [DOI] [PubMed] [Google Scholar]
  • [10].Barrie D. The provision of food and catering services in hospital. J Hosp Infect. 1996;33(1):13–33. doi: 10.1016/s0195-6701(96)90026-2. https://doi.org/10.1016/S0195-6701(96)90026-2. [DOI] [PubMed] [Google Scholar]
  • [11].Jay LS, Comar D, Govenlock LD. A video study of Australian domestic food handling practices. J Food Prot. 1999;62(11):1285–96. doi: 10.4315/0362-028x-62.11.1285. https://doi.org/10.4315/0362-028X-62.11.1285. [DOI] [PubMed] [Google Scholar]
  • [12].Kadariya J, Smith TC, Thapaliya D. Staphylococcus aureus and staphylococcal food-borne disease: an ongoing challenge in public health. Biomed Res Int. 2014;2014;827965 doi: 10.1155/2014/827965. https://doi.org/10.1155/2014/827965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Karmakar A, Dua P, Ghosh C. Biochemical and molecular analysis of Staphylococcus aureus clinical isolates from hospitalized patients. Can J Infect Dis Med Microbiol. 2016;2016;9041636 doi: 10.1155/2016/9041636. https://doi.org/10.1155/2016/9041636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].World Health Organization (WHO) Antimicrobial resistance factsheet. [ June 01; 2022 ]. viewed 23 October 2016. Available via https://www.who.int/mediacentre/factsheets/fs194/en/
  • [15].Al Amin M, Hoque MN, Siddiki AZ, Saha S, Kamal MM. Antimicrobial resistance situation in animal health of Bangladesh. Vet World. 2020;13(12):2713–27. doi: 10.14202/vetworld.2020.2713-2727. https://doi.org/10.14202/vetworld.2020.2713-2727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Schneider K, Garrett L. Washington, DC: Center for Global Development; 2009. Non-therapeutic use of antibiotics in animal agriculture, corresponding resistance rates, and what can be done about it; p. 6. [Google Scholar]
  • [17].ISO. The Netherlands: ISO; 1995. Recommendation of the meeting of the subcommittee, International Organization for Standardization, on meat and meat products. ISO/TC-36/Sc-6; pp. 10–18. [Google Scholar]
  • [18].Cheesbrough M. 1st. London, UK: Microbiology, English Language Book Society; 1985. Medical laboratory manual for tropical countries; pp. 400–80. [Google Scholar]
  • [19].Cheesbrough M. 2nd. New York, NY: Cambridge University Press; 2006. District laboratory practice in tropical countries; pp. 45–62. https://doi.org/10.1017/CBO9780511543470. [Google Scholar]
  • [20].Englen MD, Kelley LC. A rapid DNA isolation procedure for the identification of Campylobacter jejuni by the polymerase chain reaction. Lett Appl Microbiol. 2000;31(6):421–26. doi: 10.1046/j.1365-2672.2000.00841.x. https://doi.org/10.1046/j.1365-2672.2000.00841.x. [DOI] [PubMed] [Google Scholar]
  • [21].Stuhlmeier R, Stuhlmeier KM. Fast, simultaneous and sensitive detection of staphylococci. J Clin Pathol. 2003;56(10):782–85. doi: 10.1136/jcp.56.10.782. https://doi.org/10.1136/jcp.56.10.782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Kalorey DR, Shanmugam Y, Kurkure NV, Chousalkar KK, Barbuddhe SB. PCR-based detection of genes encoding virulence determinants in S. aureus from bovine subclinical mastitis cases. J Vet Sci. 2007;81:51–154. doi: 10.4142/jvs.2007.8.2.151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol. 1991;29(3):426–30. doi: 10.1128/jcm.29.3.426-430.1991. https://doi.org/10.1128/jcm.29.3.426-430.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Clinical and Labratory Standards Institute (CLSI, formerly NCCLS) 22nd informational supplement document M100-S22. Vol. 32. Wayne, Philadelphia, PA: 2016. Performance standards for antimicrobial susceptibility testing; pp. 3pp. 34–53. [Google Scholar]
  • [25].Sweeney MT, Lubbers BV, Schwarz S, Watts JL. Applying definitions for multidrug resistance, extensive drug resistance and pandrug resistance to clinically significant livestock and companion animal bacterial pathogens. J Antimicrob Chemother. 2018;73(6):1460–63. doi: 10.1093/jac/dky043. https://doi.org/10.1093/jac/dky043. [DOI] [PubMed] [Google Scholar]
  • [26].Le Loir Y, Baron F, Gautier M. Staphylococcus aureus and food poisoning. Genet Mol Res. 2003;2(1):63–76. [PubMed] [Google Scholar]
  • [27].Hageman JC, Uyeki TM, Francis JS, Jernigan DB, Wheeler JG, Bridges CB, et al. Severe community-acquired pneumonia due to Staphylococcus aureus, 2003–04 influenza season. Emerg Infect Dis. 2006;12(6):894. doi: 10.3201/eid1206.051141. https://doi.org/10.3201/eid1206.051141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Hennekinne JA, De Buyser ML, Dragacci S. Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol Rev. 2012;36(4):815–36. doi: 10.1111/j.1574-6976.2011.00311.x. https://doi.org/10.1111/j.1574-6976.2011.00311.x. [DOI] [PubMed] [Google Scholar]
  • [29].Wimalasekara SGMRL, Gunasena GDDK. Microbiological quality of ready-to-eat meat based food available in temporary food outlets in gall face green, Colombo, Srilanka. Int J Agric For Plantation. 2016;4:39–44. [Google Scholar]
  • [30].Hoque N, Kabir SML, Rahman MM, Khan MSR. Microbial quality of selected sandwiches sold at retail outlets of fast food shops in Dhaka city and Mymensingh town of Bangladesh. Sci J Microbiol. 2012;1(5):101–12. [Google Scholar]
  • [31].Adimasu A, Mekonnen B, Guadu T, Gizaw Z, Adane T. Bacteriological quality assessment of selected street foods and their public health importance in Gondar Town, North West Ethiopia. Glob Vet. 2016;17(3):255–64. [Google Scholar]
  • [32].Sabuj AAM, Haque ZF, Barua N, Islam MA, Saha S. Assessment of bacteriological quality of street vended fast foods and their antimicrobial resistance. Int J Curr Microbiol Appl Sci. 2018;7(11):3049–59. https://doi.org/10.20546/ijcmas.2018.711.350. [Google Scholar]
  • [33].Akhi MA, Das NC, Banik A, Abony M, Juthi M, Uddin ME. Detection of drug-resistant S. aureus from poultry samples collected from different areas of Bangladesh. Microbiol Res J Int. 2019;19:1–10. https://doi.org/10.9734/mrji/2019/v29i130154 . [Google Scholar]
  • [34].Tambekar DH, Jaiswal VJ, Dhanorkar DV, Gulhane PB, Dudhane MN. Microbial quality and safety of street vended fruit juices: a case study of Amravati city. Int J Food Safety. 2009;10(7):72–6. [Google Scholar]
  • [35].Khandoker A, Islam MA, Rahman MM, Husna AA, Das S, Khatun MM. Bacterial contamination of street-vended spicy puffed-rice sold at Bangladesh Agricultural University campus. Bangl Vet. 2014;31(1):20–6. https://doi.org/10.3329/bvet.v31i1.22839. [Google Scholar]
  • [36].Jahan M, Rahman M, Parvej MS, Chowdhury SMZH, Haque ME, Talukder MAK, et al. Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh. J Adv Vet Anim Res. 2015;2(1):49–55. https://doi.org/10.5455/javar.2015.b47. [Google Scholar]
  • [37].Ema FA, Arif M, Islam MA, Khatun MM. Isolation and identification of duck egg-borne bacteria and their antibiogram profile. J Adv Vet Anim Res. 2018;5(2):110–16. https://doi.org/10.5455/javar.2018.e253. [Google Scholar]
  • [38].Sultana S, Islam MA, Khatun MM. Bacteria in chicken rolls sold by fast food restaurant and their public health significance. Bangl Vet. 2015;32(1):13–8. https://doi.org/10.3329/bvet.v32i1.29252. [Google Scholar]
  • [39].Martins SCS, Martins CM, Albuquerque LMB, Fonteles TV, Do Rego SL, Faheina J. Profile resistance of coagulase positive Staphylococcus strains isolated from food handlers. Bol Cent Pesqui Process Aliment. 2009;27(1):43–52. https://doi.org/10.5380/cep.v27i1.14950. [Google Scholar]
  • [40].Singh V, Chandel R, Chauhan PK, Bala I, Thakur K. Prevalence and antibiogram pattern of bacteria isolated from food product (Burger) of street food vendors of Paonta Sahib. Int J Institut Pharm Life Sci. 2011;86:90. [Google Scholar]
  • [41].Tagoe DNA, Nyarko H, Arthur SA, Birikorang E. A study of antibiotic susceptibility pattern of bacteria isolates in sachet drinking water sold in the cape coast metropolis of Ghana. Res J Microbiol. 2011;6(2):153–58. https://doi.org/10.3923/jm.2011.153.158. [Google Scholar]
  • [42].Pyzik E, Marek A. Plasmid profile analysis and evaluation of antibiotic susceptibility of Staphylococcus aureus strains isolated from table chicken eggs. Pol J Vet Sci. 2013;16(2):307–12. doi: 10.2478/pjvs-2013-0042. https://doi.org/10.2478/pjvs-2013-0042. [DOI] [PubMed] [Google Scholar]
  • [43].Sharma I, Mazumdar JA. Assessment of bacteriological quality of ready to eat food vended in streets of Silchar city, Assam, India. Indian J Med Microbiol. 2014;32(2):169. doi: 10.4103/0255-0857.129809. https://doi.org/10.4103/0255-0857.129809. [DOI] [PubMed] [Google Scholar]
  • [44].Pekana A, Green E. Antimicrobial resistance profiles of Staphylococcus aureus isolated from meat carcasses and bovine milk in abattoirs and dairy farms of the Eastern Cape, South Africa. Int J Environ Res Public Health. 2018;15(10):2223. doi: 10.3390/ijerph15102223. https://doi.org/10.3390/ijerph15102223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Kalantari S, Sepehri G, Bahrampour A, Sepehri E. Determination of bacterial contamination isolated from Sandwiches in Kerman City and their resistance to commonly used antimicrobials. Arch Appl Sci Res. 2012;4(2):1100–05. [Google Scholar]
  • [46].Yurdakul NE, ErgiNkaYa Z, ÜNal E. Antibiotic resistance of Enterococci, coagulase negative Staphylococci and Staphylococcus aureus isolated from chicken meat. Czech J Food Sci. 2013;31(1):14–9. https://doi.org/10.17221/58/2012-CJFS. [Google Scholar]
  • [47].Tabashsum Z, Khalil I, Nazimuddin MD, Mollah AKM, Inatsu Y, Bari ML. Prevalence of foodborne pathogens and spoilage microorganisms and their drug resistant status in different street foods of Dhaka city. Agric Food Analyt Bacteriol. 2013;3(4):281–92. [Google Scholar]
  • [48].Eromo T, Tassew H, Daka D, Kibru G. Bacteriological quality of street foods and antimicrobial resistance of isolates in Hawassa, Ethiopia. Ethiop J Health Sci. 2016;26(6):533–42. doi: 10.4314/ejhs.v26i6.5. https://doi.org/10.4314/ejhs.v26i6.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [49].Parvin MS, Ali MY, Talukder S, Nahar A, Chowdhury EH, Rahman MT, et al. Prevalence and multidrug resistance pattern of methicillin resistant S. aureus isolated from frozen chicken meat in Bangladesh. Microorganisms. 2021;9:636. doi: 10.3390/microorganisms9030636. https://doi.org/10.3390/microorganisms9030636. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Advanced Veterinary and Animal Research are provided here courtesy of Network for the Veterinarians of Bangladesh

RESOURCES