Functional nucleic acids as potent therapeutics against SARS-CoV-2 infection

Abstract

The COVID-19 pandemic has posed a severe threat to human life and the global economy. Although conventional treatments, including vaccines, antibodies, and small-molecule inhibitors, have been broadly developed, they usually fall behind the constant mutation of SARS-CoV-2, due to the long screening process and high production cost. Functional nucleic acid (FNA)-based therapeutics are a newly emerging promising means against COVID-19, considering their timely adaption to different mutants and easy design for broad-spectrum virus inhibition. In this review, we survey typical FNA-related therapeutics against SARS-CoV-2 infection, including aptamers, aptamer-integrated DNA frameworks, functional RNA, and CRISPR-Cas technology. We first introduce the pathogenesis, transmission, and evolution of SARS-CoV-2, then analyze the existing therapeutic and prophylactic strategies, including their pros and cons. Subsequently, the FNAs are recommended as potent alternative therapeutics from their screening process and controllable engineering to effective neutralization. Finally, we put forward the remaining challenges of the existing field and sketch out the future development directions.

Graphical abstract

To fight against the COVID-19 pandemic, therapeutics possessing timely adaption to different variants and broad-spectrum inhibition ability are of great significance. In this review, Chen et al. summarize functional nucleic acid-based therapeutics against SARS-CoV-2 infection, which are an emerging strategy due to their high programmability and rapid development cycle.

Introduction

The COVID-19 pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has elicited extraordinary threat to human life and the global economy. Different from severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV), two other highly pathogenic and zoonotic betacoronaviruses that broke out in 2003 and 2012, respectively,^{1 , 2 , 3} SARS-CoV-2 overwhelmingly surpasses them in transmissibility, resulting in ultrafast spread all over the world.⁴ Up to December 23, 2022, there were 651,918,402 confirmed cases of COVID-19 worldwide, including 6,656,601 deaths, reported by the WHO (https://covid19.who.int/). Similar to SARS and MERS patients, people infected by SARS-CoV-2 show clinical features, including fever, shortness of breath, unproductive cough, myalgia, fatigue, and chest discomfort, and, in severe cases: lung injury, acute respiratory/multiorgan failure, and even death.^{5 , 6} Therefore, it is of urgent need to develop therapeutic and prophylactic strategies to deal with the intractable situation. So far, a series of intervention methods including antiviral agents (neutralizing antibodies, small-molecule drugs) and various vaccines have been developed continuously, and they do effectively ease the horrible damage by SARS-CoV-2. However, constant mutation of the virus poses great risk of loss of efficacy of the present intervention means and prompts research for more antiviral strategies to enrich the “toolbox” for combatting the COVID-19 pandemic. Among them, functional nucleic acids (FNAs), including aptamers, DNA framework, functional RNA, and clustered regularly interspaced short palindromic repeats (CRISPR) technology, have been employed for their unique strength against viral mutations. Taking several critical merits into consideration, such as short development cycle, prompt adaption to different variants, highly programmable, etc., the FNA-related therapeutics are promising new tools for fighting against SARS-CoV-2 infection.

Although several review articles with emphasis on the diagnosis of SARS-CoV-2 via FNAs have been published,^{7 , 8 , 9} a comprehensive review on FNAs toward SARS-CoV-2 treatment is apparently lacking. To bridge such a gap, we survey the recent development of FNAs as potent therapeutics against SARS-CoV-2 infection in this review. We firstly introduce the background and pivotal components of SARS-CoV-2. Then we summarize the existing antiviral therapeutics. Subsequently, we introduce FNAs as potent substitutions in terms of their functions and working mechanisms: (1) neutralizing aptamers binding to viral proteins; (2) neutralizing aptamers binding to glycan shields of virus; (3) modified neutralizing aptamers with elevated performance; (4) aptamers binding to inflammatory pathways for easing of the cytokine storm; (5) aptamers binding to virus-associated enzymes; (6) topology-matching nucleic acid framework against viruses; (7) FNAs focusing on virus genome (Figure 1,Table 1 ). Finally, we discuss the existing achievements and notable challenges of FNAs in SARS-CoV-2 treatment, as well as the perspectives and inspirations of therapeutics on other existing or emerging fatal viruses.

Figure 1.

Illustration of functional nucleic acid-based therapeutics against COVID-19, their functions, and their working mechanisms

Table 1.

The classification of FNA-based therapeutics against COVID-19

FNA type	Target/type	Mechanism	Advantage	Reference
Aptamer	•viral protein •glycan shields •inflammatory pathway •virus-associated enzyme	•interrupt the attachment/membrane fusion steps •provide broad-spectrum protection •alleviate inflammatory responses •inhibition on viral infection and replication	low cost, fast evolution process, without ADE effect, high tissue permeability, lot-to-lot consistency	10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40
Modified aptamer	•chemically modified •bivalent/multivalent •mutagenesis/truncation	•improve the physiochemical properties •broaden the diversity of interaction type •multivalent binding for synergistic blocking •increase the binding affinity	improved stability, increased interaction type, synergistic blocking, elevated binding affinity	10,12,16,23,25,41,42,43,44,45,46,47,48
Topology-matching DNA framework	•viral protein •viral particle	•trap from inside or block from outside •elevate the binding affinity •improve blocking effect •as antigen display platform	prompt adaption to different variants/viruses, highly programmable, spatial pattern recognition	23,49,50,51,52,53,54,55,56,57,58,59
Functional RNA	•siRNA •miRNA •circRNAs •CRISPR-Cas system •nucleic acid chimera	target highly conserved regions of virus for broad-spectrum virus inhibition or degradation	pan-coronavirus treatment, resistance to virus mutation, easy editability	60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77
Gene-based vaccine	•viral vector vaccine •DNA vaccine •mRNA vaccine	•viral vector with target viral gene •viral gene delivered by plasmid or polymers sometimes in the company of adjuvants •stimulate the immune system for humoral and cellular immune response	low production cost, potent cell-mediated protective immunity, rapid development	78,79,80,81,82,83

An overview of SARS-COV-2: From its components and symptoms to therapeutics

The pivotal proteins of SARS-COV-2

SARS-CoV-2, belonging to the genus betacoronavirus of the family coronaviridae, is an enveloped virus with a positive-sense single-stranded RNA (ssRNA) genome of 30 kb (Figure 2A ) and shares 79% nucleotide sequence similarity with SARS-CoV.⁸⁴ The genome comprises 14 open reading frames (ORFs); among them ORF1a and ORF1b locate on the upstream of the genome, which takes up two-thirds of the viral genome and encodes 16 nonstructural proteins (NSPs) including NSP1-16. The structural proteins and accessory proteins are encoded by the remaining one-third downstream genome. A mature virion is mainly composed of major structural proteins and viral genomes, while the NSPs and accessory proteins are translated after its entrance into host cells, which participate in viral replication, protein processing, and viral assembly. The spike (S) protein, membrane (M) protein, envelope (E) protein, and nucleocapsid (N) protein make up the structural proteins, and the first three proteins are transmembrane proteins and incorporated into the viral lipid envelope (Figure 2A).^{85 , 86} The virions appear as approximately spherical particles with an average diameter of around 100 nm. As reported, 24 ± 9 S protein trimers are distributed on the surface of a single virion, which are inserted into the membrane, giving a crown appearance and mediating the major entry process (Figure 2C).⁸⁷ The monomeric S protein is a type I membrane protein with dense glycan modifications (22 N-linked glycans),⁸⁸ and is composed of two functional subunits: the S1 subunit responsible for receptor binding and the S2 subunit responsible for membrane fusion. The receptor binding domain (RBD), the N-terminal domain (NTD), and the C-terminal domain constitute the S1 subunit (Figure 2B). Among them, the RBD participates in the interaction with host angiotensin-converting enzyme 2 (ACE2) directly utilizing the receptor-binding motif (RBM), which is an extended loop wrapping around one edge of the core structure and making all the contacts with ACE2 (Figure 2C). It is worth noting that only when the RBD is in the “up” conformation can the interaction with the ACE2 be accomplished (Figure 2F). As for the NTD, its function in SARS-CoV-2 is not well analyzed but, in some coronaviruses, similar NTDs can recognize sugar moieties and act as attachment factors and play a vital role in the prefusion-to-postfusion transition of the S protein. After binding with ACE2 via RBM, the S protein is cleaved into S1 and S2 by transmembrane protease: serine 2 on the cell membrane or cathepsin L in the endosome, which make up for the two main entry pathways, as shown in Figure 2D. Then the fusion peptide on the head of S2, propelled by heptad repeat 1 (HR1) transformation, is exposed and anchored into the host membrane. Subsequently, the dramatic conformational changes of S2 to postfusion conformation facilitate the subsequent membrane fusion event between the virus and host cell (Figure 2F).⁸⁹ After the membrane fusion process, the RNA is released, followed by genome translation, replication, virion packaging, and release (as shown in Figure 2D).

Figure 2.

Components of SARS-CoV-2 and mechanism of virus infection

(A) The genome organization of SARS-CoV-2.

(B) The full-length SARS-CoV-2 spike protein with 22 glycan modifications.

(C) The critical components including spike protein, membrane protein, envelope protein, nucleocapsid protein, and RNA genome that make up the SARS-CoV-2 virion.

(D) Two entry pathways of SARS-CoV-2 virions and the subsequent translation, replication, assembling, and releasing processes. (1) Cell surface entry. (2) Endosomal entry.

(E) The interaction interface between RBM and ACE2.

(F) The process of ACE2 binding and membrane fusion.

Inflammatory factor and cytokine storm syndrome

Severe disease manifested by fever and pneumonia, leading to acute respiratory distress syndrome, had been described in up to 20% of COVID-19 cases in the early stages of the pandemic.⁹⁰ These phenomena are elicited by excessive early inflammatory responses (releasing tumor necrosis factor [TNF], IL-6, and IL-1β),^{91 , 92} which results in a cytokine storm, leading to an increased risk of vascular hyperpermeability, multiorgan failure, and eventually death as the high cytokine concentrations are unabated over time. Of note, nearly all deceased patients infected by SARS-CoV-2 are found to have experienced severe cytokine storm syndrome.

Existing therapeutics

The existing therapeutics mainly focus on the following aspects: (1) inhibiting the initial attachment process and blocking the interaction with ACE2; (2) suppression of the membrane fusion between the virus and host cell; (3) disruption of viral replication, protein processing, and viral assembly/release; (4) targeting inflammatory factor and corresponding signal pathways for treatment of excessive inflammatory reaction (cytokine storm syndrome).⁹³ So far, a series of antivirals (neutralizing antibodies, small-molecule drugs) and various vaccines have been continuously developed based on the aforementioned mechanisms (Table 2 ).

Table 2.

The existing traditional therapeutics against COVID-19

Therapeutics	Type	Target	Mechanism	Typical example	Limitation	Reference
Antibody	protein	RBD, NTD, S2, inflammatory cytokine/receptor	interrupt the attachment/membrane fusion steps; alleviate inflammatory responses	REGEN-COV2, tocilizumab, bebtelovimab, F61	immune escape, high cost, ADE effect	94,95,96,97
Vaccine	inactivated, DNA, mRNA, virus-vectored, protein subunit	spike protein, protein subunit, virions	activate immune system: potent humoral and cellular protective immunity	CoronaVac, BNT162b2, Convidecia, mRNA-1273	immune escape, high cost, long development cycle	78,79
Inhibitor	small molecule	main protease, RNA polymerase, FXR inhibition	block virus replication; ACE2 downregulation	paxlovid, molnupiravir, ursodeoxycholic acid	reproduction toxicity, side effects	98,99,100

A promising approach for treating or preventing SARS-CoV-2 infection is neutralizing monoclonal antibodies (mAbs), which can be derived from the B cells of convalescent patients or humanized mice. By targeting different subdomains of S protein: NTD, RBD, and S2,^{101 , 102 , 103} these neutralizing mAbs can either interrupt the attachment process or block the membrane fusion steps of virus infection. For instance, three neutralizing mAbs have been granted emergency use authorization for treatment of non-hospitalized patients with mild to moderate COVID-19: bamlanivimab, etesevimab, and imdevimab.⁹⁴ In addition, two potent antibodies including casirivimab and imdevimab, which bind two distinct and non-overlapping sites of RBD, have been combined as REGN-COV2 (cocktail) to resist SARS-CoV-2 variants.⁹⁴ However, with the constant mutation, REGN-COV2 loses its efficacy. Other potent mAbs such as bebtelovimab could effectively neutralize SARS-CoV-2 Omicron, BA.2 Omicron, and Delta variants.⁹⁵ However, with regard to the recent BQ.1 and BQ.1.1 variants, bebtelovimab also fails to provide effective protection and is not currently authorized for emergency use, as announced by the US Food and Drug Administration.¹⁰⁴ As well as targeting the viral protein, antibodies could also focus on inflammatory cytokine-related signal pathways. For example, by targeting inflammatory cytokines, tocilizumab (targeting IL-6) is another effective treatment to reduce mortality.⁹⁶ Although antibodies could provide protection against SARS-CoV-2 infection, they suffer from several inevitable drawbacks, such as high cost, batch to batch difference, antibody-dependent enhancement (ADE) effect,¹⁰⁵ and immune escape (falling behind the rapid virus evolution).

To provide a comprehensive protection against virus infection, vaccine development against SARS-CoV-2 is essential and urgent, as is well proven in the fight against smallpox, polio, etc.^{106 , 107 , 108 , 109} The specific analysis of antibody epitopes (RBD or S protein) instructed rational design of several vaccines, including DNA, messenger RNA [mRNA] vaccines, and viral vectored vaccines, which can elicit potent immune responses in vivo. In addition, other traditional types of vaccines were also developed, such as inactivated vaccines, virus-like particles vaccines, and so on.⁷⁸ Similar to antibodies, vaccines also suffer from several weaknesses: constant mutation impairing the efficacy, long research cycle, and high cost. Alongside vaccines, small-molecule drugs, such as molnupiravir, 4′-fluorouridine, and paxlovid, are also vital antiviral therapeutics.^{98 , 99 , 110} They are nucleoside analogs or main protease inhibitors, which can effectively block virus replication. The main shortcomings lie in their reproduction toxicity or limited applicability. Recently, researchers from Cambridge University found that an old drug, ursodeoxycholic acid, can effectively downregulate the expression of ACE2,¹⁰⁰ which could serve as a broad-spectrum prophylactic agent against COVID-19. In general, although various therapeutics have already been on the market, their distinct deficiencies are nonnegligible. It is urgent to develop more therapeutic and prophylactic antivirals to enrich the toolbox for combatting the COVID-19 pandemic.

FNAs as potent therapeutics

FNAs, including aptamers (ssDNA or ssRNA), DNA framework, functional RNA (small interfering RNA [siRNA], microRNA [miRNA], circular RNAs [circRNAs], etc.), and related CRISPR-Cas system technology, are novel treatments for SARS-CoV-2 infection. Similar to antibodies, nucleic acid aptamers are short ssDNA/ssRNA sequences selected to bind specific targets with superior specificity and affinity. Aptamers, usually obtained by the systematic evolution of ligands by exponential enrichment (SELEX) technology, feature several conspicuous merits in combating COVID-19 over antibodies: low cost, fast evolution process, high stability, lot-to-lot consistency, ease of chemical modification, low immunogenicity (lack of Fc fragment and avoiding the ADE effect),¹⁰ small physical size, high tissue permeability (easy access to biological areas such as lung tissue through intranasal administration), and easy internalization (useful vectors for therapeutic RNA and drug).¹¹¹ Due to these privileges, aptamers have been termed “chemical antibodies” and used as targeting molecules in various fields.¹¹² Apart from utilizing aptamers alone, aptamer-integrated nanostructures such as DNA framework have broadened its applications in biosensing, molecular computation, and biomedical fields.^{113 , 114 , 115} Because of the high programmability and fast adaption to different viruses, nucleic acid frameworks have been broadly applied in virus trapping or neutralization. Since the outbreak of the COVID-19 pandemic, numerous aptamers and their integrated DNA frameworks have been developed for virus detection and neutralization.^{116 , 117 , 118 , 119 , 120 , 121 , 122 , 123 , 124 , 125 , 126} In this review, we concentrate on the virus therapeutic strategies. Table 3 lists the existing neutralizing aptamers (aptamers used for diagnosing are not included).

Table 3.

An overview of neutralizing aptamers against SARS-CoV-2

Aptamer name	Type	Target	Sequence	Kd (nM)	IC50 (nM) (pseudovirus)	IC50 (nM) (authentic virus)	Virus variants	Reference
CoV2-RBD-1C	ssDNA	RBD	CAGCACCGACCTTGTGCTT TGGGAGTGCTGGTCCAAGG GCGTTAATGGACA	5.8 ± 0.8	/	/	WT	Song et al.11
CoV2-RBD-4C	ssDNA	RBD	ATCCAGAGTGACGCAGCATT TCATCGGGTCCAAAAGGGGC TGCTCGGGATTGCGGATATG GACACGT	19.9 ± 2.6	/	/	WT	Song et al.11
CoV2-6C3	ssDNA	RBD	CGCAGCACCCAAGAACAAG GACTGCTTAGGATTGCGATA GGTTCGG	44.78 ± 9.97	9.68 ± 2.95 (circularly bivalent form)	0.42 ± 0.15 (circularly bivalent form)	WT	Sun et al.10
Aptamer-1	ssDNA	RBD	ATCCAGAGTGACGCAGCAT CGAGTGGCTTGTTTGTAATG TAGGGTTCCGGTCGTGGGT TGGACACGGTGGCTTAGT	6.05 ± 2.06	76.9	concentration-dependent inhibition	WT	Liu et al.14
Aptamer-2	ssDNA	RBD	ATCCAGAGTGACGCAGCAA TTACCGATGGCTTGTTTGTAA TGTAGGGTTCCGTCGGATTG GACACGGTGGCTTAGT	6.95 ± 1.10	53.0	concentration-dependent inhibition	WT	Liu et al.14
SP6	ssDNA	spike	GGGAGAGGAGGGAGATAGAT ATCAACCCATGGTAGGTATTGC TTGGTAGGGATAGTGGGCTTGA TGTTTCGTGGATGCCACAGGAC	13.9 ± 0.6	concentration-dependent inhibition	/	WT	Schmitz et al.18
RBD-PB6	ssRNA	RBD	GGCGACAUUUGUAAUUCCUGG ACCGAUACUUCCGUCAGGACA GAGGUUGCCA	18	140	46 (trimeric form)	WT, D614G	Valero et al.16
nCoV-S1-Apt1	ssDNA	S1	AGCAGCACAGAGGTCAGATGC CGCAGGCAGCTGCCATTAGTCT CTATCCGTGACGGTATGCCTAT GCGTGCTACCGTGAA	0.327 ± 0.016	concentration-dependent inhibition	/	WT	Yang et al.15
S2A2C1	ssDNA	S2	AGGCGGGTTCCTAGACTTGTAC TCAGCCT	35 ± 4.3	/	/	WT, Delta, Omicron	Silwal et al.19
ST-6	ssDNA	spike	AGCAGCACAGAGGTCAGATGA GGGCATCAAAGGGGGGAGGGC GGGTGGATTGGATGCCGACCTA TGCGTGCTACCGTGAA	36.52 ± 2.65	/	47.89–65.52	WT, Delta, Lambda,Omicron	Yang et al.30
Apt1C	ssDNA	NTD	CGCCTATCGAGGGATGCCACGT CCATCCTTGTCTGGAGACGAGAT AGGCG	69.0 ± 4.2	51.1 (multivalent form)	concentration-dependent inhibition	WT, N501Y, D614G, Δ69-70	Chen et al.23
AP5	ssDNA	high mannose	CTTCTGCCCGCCTCCTTCCCCCA GCGAATACACACGGCTAGCGAG GAGACGAGATAGGCGGACACT	182 ± 1.5	concentration-dependent inhibition	/	WT	Li et al.24

Functional RNAs, including siRNA, miRNA, circRNAs, etc., also play a vital role in the treatment of SARS-CoV-2 infection by regulation of target gene expression. Different from many antibodies targeting viral proteins, these functional RNAs focus on the viral genome. Targeting the critical and conserved region of the genome, therapeutics based on the functional RNA are broad spectrum; the rapid developing process of which compared with antibodies facilitates prompt adaption to different variants. Functional miRNAs are endogenous short non-coding RNAs that could interact with certain mRNAs during post-transcriptional regulation,¹²⁷ and siRNAs are synthetic exogenous double-stranded non-coding RNA molecules that could also regulate the expression of target genes.^{128 , 129} The circRNAs have unusual metabolic stability with covalently joined 5′ and 3′ ends, which could interact with miRNAs or RNA-binding proteins to regulate gene translation or protein expression.¹³⁰ Furthermore, CRISPR-Cas system technology and chimeric oligonucleotides could provide broad-spectrum viral prophylaxis and treatments by targeting the vital conserved genes of virus.^{60 , 61} Since early 2020, the relevant FNAs mentioned above have become ideal candidates for diagnosis and treatments against SARS-CoV-2 infection. Since there have already been several review articles surveying FNA-based virus detection,^{7 , 8 , 9} we only focus on FNA-based therapeutics against virus infection in this review, because a review on this topic is lacking.

Neutralizing aptamers binding to viral proteins

The S protein of SARS-CoV-2 directly participates in the virus-cell interaction, so therapeutics targeting different subdomains of S protein are straightforward and efficient. Learning from antibodies, researchers have also screened different aptamers binding to NTD, RBD, and S2 for virus neutralization, respectively. Considering that the RBD domain directly participates in the interaction between host cell and virus, we divide the neutralizing aptamers targeting the spike of SARS-CoV-2 into two parts: RBD dependent and RBD independent for the facility of narration.

RBD dependent

The most straightforward way to block the interaction between virus and its receptor is targeting the RBD domain, especially the RBM subdomain, so the initial attachment process can be interrupted, let alone the subsequent membrane fusion. Based on this strategy, Song et al. first screened three aptamers targeting the RBD domain (CoV2-RBD-1C, CoV2-RBD-4C, and CoV2-6C3) by competition selection.^{10 , 11} The molecular dynamics simulation results revealed that the binding sites of all three aptamers fully or partially sterically cover the binding interfaces of ACE2-RBD, blocking the ACE2-RBD “bridge” interaction. Further flow cytometry analysis gave K_d values of 5.8, 19.9, and 44.78 nM, respectively. To elevate the thermodynamic properties and stabilities, CoV2-6C3 was optimized into a circular divalent aptamer cb-CoV2-6C3 that yielded an elevated affinity (0.13 nM) and exhibited an IC₅₀ value toward wild-type SARS-CoV-2 pseudovirus and authentic virus at 9.68 and 0.42 nM, respectively (Figure 3A).¹⁰ Furthermore, the authors assembled the three aptamers onto a 5-nm gold nanoparticle to form a spherical neutralizing aptamer cocktail to inhibit different SARS-CoV-2 variants (Figure 3B).^{12 , 13} Molecular dynamic simulations revealed that the three aptamers bind to three different interfaces of RBD domain, so the binding affinity was greatly improved (the K_d value was at the picomolar level) as well as the neutralization efficiency (the IC₅₀ value was lowered to picomolar-femtomolar range). Liu et al. also developed two aptamers: Aptamer-1 and Aptamer-2 targeting the RBD domain with binding affinity at 28 and 27 nM, respectively.¹⁴ Quantitative analysis revealed that aptamers-1 and -2 neutralized pseudovirus particles with IC₅₀ values at 76.9 and 53.0 nM, respectively (Figure 3C). Furthermore, the clinical potentials of the aptamers were well demonstrated by conventional microneutralization assay system. Yang et al. reported six novel DNA aptamers targeted S1 domain screened via capillary electrophoresis-based SELEX.¹⁵ Further docking analysis and binding assay revealed that the exact binding domain exist on the RBD. And the pseudovirus neutralizing assay demonstrated that the nCoV-S1-Apt1 exhibited a dose-dependent inhibitory profile. Valero et al. screened a serum-stable RNA aptamer targeting RBD domain and further assembled it into a trimerized version.¹⁶ The binding affinity was elevated to picomolar range and could effectively neutralize viral infection as well.

Figure 3.

Neutralizing aptamers binding to viral proteins

(A) The mechanism of circular divalent aptamer cb-CoV2-6C3 to inhibit SARS-CoV-2 infection.¹⁰ Copyright 2021, John Wiley & Sons.

(B) The spherical multivalent neutralizing aptamers inhibited SARS-CoV-2 infection and suppressed immune escape.¹² Copyright 2021, American Chemical Society.

(C) RBD-blocking aptamers: Aptamer-1 and Aptamer-6 can effectively neutralize virus infection.¹⁴ Copyright 2021, John Wiley & Sons.

(D) Fusion aptamer S1B6C3-A5-S2A2C1 exhibited good inhibition efficacy to SARS-CoV-2 variants.¹⁹ Copyright 2022, IVYSPING.

(E–G) The mechanism of EK1 peptide in broad-spectrum virus inhibition.²⁰ Copyright 2019, AAAS.

RBD independent

The constantly mutating in RBD domain of the SARS-CoV-2 under severe immune stress resulted in efficacy loss of the existing RBD-targeting antibodies, so therapeutics targeting more conservative domains are highly demanded.¹⁷ Schmitz et al. developed an RBD-independent DNA aptamer which possessed neutralizing ability against SARS-CoV-2 pseudovirus.¹⁸ Although the neutralizing mechanism was unclear, the authors speculated that the initial attachment with ACE2 was not impeded and preventing S2′ cleavage or destabilizing the prefusion conformation of the S protein might be the main cause. Silwal et al. developed an anti-S2 aptamer, S2A2C1, and the authors conjugated it with a reported RBD-targeting aptamer S1B6C3 to form a fusion aptamer: S1B6C3-A5-S2A2C1 (Figure 3D).¹⁹ The fusion aptamer exhibited good inhibition efficacy to SARS-CoV-2 variants including Delta and Omicron, for few mutation sites on S2 domain, which is a highly conserved domain among different variants. To be noted, aptamers targeting S2 domain possess broad-spectrum virus inhibition capability toward more than SARS-CoV-2. Before the outbreak of the COVID-19, Lu et al. developed a pan-coronavirus fusion inhibitor EK1-targeting HR1 domain of multiple human coronavirus (HCoVs) spikes, which was derived from the HR2 domain of HCoV-OC43 (Figures 3E and 3F).²⁰ Due to the conserved structure of HR region among various HCoVs, EK1 peptide could form a stable six-helix bundle structure with both short α-HCoV and long β-HCoV HR1s (Figure 3G). When time came to the COVID-19 pandemic, the EK1C4 peptide derived from EK1 exhibited excellent inhibition effect against SARS-CoV-2, meeting the researchers’ expectations.²¹ Although the broad-spectrum aptamers targeting HR1 domain like the EK1 inhibitor have not been developed yet, the concept can be extended to the selection of relevant aptamers for effective therapeutics of multiple HCoVs infection.

Except for the S2 and RBD domain of SARS-CoV-2, another potent site, the NTD domain, also features vital epitope, to which many neutralizing mAbs target. Among them, antibodies targeting NTD supersite stand out for their efficient neutralizing ability (i.e., 4A8),²² cocktails combining NTD mAbs and RBD mAbs can evade virus mutation and antigen drift of SARS-CoV-2 effectively. Chen et al. screened an aptamer targeting NTD supersite similar to NTD neutralizing antibodies and verified the aptamer by molecular docking and molecular dynamics simulations.²³ The monomer aptamer exhibited inhibition effect to wild-type pseudovirus and a further elaborately designed multivalent topology-matching nanocrown possessed superior neutralization efficacy to multiple variants.

In conclusion, both the RBD-dependent and RBD-independent aptamers could effectively block the virus-host cell interaction through the attachment or membrane fusion process and features several advantages over antibodies: low cost, easy to modify, short screening cycle (keep up with the constantly mutating of virus), lot-to-lot consistency, and low immunogenicity. So in-depth investigation is promising and doubtlessly deserved, and some improvement could be made such as elevating biochemical stability, increasing half-life, and extending in vivo applications, which is a blue ocean calling for the relevant researchers to explore.

Neutralizing aptamers binding to glycan shields of virus

Various viruses, including HIV, SARS, influenza, are protected by glycan shields. Of note, extensively glycosylated viral proteins facilitate escape from the immune surveillance of infected hosts by shielding the immunogenic proteinous surface with a dense coat of host-derived glycans.^{88 , 131 , 132 , 133 , 134} So, the glycan shield is an ideal target for virus recognition and inhibition. In particular, high-mannose glycans are characteristic in glycans shields of multiple viruses.^{131 , 133 , 134 , 135 , 136} Many viral glycoproteins do not follow the classical secretion pathway, but bud directly from the endoplasmic reticulum and shift to the plasma membrane, bypassing further complex and diverse glycosylation in the Golgi apparatus, which yields viral populations that are occupied by considerable oligomannose glycans. Although still sparse, there have already been vaccines and antibodies developed based on viral glycans (alone or combination with peptide elements) for efficient virus prevention and neutralization.¹³⁷

Due to the weak immunogenicity and low accessibility, targeting reagents specific to glycans of viruses are extremely rare. For example, anti-glycan antibodies are hard to generate due to the low immunogenicity of glycans which usually initiate ligands with low binding affinity; in vivo, lectins exhibit low affinity and deficient selectivity to specific glycans due to their shallow binding pockets.¹³⁸ However, aptamers, also defined as “chemical antibodies,” can make up for the deficiency. Li et al. selected a high-mannose-targeting aptamer AP5 utilizing RNase B as a positive screening target (modified with high-mannose glycans [Man_5-9GlcNAc₂]) (Figure 4A).²⁴ Ap5 was further assembled into a tetrahedron DNA framework and a dendritic polyvalent DNA skeleton. Both the monovalent AP5 and the multivalent tetrahedron DNA framework modified with AP5 exhibited distinct inhibition efficacy to the wild-type SARS-CoV-2 pseudovirus, demonstrating that high-mannose glycans are a promising target for virus inhibition. Another research also reported aptamers targeting high mannose using indole-modified DNA because of its capability for recognizing and differentiating between specific protein glycoforms (Figures 4B and 4C). Unfortunately, the authors did not focus on virus inhibition but just put forward a new aptamer selection method.²⁵ We foresee that the use of aptamers would find its opportunities in virus therapeutics in the future. Except for high-mannose glycans as typical components of glycan shields, other types of glycan modifications on viral particles are also important. Taking influenza virus as an example, the mixture of high mannose, complex, and hybrid-type oligosaccharides acts as a dense shield and can modulate the immune response to infection. The N-linked glycans are further sulfated to interact with sialic acids on host cells.²⁶ Kwon et al. developed an RNA aptamer specifically binding to the glycosylated hemagglutinin (HA) of avian influenza virus, which exhibited efficient suppression of viral infection in host cells.²⁷ An early publication by the same group, however, showed that the selected RNA aptamer targeting the unglycosylated HA failed to interrupt virus invasion,²⁸ indicating the necessity of binding to the glycosylated ectodomain, which may be crucial for viral attachment. To sum up, the glycan shield of virus is another potential target for the development of broad-spectrum antiviral agents. However, the existing treatment focusing on glycosylation of viral protein is at the initial phase, which is well worth further in-depth study to broaden the virus-combating avenues.

Figure 4.

Aptamers targeting to glycan shields of viruses

(A) The SELEX process of neutralizing aptamers binding to high-mannose modification.²⁴ Copyright 2022, Chinese Chemical Society.

(B) The SELEX process of indole-modified aptamers targeting high-mannose glycans.²⁵ Copyright 2021, Springer Nature.

(C) The characterization of binding affinity and selectivity toward different substrates.²⁵ Copyright 2021, Springer Nature.

Modified aptamers binding to virus

Nucleic acids suffer from weak stability for easy degradation by nucleases, while utilizing chemically modified unnatural nucleic acids could effectively improve the physiochemical properties and provide extra chemical interaction opportunities. For example, chemically modified SELEX libraries containing boronic acid or indole moieties possess better interactions with glycoprotein; sulfur (VI) fluoride exchange (SuFEx) modifications offer covalent interaction with protein; 2′-fluoropyrimidine protected RNA from serum degradation and can be used in live-animal-based SELEX; slow off-rate modified aptamers (SOMAmers) containing 2′-deoxyuridine nucleotides could be used to add a variety of residues to broaden the diversity of the side chains.^{25 , 41 , 42 , 43 , 44} In addition, other modifications, such as truncation, bivalent or multivalent construction, and mutagenesis, can also increase the binding affinity and thermostability.^{10 , 12 , 23 , 45} Yoshikawa et al. successfully developed a high-mannose-targeting aptamer using an indole-modified DNA library.²⁵ Because of the fact that well-defined protein glycans are difficult to obtain and that aptamer candidates prefer to interact with protein epitopes other than glycans, acquisition of glycan-targeting aptamers is rather difficult. The indole moiety, however, could form key interactions within the binding pockets of anti-glycans antibodies, and is more likely to bind to electron-poor C-H bonds of glycans for electronic complementarity. Therefore, introducing indole modification, the authors established a selection method for aptamer binding to glycan moieties: modified multiparameter particle display selection. Based on this, the authors utilized RNase B and RNase A as positive and negative selection targets, respectively, and produced aptamers merely targeting the high-mannose glycans. As mentioned above, although the aptamer has not been employed in treating virus infection, we foresee its great potential in virus inhibition in the future. Valero et al. screened a serum-stable RNA aptamer RBD-PB6 targeting the RBD domain,¹⁶ which is modified by 2′-fluoropyrimidine to increase its chemical stability and resistance to nucleases and exhibited binding affinity at 18 nM. More than binding to RBD, RBD-PB6 could also interact with spike S1 and the monomeric/trimeric spike. Further, the trimeric form of RBD-PB6 increased the binding affinity as well as the virus neutralization efficiency: the K_d value decreased from 0.4 nM to 39 pM and the IC₅₀ value was reduced from 1.5 μM to 46 nM. Qin et al. developed a covalent binding aptamer equipped with sulfur (VI) fluoride exchange (SuFEx) modifications that could block the RBD-ACE2 interaction by forming covalent bonds on RBD,⁴² generating a 25-fold enhancement of pseudovirus inhibition efficacy over the original binding aptamer. The irreversible chemical covalent binding between the inhibitors and the targets could decrease the IC₅₀ value from 400 to 15.2 nM, making up for the deficiency of the existing therapeutics with reversible binding equilibrium (Figures 5A and 5B). Overall, the covalent binding manner is a novel and promising viral therapeutic via rigid irreversible binding. The only fly in the ointment is that the modification could slightly impair the binding affinity of the original aptamer, so a more improved modification method for broadening the applications of chemically modified unnatural nucleic acids in viral neutralization is in urgent demand. Lee et al. utilized hexynyl-modified ssDNA to link hACE2 hotspot peptide, resulting in a hybrid random nucleic acid library, which was further screened to obtain a receptor-mimicking synthetic reagent. The hotspot interaction of viruses with receptor-derived short peptides is maximized by aptamer-like scaffolds, which exhibit a great binding tolerance to all SARS-CoV-2 variants of concern (Figure 5C).⁴⁶ Multivalent binding could efficiently improve the binding avidity synergistically; several researchers have taken this strategy to elevate the performance of viral aptamers. Chen et al. developed a multivalent NTD supersite binding nanocrown to cap the S protein trimer, effectively blocking the receptor-ligand interaction, which could not be achieved by monovalent aptamers.²³ Furthermore, Sun et al. utilized the synergistic effect of combined aptamers targeting different epitopes, serving as an aptamer cocktail to avoid immune escape.¹² Site-directed mutagenesis could not only reveal the binding motif of a given aptamer but also be exploited to improve the binding affinity.^{45 , 47} Duclair et al. screened aptamers targeting HIV-1 protease with higher binding affinity by second-generation selection using 20% mutational library.⁴⁸ With the aid of practical experiences and computational methods (molecular docking and molecular dynamics simulations), the truncation process of the parent aptamer could be guided and a shorter aptamer was obtained, eliminating the steric hindrance and reducing the production costs.⁴⁷ Chen et al. screened an aptamer binding to the NTD supersite, and the further truncated form gave an elevated binding affinity with lowered K_d values from 83.0 to 58.6 nM.²³ Overall, only by either post modification (chemical modification, multivalent construction, truncation, and mutagenesis) or utilizing modified nucleic acids library could the performance of the selected aptamer be improved.

Figure 5.

Modified aptamers against SARS-CoV-2

(A) The specific binding sites on RBD domain and the covalent binding details.⁴² Copyright 2021, Cambridge University Press.

(B) The pseudovirus neutralization assay based on covalent binding aptamer.⁴² Copyright 2021, Cambridge University Press.

(C) In vitro selection of receptor-mimicking hybrid ligand which is composed of a hACE2-derived hotspot peptide and a nucleic acid scaffold.⁴⁶ Copyright 2022, AAAS.

Aptamers binding to inflammatory pathway for easing of cytokine storm

The inflammatory response begins when the pattern recognition receptors of innate immune cells recognize the pathogen-associated molecular pattern from pathogens such as virus and bacterium.¹³⁹ At the early stage, 20% of patients with COVID-19 might develop severe pneumonia caused by the cytokine-releasing syndrome. Of note, the complexity of cytokines and the multiplicity of related signal pathways make it intractable to ease the excessive inflammatory circumstance after virus infection, while a few membrane receptors and cytokine-targeting antibodies, including cell-membrane nanoparticles, antibody-polymer conjugates, drug-loaded extracellular vesicles, and so on, play vital roles in neutralizing the excess cytokines to alleviate the severe syndrome.¹⁴⁰

Resembling antibodies, “chemical antibody” aptamers also take their place for ease of cytokine storm. Lai et al. developed a TNF-α-targeting aptamer, AptTNF,²⁹ that could effectively alleviate the TNF-α-mediated acute lung injury and acute liver failure. The signal pathway of TNF-α plays a double-edged sword: the initial over-release may impair the issue, while after the acute injury phase suitable amount of TNF-α is needed for tissue repair. To specifically neutralize TNF-α in the early phase without undesirable side effects, a half-life adjustable aptamer (with mPEG modification) was developed. The authors first screened an aptamer targeting TNF-α with high binding affinity (K_d = 8 nM). To further verify the hypothesis, the authors investigated the attenuating injury potential of AptTNF in the mouse acute lung injury model and found that aptamer exhibited little lung injury compared with the control group. In addition, the introduction of the aptamer also promoted the early regeneration of liver tissues. The results demonstrated the great potential of AptTNF in cytokine storm-induced injury treatment. Yang et al. developed an aptamer-targeting S protein of SARS-CoV-2.³⁰ Different from the usual mechanism of blocking the RBD-ACE2 interaction, the authors introduced competing binding to the spike protein against TLR4, which would reduce inflammatory cytokine production, including IL-1β and IL-6. Of note, the aptamer candidate ST-6 is outstanding due to its high efficiency of interfering S-TLR4 interaction and inhibition of excessive inflammatory responses. Further experiments revealed that both the ST-6 and its truncations possessed ideal blocking capacity, which replaced about 70% of TLR4 bound to the S protein, exhibiting significant competition and substitution capacity while not affecting the host’s immune system. Besides, molecular dynamics simulations showed that the binding epitope of aptamer to S protein was exactly the same as that of TLR4, accounting for its blocking effect (Figures 6A and 6B). Overall, the aptamers showed their potent therapeutic properties in alleviating excessive inflammatory responses. To sum up, developing or reusing aptamers targeting cytokines and relevant signal pathways blazes new directions for virus infection treatment, which may make up for the deficiencies of the existing therapeutics.^{31 , 32 , 33} Last, but not least, it is also highly warranted to combine conventional antiviral strategies with immunomodulatory therapy to thoroughly combat SARS-CoV-2 or other fatal viruses.³⁴

Figure 6.

Aptamer ST-6 can block the TLR4-spike interaction for easing of the cytokine storm

(A) The secondary structures and kinetic binding parameters of ST-6 and its truncations to spike proteins evaluated by BLI assay.³⁰ Copyright 2022, Springer Nature.

(B) The blocking mechanism of ST-6 and qRT-PCR analysis for cytokine inhibition.³⁰ Copyright 2022, Springer Nature.

Aptamers binding to virus-associated enzyme

Targeting virus-associated enzymes is another promising way to inhibit virus infection, especially after virus entry. Within the host cells, the SARS-CoV-2 main protease (M^pro), responsible for processing of polyproteins, is involved in the generation of various NSPs (from NSP4 to Nsp16), playing an indispensable role in viral replication and transcription.⁸⁶ Besides, the M^pro stands out as a highly conserved gene among different variants of SARS-CoV-2 and even other coronaviruses, so the drugs targeting M^pro show great potential to be broad-spectrum viral inhibitors.³⁵ There have already been several promising antiviral protease inhibitors such as paxlovid from Pfizer,^{35 , 36} while aptamer therapy based on the enzyme is still at the initial stage. Morena et al. developed ssRNA targeting M^pro using an entropic fragment-based strategy.³⁷ The authors identified three specific aptamers; all of them bound to the dimerization region of M^pro, which is necessary for the enzymatic activity. Among them, MAptapro-IR1 could form the strongest stable complex with M^pro, verified by molecular dynamics simulation and binding free energy calculation, which held good potential in viral inhibition and was proposed to be further investigated. In addition to the M^pro, the helicase is another important enzyme target for virus inhibition because of its indispensable role in viral replication. Jang et al. developed an ssRNA aptamer targeting SARS-CoV helicase, which could efficiently inhibit the enzymatic activity: unwinding double-stranded DNA with an IC₅₀ value of 1.2 nM.³⁸ Since the genome of helicase is rather conservative among different coronaviruses, the already developed anti-SARS-CoV aptamers could be used for SARS-CoV-2 inhibition. Another example for using existing aptamers to target viral enzyme is the work of the Weisshoff group,³⁹ they found that an already existing aptamer, BC 007, which is in phase 2 of clinical testing for neutralizing pathogenic autoantibodies, had great potential in SARS-CoV-2 treatment via binding to the RBD domain and viral RNA polymerase with no interference with SARS-CoV-2 neutralizing antibodies.⁴⁰ Overall, binding to the more conservative virus-associated enzymes is another promising way to combat the SARS-CoV-2 pandemic. Also, because of the genome similarity, many existing nucleic acid-based therapeutics could be adopted to save time.

Topology-matching nucleic acid framework against virus

Nucleic acids, after being programmed into a specific shape that topologically matches viral protein or virus particles, are a potent virus inhibition platform either trapping from inside or blocking from outside. An aptamer-integrated nucleic acid framework could provide multivalent binding with precise spatial pattern-recognition toward a target virus, which may work collectively or associatively to achieve virus neutralization with high efficiency. Kwon et al. developed a star-shaped DNA architecture that displayed 10 dengue (DENV) envelope protein III (ED3)-targeting DNA aptamers into a two-dimensional pattern.⁴⁹ The DNA framework could precisely match the spatial arrangement of ED3 clusters on the viral surface (DENV), the multivalent interaction of which provides high binding avidity and can benefit virus detection or enhance viral inhibition (Figure 7A). It is noteworthy that the inhibition EC₅₀ value decreased from 15 μM to 2 nM after the monovalent aptamer was assembled onto the DNA star, giving a distinct inhibition leap. Provided that the unique spatial geometric pattern is resolved, the design theory can also be broadened to combat other disease-causing pathogens. Sigl et al. developed a broad-spectrum antiviral platform based on a programmable icosahedral canvas, which was self-assembled by triangular DNA building blocks with high yield into user-defined geometries and apertures.⁵⁰ The masses of the created shells ranged from 43 to 925 MDa (8–180 subunits) and the maximum internal cavity diameter which reached 280 nm (Figure 7B). The interior of the shells could be modified by various virus binding moieties including aptamers or antibodies. In this work, the authors take hepatitis B virus and adeno-associated viruses as examples to demonstrate the concept of virus trapping by engulfing viral particles. They found that the DNA half shells increased neutralization capacity compared with the free antibodies, revealing the importance of the engulfing effect introduced by topology matching. The virus-trapping strategy could directly decrease the viral load by blocking the interaction between host cells and viruses, paving a brand new avenue for viral inhibition. Recently, the same group developed another broad-spectrum virus-trapping platform, which is denoted as heparan sulfate-modified DNA origami shells, utilizing the broad avidity of heparan sulfate proteoglycans to viruses.⁵¹ With a calibrated density of heparin and heparan sulfate derivatives crafted to the interior of DNA origami shells, they successfully encapsulated adeno, adeno-associated, chikungunya, dengue, human papilloma, noro, polio, rubella, and SARS-CoV-2 viruses for efficiently preventing their interactions with receptors, respectively. Similar to the DNA-engulfing shells, Zhang et al. developed a spatially patterned icosahedral DNA nanocage for SARS-CoV-2 neutralization.⁵² To compose the topology-matching nanocage, three precisely positioned aptamers occupy three vertexes of a single triangular plane to match the SARS-CoV-2 spike trimer, forming a particular multivalent binding mode and obtaining a much lower neutralizing IC₅₀ value at attomolar scale. The spatially arranged aptamer binders of the IDNA-30 worked collaboratively, not only preventing the interaction between the RBD and ACE2 but also inducing the aggregation of virus particles. The larger volume of the aggregates displayed low mobility compared with the single virion, providing a responsive window period for immune systems. For the facility of assembly, the authors only used one aptamer. If more sorts of aptamers binding to different domains of viral protein can be integrated, a stronger capacity of evading immune escape may be achieved. Chauhan et al. developed a net-shaped DNA nanostructure modified with RBD-targeting aptamers for sensitive detection and potential inhibition of SARS-CoV-2.⁵³ The spatial pattern matching and multivalent binding could efficiently release fluorescence signals upon binding, with PCR equivalent sensitivity. Furthermore, the DNA nanostructure also efficiently impeded the authentic wild-type SARS-CoV-2 infection with a near 1,000-fold enhancement compared with the monomeric aptamer. The design principle could also be adapted to detect or neutralize other life-threatening viruses. Chen et al. screened an aptamer targeting the NTD supersite of SARS-CoV-2 spike.²³ With the aid of molecular docking and molecular dynamics simulations, the main interaction sites located in the NTD supersite, where many neutralizing antibodies exactly target. Furthermore, a multivalent topology-matching DNA nanocrown for the S trimer was developed by structure analysis. The central symmetry and the top periphery distribution of the binding sites facilitate the interaction between the DNA nanocrown and S trimer for their similar trimeric valence geometry (Figure 7C). The binding affinity and neutralization efficiency were significantly enhanced, while the K_d value decreased from 64.2 to 1.81 nM against the S trimer, and the EC₅₀ value was in the nanomolar range toward wild-type pseudovirus SARS-CoV-2. As for several mutants, the DNA nanocrown also behaved well, with a similar neutralizing EC₅₀ value. Finally, the authors investigated the potential of the DNA nanocrown in authentic SARS-CoV-2 inhibition and achieved nearly 100% inhibition efficacy, and the RNA copies decreased by 4–5 orders of magnitude, demonstrating promising potential in virus neutralization. Similarly, Wan et al. developed a spatial- and valence-matched neutralizing DNA tetrahedral nanostructure for SARS-CoV-2 for inhibition of various variants.⁵⁴ The designed MATCH-4 could match the topmost surface of the spike trimer with nanometer precision. The DNA framework could not only act as the barrier to block the interaction between RBD and ACE2 but also restrain the conformational change of the spike trimer.

Figure 7.

The topology-matching DNA frameworks against viruses

(A) The star-shaped DNA architecture inhibiting the dengue virus infection.⁴⁹ Copyright 2020, Springer Nature.

(B) The design of broad-spectrum antiviral platform based on a programmable icosahedral canvas.⁵⁰ Copyright 2021, Springer Nature.

(C) The mechanism of a multivalent topology-matching DNA nanocrown for SARS-CoV-2 inhibition.²³ Copyright 2022, Chinese Chemical Society.

(D) DNA origami integrated with spatial organized RBD binding aptamers for the investigation of immune response.⁵⁹ Copyright 2022, American Chemical Society.

As well as acting as a blocking module, the nucleic acid framework could also be functionalized as an antigen display platform to elicit robust protective immune response and improve the development of more efficient vaccines against fatal viruses.^{55 , 56 , 57 , 58} Zhang et al. developed a DNA origami integrated with RBD binding aptamers to investigate the viral attachment and immune response initiated by the copy number and distribution pattern of SARS-CoV-2 RBDs (Figure 7D).⁵⁹ With the RBD number increasing from 10 to 90, the binding rate of virus-like particles (VLPs) to host cells also increased. Although concentrated RBD distribution promotes faster and stronger interaction compared with evenly distributed ones, as few as 20 evenly distributed RBDs per VLP could elicit up to 86% immunity of macrophage cells. The design provided a brand new tool for studying virus infection and immune activation with high programmability, which could also facilitate the development of highly effective vaccines. To sum up, the DNA nanostructures assembled with multiple viral-targeting aptamers designed according to the geometry of the virions or the essential surface glycoproteins possess unparalleled potential for the inhibition of existing and emerging fatal viruses.

FNAs focusing on virus genome

Beyond targeting the surface components of virions, binding to the viral genome is also a broad spectrum and potent therapeutic strategy, especially under the rapid mutation of SARS-CoV-2. Nucleic acid-based treatments, including siRNAs, miRNA, circRNAs, CRISPR-based technology, and chimeric oligonucleotides, could efficiently target the vital conserved viral genome and then degrade them, effectively inhibiting virus replication and further reducing the virus load in vivo. siRNA, usually selected to target highly conserved regions of virus and delivered by lipid polymers, nucleic acid frameworks, dendrimers, or other polyplexes,^{62 , 63 , 64 , 65} could effectively suppress virus infection either used alone or in combination therapy. Highly conserved region such as 5′ untranslated region and ORF1 are ideal sites that many siRNAs target.^{66 , 67} Traube et al. introduced an alkyne moiety at the 3′ end of the siRNA to enable chemical modification of the siRNA via Cu^I-catalyzed click chemistry.⁶⁸ Further modification resulted in a chimeric siRNA-ligand conjugate, which could be delivered to specific microtissues to prevent SARS-CoV-2 replication. Furthermore, to increase the stability and reduce the immune stimulation of naked siRNA, 2′-O-methyl, 2′-F, and other modified forms of siRNA were introduced. Chang et al. developed a fully modified siRNA C6G25S for safe, effective, and feasible therapeutics against SARS-CoV-2 infection via nasal drops or aerosol administration (Figure 8A).⁶⁹ Other than siRNA, miRNA could also effectively target complementary sequences in the cytoplasm, then degrade the specific viral RNA and block the translation process.^{70 , 71} circRNAs are non-coding RNAs that exist in all eukaryotes and the mimics could be designed as antisense-RNAs targeting viral genome RNA. As for the 5′ untranslated region, specific segments of which could be efficiently accessed by corresponding antisense-circRNAs, bring about up to 90% reduction of virus proliferation (reported by Bindereif and co-workers) (Figure 8B).⁷² The unusual metabolic stability of circRNAs opens up a new line of RNA-based antiviral therapeutics. The well-known CRISPR-Cas technology^{73 , 74} also plays an important role in broad-spectrum viral prophylaxis and treatments. The Qi group developed a CRISPR-Cas13-based strategy binding to conserved regions of the viral genome when COVID-19 just broke out, which could target more than 90% of all coronaviruses including SARS-CoV-2 and its major variants.⁷⁵ At that time, effective vaccines or antiviral agents for SARS-CoV-2 had not yet been developed, so CRISPR RNAs (crRNAs) held great potential in pan-coronavirus treatment (Figure 8C). Also, they built an online resource of CRSPR-based virus-targeting technology with high specificity, coverage, and efficiency for the community to combat the COVID-19 pandemic.⁷⁶ Recently, they demonstrated that the CRISPR-Cas13d-based viral genome-degrading system could effectively diminish the viral titer to 1% of that of the initial, including the recently emerging Omicron B.1.1.529 variant. In addition, the Cas13d system could significantly enhance the performance of various small molecular drugs.⁶⁰ Similar to the genome-targeting and degrading technology, such as CRISPR, chimeric oligonucleotides capable of recognizing viral genome and recruiting ribonuclease can also destroy the replication of virus (Figure 8D).^{61 , 77}

Figure 8.

Functional nucleic acids binding to the virus genome

(A) The mechanism of the fully modified siRNA C6G25S for viral genome silencing.⁶⁹ Copyright 2022, John Wiley & Sons.

(B) The design of antisense circRNAs that target the 5′ untranslated region of SARS-CoV-2.⁷² Copyright 2021, Oxford University Press.

(C) The mechanism of CRISPR-Cas13 system in broad-spectrum virus genome degradation.⁶⁰ Copyright 2022, Springer Nature.

(D) Chimeric oligonucleotides for recognizing the viral genome and recruiting ribonuclease.⁶¹ Copyright 2021, John Wiley & Sons.

Apart from applications in therapeutic strategies, gene-based vaccines, also consisting of FNAs, are crucial prophylactic ways, providing thorough protection against severe infection. Conventional strategies, including inactivated viral, live attenuated viral, and protein subunit vaccines, have exhibited successful outcomes, but their shortcomings including limited cross-protection and immunogenicity show the need for more effective vaccines eliciting stronger immune response. Gene-based vaccines including viral vectors and nucleic acid vaccines genetically encode specific antigens, possessing several advantages over traditional vaccines: potent humoral and cellular protective immunity, low production costs, and simpler and more rapid development.^{78 , 79} The viral vector vaccine consists of a target viral gene and a viral vector, often including measles virus, adenovirus (Ad), and vesicular stomatitis virus. Due to the existence of viral components, these vaccines could efficiently accomplish the gene transduction process because of their innate infection process. As a result, strong immunoreaction would be stimulated without the aid of adjuvants. Representative vector vaccines have been developed by the University of Oxford/AstraZeneca (AZD1222), CanSino Biologics/Beijing Institute of Biotechnology (Ad5-nCoV), Beijing Wantai Biological Pharmacy/Xiamen University (DelNS1-2019-nCoV-RBD-OPT1), and Janssen Pharmaceutical Companies (Ad26Cov2-S). Among them, vector vaccines from CanSino and Wantai have been recently administered intranasally to induce mucosal immunity.⁷⁹ The nucleic acid vaccines can be divided as DNA and mRNA vaccines. Without viral vector, the nucleic acids need first be delivered by plasmids or polymers into cells, sometimes in the company of adjuvants, then transcribed into mRNA (vaccines should omit this procedure), and finally translated into the antigen of interest. Upon the outbreak of COVID-19, various mRNA vaccines were developed by Moderna/NIAID (mRNA-1273), BioNTech/Fosun Pharma/Pfizer (BNT162a1, b1, b2, c2), and People’s Liberation Army (PLA) Academy of Military Sciences/Walvax Biotech (ARCoV).⁷⁹ As for DNA vaccines, due to unclear safety and efficacy in humans, they have not been administrated in humans.⁸⁰ With the constant mutating of SARS-CoV-2, researchers have promptly developed bivalent mRNA vaccines to provide more comprehensive protection against different variants, especially Omicron.⁸¹ A bivalent booster vaccine (mRNA-1273.211) encoding the ancestral SARS-CoV-2 and Beta variant spike proteins could provide protection against ancestral SARS-CoV-2 and Beta, Omicron BA.1, and Delta variants.⁸² Another bivalent mRNA vaccine (mRNA-1273.214) containing the ancestral SARS-CoV-2 and B.1.1.529 (Omicron) has been currently authorized for use in multiple countries for boosting, eliciting strong neutralizing antibody responses against epidemiologically dominant subvariants, including Omicron BA.1, BA.4, BA.5, and BA.2.75.⁸³ These bivalent booster vaccines can induce potent, durable, and broad antibody responses, providing comprehensive protection in the background of constant mutating. To sum up, the viral genome-targeted strategies mentioned above are promising alternatives to the existing vaccination and antiviral agents, which possess rational designability and editability and can be easily tailored to match with other fatal viruses.

Conclusions and outlook

In summary, we have surveyed and highlighted the recent advances in FNA-based therapeutics against SARS-CoV-2 infection. Since the outbreak of the COVID-19 pandemic, a variety of therapeutic and prophylactic strategies have been developed, including antibodies, small-molecule drugs, and vaccines. However, facing constant mutation of SARS-CoV-2, new therapeutics to keep up with the rapid evolution of the virus and to overcome immune escape are in high demand. The FNA-based therapeutics stand out because of their several distinct advantages, such as short screening process, low cost, lot-to-lot consistency, versatile chemical modification, high flexibility and editability, weak immunogenicity, etc., and could make up for the deficiency of the existing therapeutics. Furthermore, the relevant technologies have already been studied in various areas such as biosensing, bioimaging, cancer immunotherapy, and inflammation therapy. Learning from past applications, the FNA-based therapeutics could also find their way in combating SARS-CoV-2.

In this review, various potent FNA-based therapeutics have been surveyed, including nucleic acid aptamers, relevant DNA framework, functional RNA (siRNA, miRNA, circRNAs), viral-related CRISPR-Cas system technology, and gene-based prophylactic vaccines. For effective antiviral therapeutics, on one hand, the most straightforward way is to interrupt the initial entry into the host cells. So, the surface of the virion, including vital glycoprotein subdomains (RBD, NTD, and S2) and dense glycan shields (high-mannose modifications), could be promising targets for directly blocking the virus-cell interaction or membrane fusion. Among them, functional DNA frameworks modified with virus-targeting aptamers had already been studied before the COVID-19 pandemic and were successfully employed in SARS-CoV-2 inhibition. Also, the functional DNA frameworks could serve as an antigen display platform for exploration of the immune stimulation mechanism or elicitation of robust protective immune responses. In addition, the glycan shield of viruses is a new noteworthy target for broad-spectrum virus inhibition and much deserves in-depth investigation. On the other hand, after the viruses enter into the host cells, targeted therapy should be focused on the viral genome and the virus-associated enzyme, which are responsible for viral replication and assembly. Certain genes could be effectively degraded, and the related enzymes could be blocked through functional RNA and the related CRISPR-Cas systems, then the replication process would be aborted and further infection inhibited. As for protection in the case of severe infection, gene-based vaccines including DNA/mRNA vaccines and viral vector vaccines play a pivotal role all over the world. These novel FNA-based strategies provide a new access to the treatment and prevention of SARS-CoV-2 as well as its variants and other emerging fatal viruses in the future.

Finally, despite major breakthroughs in FNA-based therapeutics for SARS-CoV-2 infection, there are still some challenges that should not be ignored. Firstly, the low inherent serum stability, low efficiency of delivery to target, and differences in binding specificity under different conditions prompt more understanding of in vivo behaviors of these FNAs. Possibly, the proper modification and delivery vehicle can provide accurate and sustained long-term therapeutic effects. In addition, developing FNA-based formulations targeted to organs and tissues are also important for precise treatment. Secondly, the lack of in vivo experiments makes critical parameters, such as pharmacokinetics, immunogenicity, and toxicity, less clearly defined, which hinders the clinical and related translational applications. In vivo studies in rats, and larger animal models such as dogs or non-human primates, are needed to fill this gap. Finally, more knowledge bases and characterization should be timely updated and standardized, as well as full disclosure to all related researchers. Further scaled-up production of FNAs with defined physicochemical, immunological, and pharmacokinetic properties may accelerate the translation and clinical studies, which also require a concerted and coordinated effort across multiple stakeholders. If efforts are made to overcome the aforementioned challenges, FNA-based therapeutics for combating fatal viruses, including but not limited to SARS-CoV-2, will open up a brand new avenue, providing new insights for virus inhibition. We hope this review will motivate the development of FNA-based therapeutics in universal virus inhibition.