Skip to main content
Tissue Barriers logoLink to Tissue Barriers
. 2022 Apr 20;11(1):2064179. doi: 10.1080/21688370.2022.2064179

Transmigration of macrophages through primary adult rat Sertoli cells

Hassan Kabbesh a, Muhammad A Riaz a, Alexandra D Jensen b, Georgios Scheiner-Bobis c, Lutz Konrad a,✉
PMCID: PMC9870002  PMID: 35442143

ABSTRACT

The blood testis barrier (BTB) is often studied with isolated immature Sertoli cells (SCs), transepithelial resistance (TER) measurements and FITC dextran diffusion assays. Recently, it was found that even in the absence of SCs, only few immune cells enter the seminiferous tubules. Thus, in this study, we evaluated the testicular immunological barrier (TIB) in vitro by transmigration of macrophages through SCs with and without peritubular cells (PCs) and with or without matrigel (MG). Primary PCs were isolated from adult rat testis and kept in mono- or co-cultures with the conditionally reprogrammed primary adult Sertoli cell line (PASC1) from rat that has been recently generated by our group. Rat monocytes isolated from fresh blood were differentiated into M0 macrophages, and after polarization to M1 or M2 macrophages characterized by gene expression of CXCL11 and TNF-α for M1, or CCL17 and CCL22 for M2. Transmigration of LeukoTracker-labeled M0, M1, and M2 macrophages through mono- and co-cultures of PCs/SCs with and without MG demonstrated that SCs are the main constituent of the TIB in vitro with only a negligible contribution of PCs or MG. Moreover, M2 macrophages showed less migration activity compared to M0 or M1. Treatment of SCs with testosterone (T) showed positive effects on the barrier in contrast to negative effects by interleukin-6 (IL-6) or tumor necrosis factor-α (TNF-α). The new transmigration model is suitable to evaluate transmigration of macrophages through a barrier consisting of testicular cells and can be applied to study the integrity of testicular barriers with respect to immunological aspects.

KEYWORDS: Sertoli cells, blood testis barrier, tight junctions, macrophages, transmigration

Introduction

Spermatogenesis is a consecutive process generating hundreds of millions of sperm daily in adult males and takes place in the seminiferous tubules under the regulation of hormones and other factors.1 During spermatogenesis, spermatogenic cells express molecules which could be identified as “foreign” by the immune system, thus, the blood testis barrier (BTB) formed between Sertoli cells (SC) protect these advanced auto-immunogenic germ cells from the immune system and thus preserve the immune-privileged environment of the testis.1,2 Immune-privileged sites are found not only in testis, but also in the eye, the central nervous system, placenta and temporarily in the tumor-draining lymph nodes.3 Testis injuries may result in orchitis which causes infiltration of leukocytes into the seminiferous tubules and subsequent damage of the germ cells possibly resulting in infertility.4

Several studies have demonstrated that localized active immunosuppression plays a vital role in the establishment and maintenance of testicular immune-privilege. Mechanisms involved in the establishment of immune-privilege include high levels of intra-testicular androgens, regulatory T cells, testicular macrophages in the interstitial space and immunosuppressive properties of SCs.5,6

Immune-regulatory properties of SCs are achieved through secretion of immunosuppressive factors providing immune protection even of co-transplanted tissues/organs.2,5–8 In addition, phagocytic removal of apoptotic germ cells by SCs is considered to be one of the most important factors to sustain testis immune-privilege because damaged germ cells may induce inflammatory responses in the testis.9,10

The integrity of the BTB as a physical and a physiological barrier model in vivo and in vitro has been sufficiently described,11 however in vitro studies with respect to the testicular immunological barrier (TIB) are still lacking.12 To date, nearly all previous studies have investigated the formation of the BTB by immature SCs, however, studies with adult SCs are scarce. Recently, we could demonstrate that adult SCs are also the main constituents of the testicular barrier whereas the contribution by peritubular cells (PCs) was negligible.13 Using an in vivo mouse model, it was revealed that even in the absence of SCs, only very few immune cells enter the seminiferous tubules.14

In the rat testis CD163-positive M2 macrophages represent almost 80% of testicular macrophages (TM), whereas CD68-positive/CD163-negative M1 macrophages represent 20%.15 In contrast to other tissue macrophages, TM polarize toward M2 phenotype after classical activation with lipopolysaccaride (LPS) and/or interferon-gamma (IFN-γ) or demonstrate tolerogenic characteristics after alternative activation with interleukin-4 (IL-4).16,17 This phenomenon is evidenced by secretion of high quantities of the anti-inflammatory cytokine IL-10, low quantities of pro-inflammatory cytokines INF-α and IL-12 and loss of the capability to secrete nitric oxide (NO).16,17

In this study, we present an in vitro model of the testicular barrier to study transmigration of the different M0, M1 and M2 macrophages through a monolayer of adult rat SC, PC or a co-culture of both cell types. This could help to uncover mechanisms and molecules that contribute to the establishment and maintenance of immune-privilege in the testis and how this might be related to male infertility.

Material and methods

The study was approved by the local committee on the Ethics of Animal Experiments of the Justus Liebig University (permit number: M_695 Giessen, Germany). All experiments were performed in accordance with relevant guidelines and regulations.

Isolation of rat blood-derived-monocytes (RBDM) and purity assessment

RBDM were isolated according to de Almeida et al.18 with some modifications. Adult male Sprague Dawley rats ((Crl:CD (SD)IGS; Charles River, Germany) weighing 150–200 g were anesthetized with 5% isoflurane and sacrificed (Abbott, Germany). Peripheral blood was collected directly from the heart into S-Monovette 2,7 mL tubes prepared with EDTA K3 (Sarstedt, Germany) as an anti-coagulant. The collected blood was diluted 1:2 with phosphate buffered saline (PBS, Gibco) and mononuclear cells were purified with gradient centrifugation (800 xg, 20 min, no brakes) with LymphoprepTM gradient (Stemcell, Norway) at room temperature (RT). Then cells were aspired from the middle white layer of the interface and washed 2 times with PBS with gradually decreasing centrifugation (600 × g then 450 × g) to remove the lymphocytes. The enriched RBDM fraction was cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal calf serum (FCS, Gibco), 1% streptomycin/penicillin (P/S; Gibco), 1 mM sodium pyruvate (Gibco), 1% HEPES (Gibco), 1% MEM non-essential amino acid solution (Sigma-Aldrich) and 50 µM 2-mercaptoethanol (Gibco) in a humidified incubator (37°C, 5% CO2). Cell viability was examined by trypan blue (Gibco) staining using a TC10 cell-counter (BioRad). Approximately 1 × 106 cells were seeded into each well of a 24-well-plate and after 6 h, cells were carefully washed with PBS. The attached cells were stained with cluster of differentiation 68 (CD68, a cytoplasmic marker specific for rat monocytes)19,20 to assess the purity of the RBDM, which was > 95% with very few contaminating lymphocytes which could be distinguished from RBDM by their weak staining of CD68 in addition to their small size.

To test the response of monocytes to LPS,18,21 5 × 105 RBDM cells were seeded into a 24-well-plate and incubated with RPMI 1640 medium containing 10% FCS, 1% P/S and 10 ng/mL LPS (Sigma-Aldrich) for 48 h. The controls were only incubated in medium without LPS. After 48 h RNA was collected and gene expression analyzed with qRT-PCR.

Differentiation of RBDM into M0 macrophages and polarization into M1 and M2 macrophages

For differentiation and polarization of RBDM the protocol of Spiller et al.22 and the recommendations of the manufacturer PromocellTM were used with some minor modifications. Briefly, 1 × 106 RBDM cells/mL were cultured for 5 days in RPMI 1640 containing 10% FCS and 50 ng/mL mouse macrophages colony stimulating factor (M-CSF; premium grade; 130–101-700; Miltenyi Biotec) in 25 cm2 ultra-low attachment flasks in a humidified incubator (37°C, 5% CO2) to differentiate them into M0 macrophages. Medium was changed after 5 days.

At day 6, different substances were added to achieve polarization: To get M1 macrophages, M0 macrophages were treated with 10 ng/mL LPS and 50 ng/mL recombinant interferon gamma (IFN-γ; C-60724; Promocell); and for M2 macrophages, 40 ng/mL recombinant interleukin-4 (IL-4; C-61421; Promocell) and 20 ng/mL recombinant interleukin-13 (IL-13; C-62312; Promocell). Macrophages were polarized for 48 h in ultra-low attachment 25 cm2 flasks. Afterward RNAs were collected for qRT-PCR or the cells were detached using PBS containing 5 mM EDTA for 40 min at 4°C as published.13 Instead of enzymatic detachment, we used EDTA to avoid alterations in the macrophages as indicated in to the protocol of Chen et al.23 After counting with TC10,13 cells were used in the transmigration assay.

Primary adult rat Sertoli cells PASC1 and peritubular cells

Primary adult rat SCs and PCs were isolated using enzymatic digestion and conditionally reprogrammed primary adult rat SCs (PASC1) were generated as described.13 Briefly, one adult rat testis was used to generate SCs and PCs by a 2-step enzymatic digestion. Supernatants enriched with PCs were centrifuged and the re-suspended pellet cultured with complete Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12; Gibco) supplemented with 10% fetal calf serum (FCS), 1% penicillin/streptomycin (P/S) and 1% insulin transferrin-selenium (ITS) in a humidified incubator (37°C, 5% CO2) for 3 days and then used in the experiments described below. SCs were isolated with Percoll gradients and digested until completion. Complete DMEM/F12 was added and after filtration through 100-µM cell strainers SC clusters were collected from the filter, washed, centrifuged and cultured with conditioned medium (CM) prepared from irradiated 3T3-J2 mouse fibroblasts supplemented with 10 µM ROCK inhibitor Y-27632. Hypotonic shock was performed at day 3 and CM supplemented with ROCK inhibitor was changed after 3 days. SC characterization and purity assessment was done starting from day 5.13 The generated pure adult rat SCs were named PASC1 and CM was replaced with complete DMEM/F12 3 days before using PASC1 in any experiment.13

Conditional reprogramming (CR) allows long-term cultivation of primary epithelial cells with only very few changes of cell characteristics and maintenance of cell lineage commitment.24,25 The CR method consists of co-culture of irradiated mouse fibroblasts as feeder cells or conditioned medium generated from them together with epithelial cells in the presence of the ROCK inhibitor Y- 27632.26 This treatment eliminates contaminating stromal cells and induces cell reprogramming of epithelial cells to long-term proliferation.27 We used CR to generate the PASC1 cells, which showed typical SC characteristics such as GATA1, clusterin, transferrin, SOX9 and androgen receptor expression without significant alterations during long-term propagation.13

Immunofluorescence (IF)

3.0 × 104 RBDMs were plated into 24-well-plates (1 mL/well) and incubated for 6 h at 37°C and 5% CO2. Cells were rinsed with PBS and fixed with 100% ice-cold methanol (Roth) on ice for 10 min and washed with PBS three times for 5 min. Then they were incubated in blocking solution (PBS with 3% BSA and 0.3% Triton X-100, both from Sigma-Aldrich) for 1 hr at RT. The blocking solution was replaced by fresh blocking solution containing the primary antibody CD68 (diluted 1:250; ab283654, abcam) and incubated overnight at 4°C. After washing 3 times with PBS for 3 min on an orbital shaker at RT, fresh blocking solution with the appropriate Alexafluor 488-conjugated donkey anti-rabbit secondary antibody (1:250; A-21206; Life Technologies) was added for 1 hr at RT. After washing 3 times with PBS, images were obtained using an inverse Olympus IX81 microscope equipped with a fluorescence system.

RNA extraction and quantitative real time PCR (qRT-PCR)

Primers were designed with http://www.ncbi.nlm.nih.gov/tools/primer-blast (accessed 10th May 2020) and were all intron-spanning (Table 1). Total RNA was isolated from RBDM with the RNeasy Mini-Kit (Qiagen) and subjected to DNase I treatment as described by the manufacturer. The Reverse Transcription-System first strand cDNA synthesis kit (Invitrogen) was used for cDNA synthesis as recommended. Real-time PCR amplification was done in duplicates with iQ TM SYBR Green Super-mix (Bio-Rad) on the iCycler iQ System (Bio-Rad). After an initial heating at 94°C for 5 min, 40 cycles were performed: denaturation at 94°C for 14 sec, annealing at 59°C for 30 sec, and extension at 72°C for 15 sec. A final extension at 72°C was done for 10 min. Gene expression was measured after reaching the ct value and calculated using the Delta – Delta Ct method. GAPDH was used for normalization (Table 1).

Table 1.

List of primer sequences used for qRT-PCR.

Genes (species)
and Acc. No
Sequence (5’->3’) AT Size (bp)
GAPDH (rat)
XM_039107008.1
GACCCCTTCATTGACCTCAAC fwd
GATGACCTTGCCCACAGCCTT rev
59°C 561
CXCL11 (rat)
NM_182952.2
CTGCTCTCTGCGAAGAAA fwd
GTCAGCTTCTTGGCACAG rev
59°C 400
TNF-α (rat)
XM_034524600.1
GAACTCAGCGAGGACACCAA fwd
GCTTGGTGGTTTGCTACGAC rev
59°C 460
CCL17 (rat)
NM_057151.1
TGATGTCACTTCAGATGCTGC fwd
GGACAGTCTCAAACACGATGG rev
59°C 201
CCL22 (rat)
NM_057203.1
AGGATGCTCTGGGTGAAGAA fwd
TAGGGTTTGCTGAGCCTTGT rev
59°C 98

AT; annealing temperature; Acc. No., Accession number; fwd, forward; rev, reverse; bp, base pairs; GAPDH, Glyceraldehyde 3-phosphate Dehydrogenase; CXCL11, C-X-C motif chemokine ligand 11; TNF-α, tumor necrosis factor alpha; CCL17, CC chemokine ligand 17; CCL22, CC chemokine ligand 22.

Measurement of transepithelial resistance (TER)

TER measurement was performed as reported.28 Briefly, 6.0 × 104 PASC1 cells/cm2 were seeded on 0.4 μm inserts for 24-well plates (Greiner) and cultured for 48 h until they reached confluency. Then, 10 nM testosterone (T; Sigma-Aldrich), or 200 pg/mL IL-6 (D-61632; Promokine) or 10 ng/mL recombinant TNF-α (C-63719; Promokine) were added to the inserts. Controls received only vehicle (ethanol for T and water for IL-6 or TNF-α). TER measurements were done with a Millicell ERS-2 epithelial Volt-Ohm meter (Merck Millipore). Ω× cm2 was calculated according to the protocol of the manufacturer and by setting the resistance of cell-free inserts to zero.

Transmigration assay of macrophages

The CytoselectTM transmigration assay kit (CBA-212; Cell Biolabs, San Diego, USA) was used following the manufacturer’s protocol. Briefly, PASC1 cells, PC or a co-culture of both were seeded on pre-coated inserts with matrigel (MG; 354234; Corning) or without coating in 500 µl complete DMEM/F12. Controls were performed with medium only. For coating, 9 µg/cm2 MG in cold medium was added on top of the inserts and incubated in a humidified incubator (37°C, 5% CO2) for 1 h until solidification of MG. Washing with PBS was done before use. After 48–72 h, cells or co-cultures formed monolayers and PASC1-only (without MG coating) inserts were treated with 10 nM T, 10 ng /mL TNF-α or 200 pg/mL IL-6 for 48 h. Then, treatments and controls were used for the transmigration assay.

For this, M0, M1 or M2 macrophages were detached as previously mentioned and collected separately at a concentration of 1.0 × 106 cells/mL in RPMI 1640 containing 0.5% FCS (serum-low medium). 2 µl of 500× LeukoTrackerTM (CBA-212; Cell Biolabs) to 1 mL of macrophages was added and macrophages were incubated for 1 h at 37°C and 5% CO2. Next, macrophages were centrifuged at 400 × g for 2 min, the medium aspired and cells were washed twice with serum-low medium and reconstituted at 1.0 × 106 cells/mL with serum-low medium. The medium was removed from the inserts without disturbing the monolayer and the inserts transferred to a new 24-well plate containing 500 µl of RPMI 1640 (plus additives) in addition to 100 ng/mL Macrophage chemoattractant protein-1 (MCP1). For the transmigration assay, 100 µl of 1.0 × 105 labeled M0, M1 or M2 macrophages were added to each insert and incubated for 6 h at 37°C and 5% CO2. After migration, the upper surface of each membrane was cleaned with a cotton swab without disturbing the membrane. 400 µl of the bottom medium containing the transmigrated macrophages were transferred to a new well containing 150 µl 4× lysis buffer (CBA-212; Cell Biolabs). Cells attached to the bottom surface of each membrane were removed and the swabs placed into this mixture and incubated for 5 min at RT with shaking (100 oscillations/min). Then 150 µl were transferred to black 96-well plates (655076, Greiner). Fluorescence intensity was measured at 480/520 nm (extinction/emission) in an ELISA reader (M200, Tecan). Quantification was done by serial dilutions (5.0 × 104, 2.5 × 104, 1.25 × 104, 0.625 × 104, 0.3125 × 104, 0.15625 × 104, 0.078125 × 104, 0.0390625 × 104, blank) of LeukoTrackerTM-labeled macrophages in serum-low medium. The cells (75 µL) were lysed with 75 µL of lysis buffer and measured in the ELISA reader as described. The blank of serum-low medium with lysis buffer was subtracted from the results. The OD values obtained allowed the calculation of the numbers of transmigrated macrophages.

Statistical analysis

All experiments were repeated independently for at least three times with duplicates. Means and SEM values of all experiments were used for analysis. Comparisons of the means between more than two groups were performed by one-way analysis of variance (ANOVA) followed by Dunnett or Tukey multiple comparison tests using GraphPad Prism software (Version 5.0, GraphPad Inc.), P ≤ .05 was considered significant.

Results

Isolation and characterization of rat blood-derived-monocytes (RBDM) and of M0, M1, and M2 after polarization

Freshly isolated primary RBDMs were stained with the monocyte-specific marker CD6819,20 and showed an intense cytoplasmic localization (Figure 1a). They could be easily distinguished from very few contaminating lymphocytes which are only DAPI-positive, in addition to their smaller size compared to RBDMs (Figure 1a,b). The purity of the isolated RBDMs was > 95% and ~5-6 × 106 cells could be isolated from each rat. Since monocytes respond to LPS stimulation by secreting large amounts of TNF-α,18,21 we treated RBDMs with LPS and found a strong increase in TNF-α gene expression compared to the untreated control (data not shown).

Figure 1.

Figure 1.

Staining of rat blood-derived monocytes (RBDM, green) with an antibody against cluster of differentiation 68 (CD68) indicated that the purity of RBDM was > 95%. (a,b). Only very few cells are CD68 negative (arrow). Nuclei were stained with DAPI (blue in A,B). Incubation of the monocytes/RBDM (c) with 50 ng/mL M-CSF for 6 days showed the morphological changes which occurred after differentiation into M0 macrophages (d). M0 macrophages are bigger, more elongated and attach tightly to the plastic surface compared to monocytes (c,d). Each bar represents the mean ± SEMs of three independent experiments performed in duplicates. Tukey’s multiple comparison test was used for statistical analysis; ***p < .001.

Freshly isolated RBDMs showed a diameter of ~6-22 µm in addition to a small and round cell shape (Figures 1A,b,c). After 5 days of treatment with M-CSF, the differentiated M0 macrophages demonstrated elongated and larger cell shapes and adhered tightly to the plastic surface of the plates (Figure 1d). All isolation, differentiation and polarization steps are summarized in Figure 2.

Figure 2.

Figure 2.

Overview of the isolation of rat blood-derived monocytes (RBDM), their differentiation into M0 macrophages, and polarization into M1 and M2 macrophages. All macrophages were used in transmigration assays through a monolayer of primary adult Sertoli cells (PASC1) or co-cultures of PASC1 and peritubular cells. D, days; RBDM, rat blood-derived monocytes.

After differentiation, M0 macrophages were polarized into pro-inflammatory M1 or anti-inflammatory M2 macrophages. qRT-PCR was used to analyze the expression of the M1-specific markers C-X-C motif chemokine ligand 11 (CXCL11) and TNF-α,22,29 the M2-specific markers CC chemokine ligand 17 (CCL17)22 and CC chemokine ligand 22 (CCL22).22,30 Both CXCL11 and TNF-α gene expression was highly and significantly increased in the pro-inflammatory M1 macrophages compared to M0 or M2 macrophages (Figure 3a,b). In contrast, gene expression of CCL17 and CCL22 was significantly increased in the anti-inflammatory M2 macrophages compared to M0 or M1 macrophages (Figure 3c,d).

Figure 3.

Figure 3.

Macrophages were polarized as indicated for 48 h and then expression of macrophage-specific genes was analyzed with qRT-PCR. M1 macrophages showed stronger gene expression of CXCL11 (a) and TNF-α (b) compared to M0 and M2 macrophages. In contrast, M2 macrophages showed stronger gene expression of CCL17 (c) and CCL22 (d) compared to M0 and M1 macrophages. Each bar represents the mean ± SEMs of three independent experiments performed in duplicates. Tukey’s multiple comparison test was used for statistical analysis; *p ≤ .05; **p < .01; ***p < .001.

Transmigration assay of macrophages through testicular cells

MCP1 is an important chemokine mainly produced by inflammatory and endothelial cells that regulates migration and infiltration of monocytes and macrophages.30–32 Thus, we tested MCP1 as a chemoattractant for macrophages in the transmigration assay and found that MCP1 increased the numbers of transmigrated macrophages in a dose-dependent manner (Figure 4). In our recent study, we could demonstrate that primary adult rat SCs are the main constituents of the testicular barrier in vitro.13 Therefore, we investigated the transmigration of polarized M0, M1, and M2 macrophages through a barrier composed of SCs and PCs, alone and together with or without matrigel (MG), to study the contribution of each cell type to the TIB in vitro. Our results revealed that PCs with or without MG had only a very slight effect on M0, M1, and M2 transmigration (Figure 5). Of note, transmigration of M2 macrophages was always significantly lower compared to M0 and M1 macrophages in all settings (Figure 5). In contrast, only PASC1 strongly and significantly attenuated transmigration of M0, M1, and M2 macrophages (Figure 5). Addition of MG or PCs with or without MG did not improve the barrier generated by PASC1 alone (Figure 5).

Figure 4.

Figure 4.

Concentration-dependent effects of MCP1 as macrophage chemoattractant in the transmigration assay after 6 h are shown. A concentration of 100 ng/mL MCP1 showed the best results regarding the number of transmigrated M0 macrophages compared to medium with 1% or 10% FCS. Each bar represents the means ± SEMs of three independent experiments performed in duplicates. Dunnett’s test was used for statistical analysis; **p < .01; ***p < .001 comparing control (1% FCS) with all MCP-1 treatments.

Figure 5.

Figure 5.

Comparison of transmigration of M0, M1, and M2 macrophages through matrigel (MG), peritubular cells (PC), and PASC1 alone or in different combinations. More M0 and M1 macrophages transmigrated through the PASC1 monolayer compared to M2 macrophages (a,b). PASC1 demonstrated the highest significant reduction on transmigration of all macrophage types. Co-culturing of PASC1 with PCs with or without matrigel did not further improve the PASC1 barrier (A,B). Each bar represents the means ± SEMs of three independent experiments performed in duplicates. Dunnett’s test was used for statistical analysis; **p < .01; ***p < .001 comparing control (no cells) with all other setups (A,B). MG, matrigel; PC, peritubular cells; NO, numbers.

Influence of cytokines on macrophage transmigration through the testicular barrier

In order to analyze the effects of SC cell-cell contacts on transmigration of macrophages, we focused on testosterone, IL-6 and TNF-α which have been published to exert different effects on the testicular barrier.13,33,34 Consequently, we tested these cytokines with the transmigration assay as described in the present manuscript. Compared to the untreated controls, T significantly increased the TER values on all days tested (Figure 6) In contrast, IL-6 and TNF-α decreased the TER values only on day 2 and day 3 (Figure 6). Concomitantly, transmigration of M0, M1, and M2 macrophages was significantly decreased through testosterone-treated PASC1 cells (Figure 7). The number of transmigrated M0, M1, and M2 macrophages was significantly increased after treatment with IL-6 or TNF-α (Figure 7) which correlated well with the decreased TER values (Figure 6). In all settings, significantly less M2 macrophages compared to M0 and M1 macrophages transmigrated through the PASC1 barrier (Figure 7).

Figure 6.

Figure 6.

Measurement of TER values of PASC1 with and without different treatments. Treating PASC1 with T increased the TER values time-dependently and significantly on days 1–3 compared to untreated controls (a,b). Treatment of a confluent monolayer of PASC1 with IL-6 or TNF-α decreased TER values time-dependently on days 1–3 and significantly on days 2 and 3 compared to untreated controls (A,B). Each bar represents the means ± SEMs of three independent experiments performed in duplicates. Dunnett’s test was used for statistical analysis. TER, transepithelial resistance; T, testosterone.

Figure 7.

Figure 7.

Quantification of transmigration of M0, M1, and M2 macrophages through PASC1 treated with different substances. Treatment with T significantly decreased transmigration of all three macrophage types through PASC1 (a,b) which again confirms the increased tightness of the barrier as shown in Figure 6. Treatments with IL-6 and TNF-α resulted in significantly increased macrophage transmigration (A,B). Comparison of the controls (ctrl) and treatments demonstrated that more M0 and M1 macrophages significantly transmigrated in contrast to M2 macrophages (A,B). Each bar represents the mean ± SEMs of three independent experiments performed in duplicates. Ctrl, control; T, testosterone; NO, numbers.

Discussion

The BTB is supposed to be one of the tightest blood-tissue barriers.35 Recently, it was found in in vivo studies that even in the absence of SCs, only very few immune cells enter the seminiferous tubules when PCs are present.14 Thus, in this study we evaluated the testicular barrier in vitro by transmigration of macrophages through SCs with and without PCs.

Using the newly established PASC1 cell line, we recently demonstrated that adult SCs are the main component of the testicular barrier in vitro.13 In this study, we further confirmed that adult SCs are also the main cell type to attenuate transmigration of macrophages. No significant improvements of the barrier could be observed in PCs or matrigel used in different combinations with and without SCs. However, to achieve a suitable in vitro model of the BTB for use in studying macrophages transmigration, we had to modify existing protocols.

In testis, anti-inflammatory M2 macrophages are considered to constitute the major subpopulation (≈80%) of testicular macrophages (TM), whilst pro-inflammatory M1 macrophages represent only a small subset of TMs (≈20%) supposed to originate from circulatory monocytes.15 Thus, we sought to isolate monocytes from rat blood and after differentiation into M0 macrophages polarize them into M1 and M2 macrophages to be used for the transmigration assay. Therefore, RBDMs were freshly isolated from rat blood using gradual decreasing centrifugation and two washings to reduce contamination with lymphocytes. The final monocyte purification step was achieved by adherence to the plastic surface after 6 h and contaminating floating lymphocytes were eliminated by washing.18 The purity of the RBDMs was quantified by detection of the monocyte-specific marker CD68.19,20 The high purity we achieved with this protocol was similar to isolation of monocytes by Fluorescence-activated Cell Sorting (FACS).22,36 Furthermore, we found a significant increase in the mRNA level of TNF-α in RBDMs after LPS treatment, which is an additional confirmation of monocytes characteristics.18,21 After polarization of M0 macrophages into M1 and M2, gene expressions of M1-specific markers, CXCL11 and TNF-α, and M2-specific markers, CCL17 and CCL22, were highly increased confirming previous observations.22

MCP-1 is expressed in tissues during inflammation and is induced in a variety of cell types by pro-inflammatory mediators such as TNF-α, IL-1, or endotoxin.32,37 Importantly, MCP-1 exerts its effect through the chemokine receptor type 2 (CCR2). Once activated CCR2 triggers a set of cellular reactions that result in IP3 formation, Ca2+ release, and activation of protein kinase C,37,38 which may promote changes in the cytoskeleton of macrophages and facilitate spreading and migration of cells.39 The chemokine MCP-1 was used in the present study as a chemoattractant, which markedly increased migration of macrophages in a dose dependent manner corresponding with previous observations.40

Inflammatory factors and multiple cell types exert suppressive activities on autoimmunity and tissue-specific immune cell infiltration, which is established in the juvenile testis and maintained through adulthood.41 In our in vitro TIB model to study monocyte/macrophage transmigration, we showed that the TIB formation depends primarily on the SCs, whereas the contribution of PCs or MG to the TIB was negligible. Even co-culture of SCs with PCs with and without Matrigel, to mimic the ECM, did not improve the barrier in vitro.

Although our data show that our in vitro cell transmigration model is reliable, the migration of macrophages through the BTB into the seminiferous tubules lumen seems to be nearly completely inhibited in vivo.41 Similarly, Rebourcet et al.14 could demonstrate that testicular cells form a relatively strong BTB even in the absence of SC in vivo. Only very few immune cells infiltrated the seminiferous tubules. However, one has to keep in mind that in our transmigration model we used a very high number of macrophages (~1.0x105 macrophages on 2.0 × 105 SCs) in contrast to lower numbers of monocytes-macrophages normally found in the adult testis (7.9x106 monocytes-macrophages: 3 × 107 SCs).42,43 Nevertheless, with our transmigration model the contribution of all testicular cell types and of immune-suppressive molecules can be tested in vitro.

Finally, we also evaluated the transmigration model after treatment with pro-inflammatory cytokines such as TNF-α, IL-6 and the sex hormone T, which are known to regulate the barrier integrity.13,33,34 The effects of the TNF-α, IL-6 and T on the integrity of the barrier quantified by TER values corresponded with the results obtained from the macrophage transmigration. Remarkably, in all cases M2 macrophages demonstrated the weakest infiltration rate as well.

In conclusion, we present a simple and efficient method to isolate monocytes from blood and to differentiate and polarize them into M0 and M1/M2 macrophages, respectively. Furthermore, we established a reliable transmigration model to study the contribution of testicular cells and molecules into the barrier. Most importantly, we corroborated recent observations that adult SCs are the main cellular component of the testicular barrier. In addition, we found that SCs act as a primary physical barrier for transmigration of macrophages. Remarkably, anti-inflammatory M2 macrophages transmigrate less compared to M0 and M1 macrophages, an observation which warrants further studies.

Funding Statement

The study was financed by the Deutsche Forschungsgemeinschaft (DFG) within the framework of the International Research Training Group (IRTG) between Justus Liebig University of Giessen and Monash University, Melbourne (GRK 1871/1) on ‘Molecular pathogenesis of male reproductive disorders’.

Author contributions

Data curation and writing, H.K.; conceptualization and proofreading, M.A.R.; radiography, A.D.J.; funding acquisition, G.S.B. and L.K.; proofreading and supervision, G.S.B.; conceptualization, supervision and writing, L.K. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The study was approved by the local committee on the Ethics of Animal Experiments of the Justus Liebig University (number: M_695, Giessen, Germany) and all experiments were performed in accordance with relevant guidelines and regulations.

Disclosure statement

No potential conflict of interest was reported by the authors.

Data availability statement

Data are available from the corresponding author upon request.

References

  • 1.O’Shaughnessy PJ. Hormonal control of germ cell development and spermatogenesis. Semin Cell Dev Biol. 2014;29:1–14. doi: 10.1016/j.semcdb.2014.02.010. [DOI] [PubMed] [Google Scholar]
  • 2.Kaur G, Wright K, Verma S, Haynes A, Dufour JM. The good, the bad and the ugly of testicular immune regulation: a delicate balance between immune function and immune privilege. Adv Exp Med Biol. 2021;1288:21–47. [DOI] [PubMed] [Google Scholar]
  • 3.Mellor AL, Munn DH. Creating immune privilege: active local suppression that benefits friends, but protects foes. Nat Rev Immunol. 2008;8(1):74–80. doi: 10.1038/nri2233. [DOI] [PubMed] [Google Scholar]
  • 4.Schuppe H-C, Pilatz A, Hossain H, Meinhardt A, Bergmann M, Haidl G, Weidner W. Orchitis and male infertility. Urologe A. 2010;49(5):629–635. doi: 10.1007/s00120-010-2256-1. [DOI] [PubMed] [Google Scholar]
  • 5.Fijak M, Meinhardt A. The testis in immune privilege. Immunol Rev. 2006;213(1):66–81. doi: 10.1111/j.1600-065X.2006.00438.x. [DOI] [PubMed] [Google Scholar]
  • 6.Li N, Wang T, Han D. Structural, cellular and molecular aspects of immune privilege in the testis. Front Immunol. 2012;3:152. doi: 10.3389/fimmu.2012.00152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wyatt CR, Law L, Magnuson JA, Griswold MD, Magnuson NS. Suppression of lymphocyte proliferation by proteins secreted by cultured Sertoli cells. J Reprod Immunol. 1988;14(1):27–40. doi: 10.1016/0165-0378(88)90033-2. [DOI] [PubMed] [Google Scholar]
  • 8.De Cesaris P, Filippini A, Cervelli C, Riccioli A, Muci S, Starace G, Stefanini M, Ziparo E. Immunosuppressive molecules produced by Sertoli cells cultured in vitro: biological effects on lymphocytes. Biochem Biophys Res Commun. 1992;186(3):1639–1646. doi: 10.1016/S0006-291X(05)81596-7. [DOI] [PubMed] [Google Scholar]
  • 9.Nakanishi Y, Shiratsuchi A. Phagocytic removal of apoptotic spermatogenic cells by Sertoli cells: mechanisms and consequences. Biol Pharm Bull. 2004;27(1):13–16. doi: 10.1248/bpb.27.13. [DOI] [PubMed] [Google Scholar]
  • 10.Zhang X, Wang T, Deng T, Xiong W, Lui P, Li N, Chen Y, Han D. Damaged spermatogenic cells induce inflammatory gene expression in mouse Sertoli cells through the activation of Toll-like receptors 2 and 4. Mol Cell Endocrinol. 2013;365(2):162–173. doi: 10.1016/j.mce.2012.10.016. [DOI] [PubMed] [Google Scholar]
  • 11.Ghafouri-Fard S, Shoorei H, Mohaqiq M, Raza SHA, Taheri M. The role of different compounds on the integrity of blood-testis barrier: a concise review based on in vitro and in vivo studies. Gene. 2021;780:145531. doi: 10.1016/j.gene.2021.145531. [DOI] [PubMed] [Google Scholar]
  • 12.McCabe MJ, Foo CF, Dinger ME, Smooker PM, Stanton PG. Claudin-11 and occludin are major contributors to Sertoli cell tight junction function, in vitro. Asian J Androl. 2016;18(4):620–626. doi: 10.4103/1008-682X.163189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kabbesh H, Riaz MA, Jensen AD, Scheiner-Bobis G, Konrad L. Long-term maintenance of viable adult rat Sertoli cells able to establish testis barrier components and function in response to androgens. Cells. 2021;10(9):2405. doi: 10.3390/cells10092405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Rebourcet D, O’Shaughnessy PJ, Monteiro A, Milne L, Cruickshanks L, Jeffrey N, Guillou F, Freeman TC, Mitchell RT, Smith LB. Sertoli cells maintain Leydig cell number and peritubular myoid cell activity in the adult mouse testis. PLoSOne. 2014;9(8):e105687. doi: 10.1371/journal.pone.0105687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wang J, Wreford NG, Lan HY, Atkins R, Hedger MP. Leukocyte populations of the adult rat testis following removal of the Leydig cells by treatment with ethane dimethane sulfonate and subcutaneous testosterone implants. Biol Reprod. 1994;51(3):551–561. doi: 10.1095/biolreprod51.3.551. [DOI] [PubMed] [Google Scholar]
  • 16.Kern S, Robertson SA, Mau VJ, Maddocks S. Cytokine secretion by macrophages in the rat testis. Biol Reprod. 1995;53(6):1407–1416. doi: 10.1095/biolreprod53.6.1407. [DOI] [PubMed] [Google Scholar]
  • 17.Winnall WR, Muir JA, Hedger MP. Rat resident testicular macrophages have an alternatively activated phenotype and constitutively produce interleukin-10 in vitro. J Leukoc Biol. 2011;90(1):133–143. doi: 10.1189/jlb.1010557. [DOI] [PubMed] [Google Scholar]
  • 18.de Almeida MC, Silva AC, Barral A, Barral Netto M. A simple method for human peripheral blood monocyte isolation. Mem Inst Oswaldo Cruz. 2000;95(2):221–223. doi: 10.1590/S0074-02762000000200014. [DOI] [PubMed] [Google Scholar]
  • 19.Dijkstra CD, Döpp EA, Joling P, Kraal G. The heterogeneity of mononuclear phagocytes in lymphoid organs: distinct macrophage subpopulations in the rat recognized by monoclonal antibodies ED1, ED2 and ED3. Immunology. 1985;54:589–599. [PMC free article] [PubMed] [Google Scholar]
  • 20.Grau V, Scriba A, Stehling O, Steiniger B. Monocytes in the rat.Immunobiology. 2000;202(1):94–103. doi: 10.1016/S0171-2985(00)80056-X. [DOI] [PubMed] [Google Scholar]
  • 21.Van der Bruggen T, Nijenhuis S, van Raaij E, Verhoef J, van Asbeck BS. Lipopolysaccharide-induced tumor necrosis factor alpha production by human monocytes involves the raf-1/MEK1-MEK2/ERK1-ERK2 pathway. Infect Immun. 1999;67(8):3824–3829. doi: 10.1128/IAI.67.8.3824-3829.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Spiller KL, Wrona EA, Romero-Torres S, Pallotta I, Graney PL, Witherel CE, Panicker LM, Feldman RA, Urbanska AM, Santambrogio L, et al. Differential gene expression in human, murine, and cell line-derived macrophages upon polarization. Exp Cell Res. 2016;347(1):1–13. doi: 10.1016/j.yexcr.2015.10.017. [DOI] [PubMed] [Google Scholar]
  • 23.Chen S, So EC, Strome SE, Zhang X. Impact of detachment methods on M2 macrophage phenotype and function. J Immunol Methods. 2015;426:56–61. doi: 10.1016/j.jim.2015.08.001. [DOI] [PubMed] [Google Scholar]
  • 24.Chapman S, Liu X, Meyers C, Schlegel R, McBride AA. Human keratinocytes are efficiently immortalized by a Rho kinase inhibitor. J Clin Invest. 2010;120(7):2619–2626. doi: 10.1172/JCI42297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Suprynowicz FA, Upadhyay G, Krawczyk E, Kramer SC, Hebert JD, Liu X, Yuan H, Cheluvaraju C, Clapp PW, Boucher RC, et al. Conditionally reprogrammed cells represent a stem-like state of adult epithelial cells. Proc Natl Acad Sci U S A. 2012;109(49):20035–20040. doi: 10.1073/pnas.1213241109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Liu X, Krawczyk E, Suprynowicz F, Palechor-Ceron N, Yuan H, Dakic A, Simic V, Zheng YL, Sripadhan P, Chen C, et al. Conditional reprogramming and long-term expansion of normal and tumor cells from human biospecimens. Nat Protoc. 2017;12(2):439–451. doi: 10.1038/nprot.2016.174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yue J, Shukla R, Accardi R, Zanella-Cleon I, Siouda M, Cros MP, Krutovskikh V, Hussain I, Niu Y, Hu S, et al. Cutaneous human papillomavirus type 38 E7 regulates actin cytoskeleton structure for increasing cell proliferation through CK2 and the eukaryotic elongation factor 1A. J Virol. 2011;85(17):8477–8494. doi: 10.1128/JVI.02561-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Stammler A, Müller D, Tabuchi Y, Konrad L, Middendorff R. TGFβs modulate permeability of the blood-epididymis barrier in an in vitro model. PLoSOne. 2013;8(11):e80611. doi: 10.1371/journal.pone.0080611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Jaguin M, Houlbert N, Fardel O, Lecureur V. Polarization profiles of human M-CSF-generated macrophages and comparison of M1-markers in classically activated macrophages from GM-CSF and M-CSF origin. Cell Immunol. 2013;281(1):51–61. doi: 10.1016/j.cellimm.2013.01.010. [DOI] [PubMed] [Google Scholar]
  • 30.Brown Z, Strieter RM, Neild GH, Thompson RC, Kunkel SL, Westwick J. IL-1 receptor antagonist inhibits monocyte chemotactic peptide 1 generation by human mesangial cells. Kidney Int. 1992;42(1):95–101. doi: 10.1038/ki.1992.266. [DOI] [PubMed] [Google Scholar]
  • 31.Barna BP, Pettay J, Barnett GH, Zhou P, Iwasaki K, Estes ML. Regulation of monocyte chemoattractant protein-1 expression in adult human non-neoplastic astrocytes is sensitive to tumor necrosis factor (TNF) or antibody to the 55-kDa TNF receptor. J Neuroimmunol. 1994;50(1):101–107. doi: 10.1016/0165-5728(94)90220-8. [DOI] [PubMed] [Google Scholar]
  • 32.Sørensen TL, Ransohoff RM, Strieter RM, Sellebjerg F, Chemokine CCL2, and chemokine receptor CCR2 in early active multiple sclerosis. Eur J Neurol. 2004;11(7):445-449. doi: 10.1111/j.1468-1331.2004.00796.x. [DOI] [PubMed] [Google Scholar]
  • 33.Li MW, Xia W, Mruk DD, Wang CQ, Yan HH, Siu MK, Lee WM, Cheng CY. Tumor necrosis factor {alpha} reversibly disrupts the blood-testis barrier and impairs Sertoli-germ cell adhesion in the seminiferous epithelium of adult rat testes. J Endocrinol. 2006;190(2):313-329. doi:10.1677/ joe.1.06781. [DOI] [PubMed] [Google Scholar]
  • 34.Zhang H, Yin Y, Wang G, Liu Z, Liu L, Sun F. Interleukin-6 disrupts blood-testis barrier through inhibiting protein degradation or activating phosphorylated ERK in Sertoli cells. Sci Rep. 2014;4(1):4260. doi: 10.1038/srep04260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Mruk DD, Cheng CY. The mammalian blood-testis barrier: its biology and regulation. Endocr Rev. 2015;36(5):564–591. doi: 10.1210/er.2014-1101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Mossadegh-Keller N, Sarrazin S, Kandalla PK, Espinosa L, Stanley ER, Nutt SL, Moore J, Sieweke MH. M-CSF instructs myeloid lineage fate in single haematopoietic stem cells. Nature. 2013;497(7448):239–243. doi: 10.1038/nature12026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Proost P, Wuyts A, Van Damme J. Human monocyte chemotactic proteins-2 and −3: structural and functional comparison with MCP-1. J Leukoc Biol. 1996;59(1):67–74. doi: 10.1002/jlb.59.1.67. [DOI] [PubMed] [Google Scholar]
  • 38.Sallusto F, Baggiolini M. Chemokines and leukocyte traffic. Nat Immunol. 2008;9(9):949–952. doi: 10.1038/ni.f.214. [DOI] [PubMed] [Google Scholar]
  • 39.Larsson C. Protein kinase C and the regulation of the actin cytoskeleton. Cell Signal. 2006;18(3):276–284. doi: 10.1016/j.cellsig.2005.07.010. [DOI] [PubMed] [Google Scholar]
  • 40.Green TD, Park J, Yin Q, Fang S, Crews AL, Jones SL, Adler KB. Directed migration of mouse macrophages in vitro involves myristoylated alanine-rich C-kinase substrate (MARCKS) protein. J Leukoc Biol. 2012;92(3):633–639. doi: 10.1189/jlb.1211604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chan AY, Anderson MS. Central tolerance to self revealed by the autoimmune regulator. Ann N Y Acad Sci. 2015;1356(1):80–89. doi: 10.1111/nyas.12960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Hedger MA. Testicular leukocytes: what are they doing? Rev Reprod. 1997;2(1):38–47. doi: 10.1530/ror.0.0020038. [DOI] [PubMed] [Google Scholar]
  • 43.Bortolussi M, Zanchetta R, Belvedere P, Colombo L. Sertoli and Leydig cell numbers and gonadotropin receptors in rat testis from birth to puberty. Cell Tissue Res. 1990;260(1):185–191. doi: 10.1007/BF00297504. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data are available from the corresponding author upon request.


Articles from Tissue Barriers are provided here courtesy of Taylor & Francis

RESOURCES