Skip to main content
Wiley - PMC COVID-19 Collection logoLink to Wiley - PMC COVID-19 Collection
. 2022 Dec 30:10.1002/cjoc.202200486. Online ahead of print. doi: 10.1002/cjoc.202200486

Unlocking G‐Quadruplexes as Targets and Tools against COVID‐19

Geng Qin 1,2, Chuanqi Zhao 1,2, Jie Yang 1,2, Zhao Wang 1,2, Jinsong Ren 1,2, Xiaogang Qu 1,2,✉
PMCID: PMC9874442  PMID: 36711116

Comprehensive Summary

The applicability of G‐quadruplexes (G4s) as antiviral targets, therapeutic agents and diagnostic tools for coronavirus disease 2019 (COVID‐19) is currently being evaluated, which has drawn the extensive attention of the scientific community. During the COVID‐19 pandemic, research in this field is rapidly accumulating. In this review, we summarize the latest achievements and breakthroughs in the use of G4s as antiviral targets, therapeutic agents and diagnostic tools for COVID‐19, particularly using G4 ligands. Finally, strength and weakness regarding G4s in anti‐SARS‐CoV‐2 field are highlighted for prospective future projects.Inline graphic

Keywords: G‐quadruplexes, Viruses, Nucleic acids, Drug discovery, Aptamers


This review summarized the recent advance in the applicability of G‐quadruplexes (G4s) as antiviral targets, therapeutic agents and diagnostic tools for coronavirus disease 2019 (COVID‐19). Meanwhile, some challenges and perspectives were also presented, looking forward to advancing the G4s for COVID‐19 therapy and diagnosis.

graphic file with name CJOC-9999-0-g002.jpg

1. Introduction

The ongoing pandemic of coronavirus disease 2019 (COVID‐19), caused by a novel severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2),[ 1, 2 ] has resulted in more than 560 million infections and 6 million deaths worldwide by the end of July 2022 across 223 countries. Despite intensive countermeasures implemented around the world, the morbidity and mortality of COVID‐19 remain high. Notably, the SARS‐CoV‐2 genome undergoes persistent and rapid mutations,[ 3 ] resulting in the emergence and rapid spread of various SARS‐CoV‐2 variants that are more contagious. The Omicron variant has started to spread all over the world since the beginning of 2022 and is still emerging now. Despite implementing large‐scale vaccination efforts around the world, the SARS‐CoV‐2 variants have reduced the efficacy of vaccines, posing serious challenges to the control of the COVID‐19 pandemic.[ 4 ] Given that frequent emergence of various SARS‐CoV‐2 variants would limit the efficacy of vaccines and drugs, the development of more antiviral strategies and drugs for COVID‐19 is still a high priority.

The conserved secondary structural elements such as stem loop and G‐quadruplexes (G4s) structure in viral genome have been used as potential antiviral targets. G4s are a type of noncanonical nucleic acid secondary structure formed in guanine (G)‐rich DNA or RNA strands.[ 5 ] They are characterized by the stacking of two or more G‐tetrads, in which four Gs are connected through Hoogsteen‐type hydrogen bonds, centrally coordinated by monovalent or divalent cations,[ 6 ] typically K+, under physiological conditions (Figure 1A). The structure of G4s is highly polymorphic and its topology is determined by several factors, including the sequence length, location within the sequence, loop nature and strand stoichiometry, etc.[ 7 ] And the G4s can fold into different topological structures, such as parallel, antiparallel, and hybrid topological structures (Figure 1B), which is mainly defined by the strands orientation and the glycosidic bond between the G base and the sugar.[ 8 ] Generally, DNA G4s can form parallel,

Figure 1.

Figure 1

The structure and topologies of G4s. A) G‐quartet, a planar array of four guanines stabilized by pairwise hydrogen‐bonding and coordination by a cation at the center of the tetrad (M+). B) The representative topologies commonly found in G4 structures.

antiparallel, or hybrid conformations, while due to 2′‐hydroxyl group in the ribose sugar inducing steric hindrance, the anticonformation of glycosidic bond makes most of RNA G4 be locked in a parallel topology.[ 9 ]

Potential G4 formation sequences in the genome or transcripsome can be analyzed and identified by using bioinformatics,[ 10, 11, 12 ] G4 high‐throughput sequencing,[ 13 ] G4 ChIP‐sequencing with the specific G4 antibody,[ 14, 15 ] and G4‐RNA‐specific precipitation (G4RP) sequencing,[ 16, 17 ] etc. According to these G4 identification strategies, thousands of G4s have been found to widely exist in genomic regulatory regions and various RNAs, such as promoters, enhancer, CpG islands, splice and recombination sites, telomeric ends, microRNA, mRNA and long‐non coding RNA,[ 18, 19, 20, 21, 22, 23, 24 ] indicating their involvement in various biological processes. Indeed, G4s are now recognized for their necessary regulatory roles in several key biological processes, such as replication, transcription, translation and genome instability.[ 5 ] These findings encourage further exploration for understanding how G4‐related mechanisms may present opportunities for therapeutic intervention in human diseases. In the last years, G4s have been extensively investigated for regulatory roles in cancer and developed into antitumor therapeutic targets, resulting in the development and design of thousands of G4 ligands.[ 25, 26 ] Although no G4 ligands are currently approved by the US Food and Drug Administration (FDA), two G4 ligands CX‐3543 and CX‐5461 have entered clinical trials for cancer therapy.[ 27, 28 ] It is believed that in the near future, there will be FDA approved G4 ligands for cancer or other human diseases therapy. This evidence instigates the quest for investigating G4s in other organisms, such as protozoa,[ 29 ] bacteria,[ 30, 31 ] viruses,[ 32 ] yeasts[ 33 ] and plants.[ 34 ] Among them, the roles of viral G4s have been widely investigated and the emerging evidence indicated that G4s involved in regulating viral replication, transcription, assembly, virulence, etc., even G4s can co‐evolve with virus.[ 35, 36 ] In addition, several G4 ligands have shown potentially interesting antiviral activity in various viruses, including Hepatitis C virus (HCV),[ 37 ] the Zika virus (ZIKV),[ 38, 39 ] the Ebola virus (EBOV)[ 40 ] and SARS‐CoV‐2.

Over the past two years since the emergence of COVID‐19, the number of researches on the presence of G4s in SARS‐CoV‐2 genomes has boomed and several G4 ligands have shown excellent anti‐SARS‐CoV‐2 activity. On the other hand, while natural G4 structures are prospective targets for COVID‐19 therapy, synthetic G4‐forming oligonucleotides aimed at SARS‐CoV‐2 viral protein targets have also been developed as therapeutic agents and diagnostic tools. Herein, we aim at presenting, organizing and discussing an up‐to‐date close‐up of the literature on unlocking G4s as targets and tools against COVID‐19. In particular, we first focus on whether, how and where G4s fold in SARS‐CoV‐2 genome and the biological function of G4s during SARS‐CoV‐2 viral life cycle. Then, we describe several G4 ligands that have shown powerful anti‐SARS‐CoV‐2 activity. In addition, we also introduce the development of G4s therapeutic agents and diagnostic tools for SARS‐CoV‐2. Finally, we discuss the challenge and prospect of G4s as therapeutic targets and tools against COVID‐19.

2. Identification of G4s in SARS‐CoV‐2 Genome

SARS‐CoV‐2 is an enveloped positive‐sense RNA virus belonging to coronaviruses, which are characterized by an unusually large RNA genome and club‐like spikes that project from their surface. SARS‐CoV‐2 contains a non‐segmented, positive‐sense RNA genome of ~30 kb.[ 41 ] Due to the unusually large RNA genome, amount of conserved secondary structural elements exists in leader sequence and untranslated region (UTR) of SARS‐CoV‐2 genome, which play key regulatory roles in viral RNA replication and translation during viral life cycle.[ 42 ]

Before the ongoing pandemic of COVID‐19, Lavezzo et al. had reported the characteristics of G4s detected in several coronavirus genomes.[ 43 ] Another study has shown that SARS‐CoV‐1 viral protein Nsp3 can bind to G4s and involve in regulating viral replication and transcription.[ 44 ] These findings instigate the quest for investigating whether G4s exist in SARS‐CoV‐2 genomes, and whether targeting viral G4s may lead to the exciting possibility of inhibiting SARS‐CoV‐2 replication. Thus, since the appearance of SARS‐CoV‐2, a lot of G4 began to be identified in SARS‐CoV‐2 genome. Panera et al. identified 25 putative G4‐forming sequences (PQSs) in the genome of SARS‐CoV‐2 by Wuhan (NC_045512.2) at the earliest.[ 45 ] Bartas et al. evaluated all coronaviruses genomes and discovered much evidence of putative G4s sites.[ 46 ] In addition, they found that the host G4 binding proteins have potential for binding to SARS‐CoV‐2 RNA, indicating SARS‐CoV‐2 G4s as the promising druggable nucleic acids structures for COVID‐19 therapy. Although SARS‐CoV‐2 is a positive‐sense RNA virus, the negative‐ strand intermediates were synthesized by positive‐strand RNA to produce genomic and sub‐genomic RNAs following the translation and assembly of the viral replicase complexes.[ 41 ] Zhang et al. characterized some novel PQSs existing in the negative‐strand intermediates of SARS‐CoV‐2.[ 47 ] However, these studies did not prove the formation of these PQSs into G4s in vitro or in vivo through experiments.

Subsequently, by performing multiple biophysical techniques and molecular biology assays, several PQSs in SARS‐CoV‐2 genome were well characterized and shown to fold into G4s in vitro and in live cells. For example, Cui et al. identified 7 PQSs in SARS‐CoV‐2 genome and proved that these PQSs can fold into RNA G4 structures by thioflavin T (ThT) Fluorescence turn‐on assays and circular dichroism (CD) spectroscopy.[ 48 ] Moreover, the author showed that G4 ligands BRACO‐19 and TMPyP4 can block G4‐based gene expression. Ji et al. confirmed that SARS‐CoV‐2 PQSs at positions 13385 and 24268 can form RNA G4 structures in vitro and interact with viral helicase (nsp13), indicating an attractive approach against SARS‐CoV‐2 by targeting viral helicase and G4s.[ 49 ] Belmonte‐Reche et al. predicted both PQSs and potential i‐Motifs in the SARS‐CoV‐2, and proved their formation in vitro by 1H nuclear magnetic resonance (NMR) analysis.[ 50 ]

Among the identified SARS‐CoV‐2 G4s, RG‐1 at position 28903 of SARS‐CoV‐2 genome is the best‐known G4, which is the first G4 that is proven to fold into RNA G4 structures both in vitro and in live cells by Qu's group.[ 51 ] First, they found that RG‐1, which locates in the coding sequence (CDS) region of SARS‐CoV‐2 nucleocapsid phosphoprotein (N), can form stable unimolecular parallel RNA G4 structure in live cells.[ 51 ] G4 ligands PDP could significantly inhibit the expression of SARS‐CoV‐2 N by inducing the formation of RG‐1, suggesting that SARS‐CoV‐2 G4s may be promising therapeutic target for COVID‐19. Through an intensive investigation they found that targeting SARS‐CoV‐2 G4s by PDP and TMPyP4 can significantly inhibit SARS‐CoV‐2 infection in cell‐based assays.[ 52 ] And TMPyP4 showed more potent anti‐SARS‐CoV‐2 activity than PDP and can significantly ameliorate lung damage caused by SARS‐CoV‐2 infection in animal models.[ 52 ] These findings reveal the biological roles of viral RNA G4s in SARS‐CoV‐2 life cycle and highlight the potential of viral RNA G4s as a druggable target for COVID‐19 prevention and treatment.

Since the discovery of RG‐1 in SARS‐CoV‐2 genome, increasing studies focus on investigating RG‐1 with a deeper understanding. By using a multiscale approach combining quantum and classical molecular modeling, Miclot et al. reported the first calculated RNA G4 structure of RG‐1 and proved the stability of the RG‐1 G4 arrangement as well as its interaction with G4 ligands, such as PDP and CX‐3543.[ 53 ] Berberine is a potential anti‐SARS‐CoV‐2 drug and Oliva et al. investigated the binding properties of RG‐1 to Berberine compared to telomeric G4,[ 54 ] contributing to the development of G4 ligands that can discriminate between binding to DNA and RNA G4s. For understanding the relationship between COVID‐19 and other diseases such as Parkinson's disease and type‐II diabetes mellitus, Mukherjee et al. investigated the interaction of RG‐1 with α‐Synuclein or the human islet amyloid polypeptide and found that these peptides can regulate the conformational equilibrium of the RG‐1,[ 55 ] suggesting their possible molecular underpinnings of the relationship between Parkinson's disease as well as type‐II diabetes mellitus and COVID‐19.

The potential regulatory mechanism of G4s in SARS‐CoV‐2 life cycle was schematically depicted in Figure 2, including viral RNA replication, RNA transcription, translation of viral proteins, etc. Briefly, G4s act as inhibition elements in the SARS‐CoV‐2 life cycle and inhibit both the viral replication and translation processes by impairing the elongating of RdRp and ribosomes, leading to hindering the production of viral RNA and proteins. G4‐specific ligands can bind and stabilize the G4s to enhance the inhibitory effects, which reveal the potential of viral G4s as a therapeutic target for COVID‐19. And we summarized the PQSs that have been predicted or verified in Table 1.

Figure 2.

Figure 2

The potential regulatory mechanism of G4s in SARS‐CoV‐2 life cycle. G4s act as inhibition elements in the SARS‐CoV‐2 life cycle and inhibit both the viral replication and translation processes by impairing the elongating of RdRp and ribosomes, leading to hindering the production of viral RNA and proteins. G4‐specific ligands can bind and stabilize the G4s to enhance the inhibitory effects, which is a promising antiviral therapeutic strategy for COVID‐19.

Table 1.

SARS‐CoV‐2 G4 identified with experimental evidence

G4 Position a Genome Sequence Ref.
1 +353 Nsp1 GGCUUUGGAGACUCCGUGGAGGAGG [48]
2 +644 Nsp1 GGUAAUAAAGGAGCUGGUGG [48, 52, 56]
3 +1574 Nsp2 GGUGUUGUUGGAGAAGGUUCCGAAGG [52]
4 +3467 Nsp3 GGAGGAGGUGUUGCAGG [50, 52, 56]
5 +13385 Nsp10 GGUAUGUGGAAAGGUUAUGG [48, 49, 51, 52]
6 +24215 S GGUUGGACCUUUGGUGCAGG [48]
7 +24268 S GGCUUAUAGGUUUAAUGGUAUUGG [48, 49]
8 +25197 S GGCCAUGGUACAUUUGGCUAGG [48]
9 +28903 N GGCUGGCAAUGGCGG [48, 50, 51, 52, 56]
10 –6011 — GGAUAUGGUUGGUUUGG [52]
11 –10015 — GGUGAUAGAGGUUUGUGGUGGUUGG [52]
12 –13963 — GGAUCUGGGUAAGGAAGG [56]
13 –23877 — GGAUAUGGUUGGUUUGG [56]
a

Positions are based on SARS‐CoV‐2 Jan. 2020/NC_045512.2 Assembly (wuhCor1).

3. G4 Ligands against SARS‐CoV‐2

In the last decade, great effort has been directed to develop the small molecule ligands targeting G4s, resulting in promising potential therapeutics for various human diseases. To date, a lot of small molecules have been proven to bind and stabilize G4s. In general, these small molecules are similar, characterized by a polycyclic planar aromatic scaffold with protonable side chains. They interacted with G4s through π‐π stacking and electrostatic interactions.[ 57 ] At present, the clinical applicability of some G4 ligands is presently being tested,[ 28 ] supporting the feasibility of G4‐based therapeutic strategy.

Despite great advances in antiviral field, the diseases caused by a variety of viruses are still the serious public health problem, such as the current COVID‐19 pandemic. The traditional development of vaccine and antiviral agents has been mainly focused on viral proteins,[ 58, 59, 60 ] whose antiviral efficacy is easily limited by the viral mutation. Given that most of predicted PQSs in viral genomes is high conservation, especially the Gs that is necessary to G4 formation,[ 43 ] targeting G4s in the viral genome by G4 ligands may potentially be effective against the emerging of mutant strains of viruses. Thus, the development of G4 ligands targeting viral G4s may pave the way for innovative strategies in the fight against viruses, especially in SARS‐CoV‐2.

In the section below, the G4 ligands so far reported to exert anti‐SARS‐CoV‐2 activity were described (Figures 3 and 4) and discussed on their discovery, general G4 binding ability and antiviral activity.

Figure 3.

Figure 3

Chemical structures of conventional G4 ligands tested for SARS‐CoV‐2 G4 binding.

Figure 4.

Figure 4

Chemical structures of other G4 ligands tested against SARS‐CoV‐2.

3.1. BRACO‐19

N,N0‐(9‐((4‐(dimethylamino)phenyl)amino)acridine‐3,6‐diyl)‐bis(3‐(pyrrolidin‐1‐yl)propanamide), is known as BRACO‐19. The acridine derivative BRACO‐19, which is one of the most studied G4 binding small molecules, has significant telomerase inhibition activity and high selectivity for G4s.[ 61 ] The earliest application of BRACO‐19 is cancer therapy. It can induce long‐term growth arrest of tumor and is the first G4 ligand to prove the activity against human xenograft tumor in animal models.[ 62, 63 ] In the last years, the antiviral activity of BRACO‐19 is also widely investigated. By targeting viral G4s, BRACO‐19 can inhibit replication and infection of various viruses, including human immunodeficiency virus (HIV),[ 63 ] Herpesviruses,[ 64 ] Hepatitis B virus (HBV),[ 65 ] Chikungunya virus (CHIKV),[ 66 ] etc. Recently, BRACO‐19 was employed in a GFP expression system to analyze the role of G4s in SARS‐CoV‐2, where it significantly inhibits the expression of GFP gene, suggesting an inhibiting effect of G4s in SARS‐CoV‐2 replication.[ 48 ] However, the antiviral effects of BRACO‐19 on the replication of live SARS‐CoV‐2 virus or pseudoviruses were not been evaluated, which deserve to be soon investigated in the future.

3.2. TMPyP4

Compound 5,10,15,20‐tetrakis‐(N‐methyl‐4‐pyridyl)porphyrin (TMPyP4) was used as G4‐specific stabilizer because of its suitable physical properties for stacking with the G tetrads.[ 67 ] TMPyP4 has been shown to significantly inhibit the activity of human telomerase[ 68 ] and also can decrease the expression of several proto‐ oncogenes by targeting their promoter G4s.[ 69 ] Thus, TMPyP4 has been identified as an attractive candidate for anticancer drug development. On the other hand, due to the availability of a negative control compound TMPyP2, TMPyP4 is widely employed as a tool for studying G4s.[ 7, 52, 70 ] TMPyP2 cannot stack on the G4 because of the steric‐hindrance effect, leading to no biological effects.[ 70 ] In viruses, TMPyP4 was also employed to investigate the roles of G4s in the life cycle of various viruses, such as HIV,[ 71 ] Hepatitis C virus (HCV),[ 37 ] Zika virus (ZIKV)[ 38 ] and Ebola virus (EBOV).[ 40 ] Importantly, these studies have shown the antiviral activity of TMPyP4 against multiple viruses by targeting G4s in cell‐based assays, including SARS‐CoV‐2. Qu's group[ 52 ] showed that TMPyP4 significantly inhibits SARS‐CoV‐2 infection by targeting SARS‐CoV‐2 G4s in cell‐based assays. Moreover, administration of TMPyP4 effectively suppresses SARS‐CoV‐2 replication and relieves lung lesions in two animal models. More importantly, the anti‐SARS‐CoV‐2 activity of TMPyP4 is more potent than remdesivir,[ 72 ] which is known as a gold‐standard treatment for COVID‐19, both in vitro and in vivo. Meanwhile, short‐term administration of TMPyP4 exhibited no observable toxicity at an effective antiviral concentration in vivo.[ 52 ] These findings instigate the quest for the clinical application potential of TMPyP4 as an antiviral agent against SARS‐CoV‐2. Consistently, Cui et al. had reported that TMPyP4 can inhibit the expression of GFP gene, which inserts the SARS‐CoV‐2 G4 sequence into it after translation start codon ATG, suggesting that TMPyP4 may target the SARS‐CoV‐2 G4 to inhibit the viral protein expression.[ 48 ] Interestingly, Liu et al. showed that TMPyP4 can bind and stabilize host TMPRSS2 mRNA G4 to suppress the translation of TMPRSS2 mRNA, leading to inhibition of SARS‐CoV‐2 infection,[ 73 ] suggesting that the anti‐SARS‐CoV‐2 effects of TMPyP4 may be due in part to TMPyP4 mediated decrease of TMPRSS2 expression by targeting TMPRSS2 RNA G4. Additional experiments will need to be performed to investigate the precise mechanism of TMPyP4 against SARS‐CoV‐2.

3.3. Pyridostatin and derivatives

Pyridostatin (PDS) is a well‐known G4 ligand that is rationally designed according to all the chemical features of effective small molecule G4 binders.[ 74 ] Due to the high G4 selectivity of PDS, it is considered a reference G4 ligand in G4 study. PDS can strongly stabilize telomeric G4s to exert the antitumor effects.[ 75 ] Some PDS derivatives with various modifications on PDS scaffold have also shown the excellent antitumor activity via a G4‐based mechanism of action.[ 75 ] Worth to note, the structural basis of pyridostatin and its derivatives specifically binding to G4s has been elucidated by NMR structures.[ 76 ] In antiviral research, PDS and its derivatives have been widely used against various viruses, [ 37, 77, 78 ] including the recent SARS‐CoV‐2. It has been reported that PDS and its derivatives carboxypyridostatin (cPDS) can significantly inhibit the SARS‐CoV‐2 pseudoviruses infection in cell‐based assays by inducing G4‐mediated decrease of TMPRSS2 expression.[ 73 ] More importantly, administration of PDS effectively hindered SARS‐CoV‐2 infection with no observable toxicity in vivo.[ 73 ] PDP, another PDS derivative, was used in SARS‐CoV‐2 G4 research. The PDP‐mediated stabilization of RG‐1 in SARS‐CoV‐2 genome significantly reduced the expression of SARS‐CoV‐2 N protein,[ 51 ] which plays a fundamental role in viral replication and assembly. Aithough several studies provided some evidence on the low toxicity of PDS and its derivatives in vivo in short‐term treatment, their bioavailability, druggability and clinic application should be carefully evaluated in the future.

3.4. Other G4 binding compounds

Several other G4 binding compounds have been tested as SARS‐CoV‐2 RNA G4s binding ligands or anti‐SARS‐CoV‐2 agents, including the bisquinolinium derivatives PheDC3 and PhenDH2, CX‐3543, ribavirin, benzoselenoxanthene analogues and berberine, etc. PheDC3 and PhenDH2 were shown to compete with SARS‐CoV‐2 SUD proteins for host cellular DNA or RNA G4s.[ 79 ] Given that disruption of the SARS‐CoV‐2 SUD/G4 interaction is a potential antiviral strategy, PheDC3 and PhenDH2 may be used as anti‐SARS‐CoV‐2 candidates. CX‐3543 is the first G4 binding compound tested in human clinical trials.[ 27 ] However, due to the bioavailability issues, it was withdrawn from further trials. Recent research showed that CX‐3543 can potentially be seen as an effective compound to stabilize SARS‐CoV‐2 RG1,[ 53 ] indicating the potential of CX‐3543 for COVID‐19 therapy. Ribavirin is a well‐known antiviral drugs used for treating COVID‐19.[ 80 ] Interestingly, a very recent work showed that the anti‐SARS‐CoV‐2 effects of ribavirin may be due in part to ribavirin mediated decrease of TMPRSS2 expression by regulating G4 at the TMPRSS2 promoter,[ 81 ] suggesting the key roles of both viral and host G4s during viral infection.

4. G4 for SARS‐CoV‐2 Detection

In recent years, due to high sensitivity, convenient operation, fast detection ability and low cost, G4s have been widely used to detect metal ions, enzymes, nucleic acids, etc. via the conformational changes.[ 82 ] In addition to targeting SARS‐CoV‐2 or host G4s for antiviral therapy, the G4s are also used for SARS‐CoV‐2 detection. Carvalho et al. designed two molecular beacons according to the conserved G4s in SARS‐CoV‐2 genome and developed a fast and simple strategy to detect SARS‐CoV‐2 in clinical samples.[ 83 ]

Utilizing the conformational changes of G4s, several other studies converted the concentration of SARS‐CoV‐2 RNA to the signal visualized by G4‐specific dye molecules or chromogenic reaction catalyzed by G4s combining with hemin.[ 84, 85, 86 ] Chen et al. integrated multi‐branch rolling circle amplification (mbRCA) signal amplification with the signal readout of the G4/iridium(III) system, achieving the rapid and specific detection of SARS‐CoV‐2.[ 84 ] Zhang et al. developed a SARS‐CoV‐2 protein detection system by using a rolling circle‐amplified G4/Hemin DNAzyme, whose detection limit was as low as 6.46 fg/mL.[ 86 ] Lee et al. develop a SARS‐CoV‐2 RNA detection system by integrating ternary rolling circle amplification (t‐RCA) and subsequent strand displacement amplification (SDA) coupled with G4‐generating RCA, which has high sensitivity and accuracy as an alternative to detection strategy based on qRT‐PCR.[ 85 ]

In addition, G4‐based aptamer has been developed for SARS‐CoV‐2 detection. Gupta et al. had developed a novel G4 aptamer based spike trimeric antigen test for SARS‐CoV‐2 detection, which has evinced a comparable performance with that of RT‐PCR based detection of SARS‐CoV‐2.[ 87 ] For the past few years, G‐based aptamers have been applied to treat various diseases, including virus infection.[ 88, 89, 90, 91 ] For examples, Blaum et al. identified a minimal G4‐based aptamer G(5)T that can inhibit the activity of 3C protease of hepatitis A virus (HAV) by directly binding to the C‐terminal β‐barrel of 3C protease, providing a novel strategy for HAV treatment.[ 92 ] Michalowski et al. found that a series of DNA aptamers with G4 structures can suppress HIV‐1 reverse transcriptases function.[ 93 ] Thus, the G4‐forming aptamer targeting SARS‐CoV‐2 spike protein may be not only used for SARS‐CoV‐2 detection, and it also can be used as a promising antiviral agent for COVID‐19 therapy, , and the sequences of aptamer and molecular were described in Table 2.

Table 2.

The sequences of aptamer and molecular beacon used for SARS‐CoV‐2 detection

Sequence Reference
Aptamer
S1 TGGGAGGATTCGGCGCATGGGGACGGGGGTGGCCCCCCCCCCTC [87]
S13 TCGTTGGTGGCGGCGTGCCCGGGGCACGGGGACGTCTCGCACGGC [87]
S14 TGGGAGCCTGGGACATAGTGGGGAAAGAGGGGAAGAGTGGGTCT [87]
Molecular beacon
MB1 FAM‐ACGCGCCCTTCGGAACCTTCTCCAACAACACCGCGCGT‐BHQ1 [83]
MB2 FAM‐ACGCGCCCAATACCATTAAACCTATAAGCCGCGCGT‐BHQ1 [83]

5. Conclusions and Perspectives

In the last decades, research on viral G4s and their binding compounds has been quite promising and challenging, resulting in the awareness that targeting viral G4s by G4 ligands is a possible new antiviral strategy. As G4 ligands with encouraging anti‐cancer activity were developed and increasing numbers of highly conserved viral G4s were identified, evidence collected so far unquestionably points to G4s as encouraging antiviral targets.

Although the development of antiviral field by targeting G4s is encouraging, several potential limitations of this antiviral strategy should be kept in mind. First, current G4 ligands share common chemical features that specifically bind to G4s by stacking interactions with the G‐tetrad, making them selective for G4s over duplex DNA.[ 94 ] However, this property reduces the selectivity towards different G4s. Thus, almost all G4 ligands have no ability to discriminate between viral and cellular G4s. Cellular G4s broadly influence many biological processes of transcription, translation and genome stability, etc.,[ 5 ] thus the off‐target of G4 ligands may cause side effects. Despite their scarce selectivity, several G4 ligands showed low side effects and promising antiviral activity by targeting viral G4s. Recently, a growing number of studies proposed that during infection, the virus extensively replicates its genome to create a large number of viral G4s, considerably exceeding that of cellular G4s, which may compensate for a limited intra‐G4 specificity of a ligand.[ 7, 32, 94 ] In one case this eventuality has been demonstrated: there is a sharp increase in the number of viral G4s during herpes simplex virus‐1(HSV‐1) replication.[ 95 ] Therefore, because the amount of viral G4s may outstand that of cellular G4s by several logs per cell during viral infection and the antiviral effects of several G4 ligands can be achieved at low concentrations, the off‐target effects might be reduced in a large part. On the other hand, the antiviral effects of these G4 ligands may be due in part to binding the host G4s, such as TMPRSS2 RNA G4s.[ 73 ] In regard to anti‐SARS‐CoV‐2 by targeting viral or host G4s, we have reasons to believe that these G4 ligands have the potential to be a short‐term treatment of COVID‐19 for 1—2 weeks, because COVID‐19 is an acute disease. Second, although some researches demonstrated the regulating effects of G4s on the replication processes of SARS‐CoV‐2, the roles of G4s in SARS‐CoV‐2 life cycle is still not fully elucidated. The transmission of asymptomatic carriers of SARS‐CoV‐2 infection is still a serious problem, thus the underlying mechanism of SARS‐CoV‐2 undergoing latency is urgently illustrated. Several recent studies have shown that G4s can regulate the viral incubation period and immune evasion.[ 96, 97 ] Whether SASR‐CoV‐2 G4s involve in regulating viral incubation period deserves further investigation. Third, it is essential to identify the host proteins that can interact with SARS‐CoV‐2 RNA G4. Moreover, the function and mechanism of their interaction should be clearly illustrated, which can provide novel therapeutic targets for COVID‐19.

In conclusion, all these findings instigate the quest for further developing G4‐based strategy to detect or destroy SARS‐CoV‐2. Progress in this field can potentially lead to the development of cutting‐edge therapeutic approaches for various human diseases.

Acknowledgement

Financial support was provided by the National Key R&D Program of China (2019YFA0709202), the National Natural Science Foundation of China (91856205, 21820102009, 22237006, 22107098, 22122704), and the Key Program of Frontier of Sciences (CAS QYZDJ‐SSW‐SLH052).

Biographies

Geng Qin obtained his Ph.D. from Academy of Military Sciences in 2019. Now he works in Changchun Institute of Applied Chemistry, Chinese Academy of Sciences. His research interests include G‐quadruplex and CRISPR technique.

biography image

Chanqi Zhao obtained his Ph.D. from Changchun Institute of Applied Chemistry, Chinese Academy of Sciences under the supervision of Prof. Xiaogang Qu. He is now a professor at the Changchun Institute of Applied Chemistry. His research is focused on regulation of nucleic acid function.

Jie Yang received her BSc from Zhengzhou University in 2019. Now she is a Ph.D. candidate under the supervision of Prof. Xiaogang Qu. Her research interests include G‐quadruplex and CRISPR technique.

Zhao Wang received his BSc from Hunan University in 2018. Now he is a Ph.D. candidate under the supervision of Prof. Xiaogang Qu. His research is focused on DNAzyme.

Jinsong Ren received her BSc degree at Nanjing University in 1990, and, Ph.D. from the Changchun Institute of Applied Chemistry, Chinese Academy of Sciences in 1995. From 1996 to 2002, she worked in the School of Medicine, UMMC and Department of Chemistry and Chemical Engineering, California Institute of Technology. In 2002, she took a position as a principal investigator at Changchun Institute of Applied Chemistry, Chinese Academy of Sciences. Her current research is mainly focused on drug screening and DNA‐based nanofunctional materials.

Xiaogang Qu received his Ph.D. from the Chinese Academy of Sciences (CAS) in 1995 with the President's Award of CAS. He moved to the U.S. afterwards and worked with Professor J. B. Chaires at the Mississippi Medical Center and Nobel Laureate Professor Ahmed H. Zewail at the California Institute of Technology. Since late 2002, he has been a professor at the Changchun Institute of Applied Chemistry, CAS. From 12/2006 to 05/2007, he visited the group of Nobel Laureate Professor Alan J. Heeger at UCSB. His current research is focused on ligand nucleic acids and related protein interactions and biofunctional materials for advanced medical technology.

References

  • 1. Chan, J. F. ; Yuan, S. ; Kok, K. H.; To, K. K.; Chu, H.; Yang, J.; Xing, F.; Liu, J.; Yip, C. C.; Poon, R. W.; Tsoi, H. W.; Lo, S. K.; Chan, K. H.; Poon, V. K.; Chan, W. M.; Ip, J. D.; Cai, J. P.; Cheng, V. C.; Chen, H.; Hui, C. K.; Yuen, K. Y. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person‐to‐person transmission: a study of a family cluster. Lancet 2020, 395, 514–523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Zhou, P. ; Yang, X. L. ; Wang, X. G. ; Hu, B. ; Zhang, L. ; Zhang, W. ; Si, H. R. ; Zhu, Y. ; Li, B. ; Huang, C. L. ; Chen, H. D. ; Chen, J. ; Luo, Y. ; Guo, H. ; Jiang, R. D. ; Liu, M. Q. ; Chen, Y. ; Shen, X. R. ; Wang, X. ; Zheng, X. S. ; Zhao, K. ; Chen, Q. J. ; Deng, F. ; Liu, L. L. ; Yan, B. ; Zhan, F. X. ; Wang, Y. Y. ; Xiao, G. F. ; Shi, Z. L. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020, 579, 270–273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Sun, C. ; Xie, C. ; Bu, G. L. ; Zhong, L. Y. ; Zeng, M. S. Molecular characteristics, immune evasion, and impact of SARS‐CoV‐2 variants. Signal. Transduct. Target. Ther. 2022, 7, 202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Li, J. ; Lai, S. ; Gao, G. F. ; Shi, W. The emergence, genomic diversity and global spread of SARS‐CoV‐2. Nature 2021, 600, 408–418. [DOI] [PubMed] [Google Scholar]
  • 5. Varshney, D. ; Spiegel, J. ; Zyner, K. ; Tannahill, D. ; Balasubramanian, S. The regulation and functions of DNA and RNA G‐quadruplexes. Nat. Rev. Mol. Cell Biol. 2020, 21, 459–474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Guiset Miserachs, H. ; Donghi, D. ; Borner, R. ; Johannsen, S. ; Sigel, R. K. Distinct differences in metal ion specificity of RNA and DNA G‐quadruplexes. J. Biol. Inorg. Chem. 2016, 21, 975–986. [DOI] [PubMed] [Google Scholar]
  • 7. Ruggiero, E. ; Richter, S. N. G‐quadruplexes and G‐quadruplex ligands: targets and tools in antiviral therapy. Nucleic Acids Res. 2018, 46, 3270–3283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Burge, S. ; Parkinson, G. N. ; Hazel, P. ; Todd, A. K. ; Neidle, S. Quadruplex DNA: sequence, topology and structure. Nucleic Acids Res. 2006, 34, 5402–5415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Fay, M. M. ; Lyons, S. M. ; Ivanov, P. RNA G‐Quadruplexes in Biology: Principles and Molecular Mechanisms. J. Mol. Biol. 2017, 429, 2127–2147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Brazda, V. ; Kolomaznik, J. ; Lysek, J. ; Bartas, M. ; Fojta, M. ; Stastny, J. ; Mergny, J. L. G4Hunter web application: a web server for G‐quadruplex prediction. Bioinformatics 2019, 35, 3493–3495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Hon, J. ; Martinek, T. ; Zendulka, J. ; Lexa, M. pqsfinder: an exhaustive and imperfection‐tolerant search tool for potential quadruplex‐ forming sequences in R. Bioinformatics 2017, 33, 3373–3379. [DOI] [PubMed] [Google Scholar]
  • 12. Kikin, O. ; D'Antonio, L. ; Bagga, P. S. QGRS Mapper: a web‐based server for predicting G‐quadruplexes in nucleotide sequences. Nucleic Acids Res. 2006, 34, W676–W682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Chambers, V. S. ; Marsico, G. ; Boutell, J. M. ; Di Antonio, M. ; Smith, G. P. ; Balasubramanian, S. High‐throughput sequencing of DNA G‐quadruplex structures in the human genome. Nat .Biotechnol. 2015, 33, 877–881. [DOI] [PubMed] [Google Scholar]
  • 14. Hansel‐Hertsch, R. ; Beraldi, D. ; Lensing, S. V. ; Marsico, G. ; Zyner, K. ; Parry, A. ; Di Antonio, M. ; Pike, J. ; Kimura, H. ; Narita, M. ; Tannahill, D. ; Balasubramanian, S. G‐quadruplex structures mark human regulatory chromatin. Nat. Genet. 2016, 48, 1267–1272. [DOI] [PubMed] [Google Scholar]
  • 15. Hansel‐Hertsch, R. ; Spiegel, J. ; Marsico, G. ; Tannahill, D. ; Balasubramanian, S. Genome‐wide mapping of endogenous G‐quadruplex DNA structures by chromatin immunoprecipitation and high‐throughput sequencing. Nat. Protoc. 2018, 13, 551–564. [DOI] [PubMed] [Google Scholar]
  • 16. Yang, S. Y. ; Lejault, P. ; Chevrier, S. ; Boidot, R. ; Robertson, A. G. ; Wong, J. M. Y. ; Monchaud, D. Transcriptome‐wide identification of transient RNA G‐quadruplexes in human cells. Nat. Commun. 2018, 9, 4730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Yang, S. Y. ; Monchaud, D. ; Wong, J. M. Y. Global mapping of RNA G‐quadruplexes (G4‐RNAs) using G4RP‐seq. Nat. Protoc. 2022, 17, 870–889. [DOI] [PubMed] [Google Scholar]
  • 18. Dumas, L. ; Herviou, P. ; Dassi, E. ; Cammas, A. ; Millevoi, S. G‐Quadruplexes in RNA Biology: Recent Advances and Future Directions. Trends Biochem. Sci. 2021, 46, 270–283. [DOI] [PubMed] [Google Scholar]
  • 19. Hansel‐Hertsch, R. ; Di Antonio, M. ; Balasubramanian, S. DNA G‐quadruplexes in the human genome: detection, functions and therapeutic potential. Nat. Rev. Mol. Cell Biol. 2017, 18, 279–284. [DOI] [PubMed] [Google Scholar]
  • 20. Liu, G. ; Du, W. ; Xu, H. ; Sun, Q. ; Tang, D. ; Zou, S. ; Zhang, Y. ; Ma, M. ; Zhang, G. ; Du, X. ; Ju, S. ; Cheng, W. ; Tian, Y. ; Fu, X. RNA G‐quadruplex regulates microRNA‐26a biogenesis and function. J. Hepatol. 2020, 73, 371–382. [DOI] [PubMed] [Google Scholar]
  • 21. Maltby, C. J. ; Schofield, J. P. R. ; Houghton, S. D. ; O'Kelly, I. ; Vargas‐Caballero, M. ; Deinhardt, K. ; Coldwell, M. J. A 5' UTR GGN repeat controls localisation and translation of a potassium leak channel mRNA through G‐quadruplex formation. Nucleic Acids Res. 2020, 48, 9822–9839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Mao, S. Q. ; Ghanbarian, A. T. ; Spiegel, J. ; Martinez Cuesta, S. ; Beraldi, D. ; Di Antonio, M. ; Marsico, G. ; Hansel‐Hertsch, R. ; Tannahill, D. ; Balasubramanian, S. DNA G‐quadruplex structures mold the DNA methylome. Nat. Struct. Mol. Biol. 2018, 25, 951–957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Simko, E. A. J. ; Liu, H. ; Zhang, T. ; Velasquez, A. ; Teli, S. ; Haeusler, A. R. ; Wang, J. G‐quadruplexes offer a conserved structural motif for NONO recruitment to NEAT1 architectural lncRNA. Nucleic Acids Res. 2020, 48, 7421–7438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Weldon, C. ; Dacanay, J. G. ; Gokhale, V. ; Boddupally, P. V. L. ; Behm‐Ansmant, I. ; Burley, G. A. ; Branlant, C. ; Hurley, L. H. ; Dominguez, C. ; Eperon, I. C. Specific G‐quadruplex ligands modulate the alternative splicing of Bcl‐X. Nucleic Acids Res. 2018, 46, 886–896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Kosiol, N. ; Juranek, S. ; Brossart, P. ; Heine, A. ; Paeschke, K. G‐quadruplexes: a promising target for cancer therapy. Mol. Cancer 2021, 20, 40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Lejault, P. ; Mitteaux, J. ; Sperti, F. R. ; Monchaud, D. How to untie G‐quadruplex knots and why? Cell Chem. Biol. 2021, 28, 436–455. [DOI] [PubMed] [Google Scholar]
  • 27. Balasubramanian, S. ; Hurley, L. H. ; Neidle, S. Targeting G‐quadruplexes in gene promoters: a novel anticancer strategy? Nat. Rev. Drug Discov. 2011, 10, 261–275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Xu, H.; Di Antonio, M.; McKinney, S.; Mathew, V.; Ho, B.; O'Neil, N. J.; Santos, N. D.; Silvester, J.; Wei, V.; Garcia, J.; Kabeer, F.; Lai, D.; Soriano, P.; Banath, J.; Chiu, D. S.; Yap, D.; Le, D. D.; Ye, F. B.; Zhang, A.; Thu, K.; Soong, J.; Lin, S. C.; Tsai, A. H.; Osako, T.; Algara, T.; Saunders, D. N.; Wong, J.; Xian, J.; Bally, M. B.; Brenton, J. D.; Brown, G. W.; Shah, S. P.; Cescon, D.; Mak, T. W.; Caldas, C.; Stirling, P. C.; Hieter, P.; Balasubramanian, S.; Aparicio, S. CX‐5461 is a DNA G‐quadruplex stabilizer with selective lethality in BRCA1/2 deficient tumours. Nat. Commun. 2017, 8, 14432. [DOI] [PMC free article] [PubMed]
  • 29. Smargiasso, N. ; Gabelica, V. ; Damblon, C. ; Rosu, F. ; De Pauw, E. ; Teulade‐Fichou, M. P. ; Rowe, J. A. ; Claessens, A. Putative DNA G‐quadruplex formation within the promoters of Plasmodium falciparum var genes. BMC Genomics 2009, 10, 362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Beaume, N. ; Pathak, R. ; Yadav, V. K.; Kota, S.; Misra, H. S.; Gautam, H. K.; Chowdhury, S. Genome‐wide study predicts promoter‐G4 DNA motifs regulate selective functions in bacteria: radioresistance of D. radiodurans involves G4 DNA‐mediated regulation. Nucleic Acids Res. 2013, 41, 76–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Perrone, R. ; Lavezzo, E. ; Riello, E. ; Manganelli, R. ; Palu, G. ; Toppo, S. ; Provvedi, R. ; Richter, S. N. Mapping and characterization of G‐quadruplexes in Mycobacterium tuberculosis gene promoter regions. Sci. Rep. 2017, 7, 5743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Abiri, A. ; Lavigne, M. ; Rezaei, M. ; Nikzad, S. ; Zare, P. ; Mergny, J. L. ; Rahimi, H. R. Unlocking G‐Quadruplexes as Antiviral Targets. Pharmacol. Rev. 2021, 73, 897–923. [DOI] [PubMed] [Google Scholar]
  • 33. Hershman, S. G. ; Chen, Q. ; Lee, J. Y. ; Kozak, M. L. ; Yue, P. ; Wang, L. S. ; Johnson, F. B. Genomic distribution and functional analyses of potential G‐quadruplex‐forming sequences in Saccharomyces cerevisiae. Nucleic Acids Res. 2008, 36, 144–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Ma, X. ; Feng, Y. ; Luo, Z. ; Zhang, W. Identification and functional characterization of G‐quadruplexes in plants. Trends Plant Sci. 2022, 27, 952–953. [DOI] [PubMed] [Google Scholar]
  • 35. Puig Lombardi, E. ; Londono‐Vallejo, A. ; Nicolas, A. Relationship between G‐Quadruplex Sequence Composition in Viruses and Their Hosts. Molecules 2019, 24, 1942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Zhai, L. Y. ; Liu, J. F. ; Zhao, J. J. ; Su, A. M. ; Xi, X. G. ; Hou, X. M. Targeting the RNA G‐Quadruplex and Protein Interactome for Antiviral Therapy. J. Med. Chem. 2022, 65, 10161–10182. [DOI] [PubMed] [Google Scholar]
  • 37. Wang, S. R. ; Min, Y. Q. ; Wang, J. Q. ; Liu, C. X. ; Fu, B. S. ; Wu, F. ; Wu, L. Y. ; Qiao, Z. X. ; Song, Y. Y. ; Xu, G. H. ; Wu, Z. G. ; Huang, G. ; Peng, N. F. ; Huang, R. ; Mao, W. X. ; Peng, S. ; Chen, Y. Q. ; Zhu, Y. ; Tian, T. ; Zhang, X. L. ; Zhou, X. A highly conserved G‐rich consensus sequence in hepatitis C virus core gene represents a new anti‐hepatitis C target. Sci. Adv. 2016, 2, e1501535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Majee, P. ; Pattnaik, A. ; Sahoo, B. R. ; Shankar, U. ; Pattnaik, A. K. ; Kumar, A. ; Nayak, D. Inhibition of Zika virus replication by G‐quadruplex‐binding ligands. Mol. Ther. Nucleic Acids 2021, 23, 691–701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Zou, M. ; Li, J. Y. ; Zhang, M. J. ; Li, J. H. ; Huang, J. T. ; You, P. D. ; Liu, S. W. ; Zhou, C. Q. G‐quadruplex binder pyridostatin as an effective multi‐target ZIKV inhibitor. Int. J. Biol. Macromol. 2021, 190, 178–188. [DOI] [PubMed] [Google Scholar]
  • 40. Wang, S. R. ; Zhang, Q. Y. ; Wang, J. Q. ; Ge, X. Y. ; Song, Y. Y. ; Wang, Y. F. ; Li, X. D. ; Fu, B. S. ; Xu, G. H. ; Shu, B. ; Gong, P. ; Zhang, B. ; Tian, T. ; Zhou, X. Chemical Targeting of a G‐Quadruplex RNA in the Ebola Virus L Gene. Cell Chem. Biol. 2016, 23, 1113–1122. [DOI] [PubMed] [Google Scholar]
  • 41. Wang, Y. ; Grunewald, M. ; Perlman, S. Coronaviruses: An Updated Overview of Their Replication and Pathogenesis. Methods Mol. Biol. 2020, 2203, 1–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Huston, N. C. ; Wan, H. ; Strine, M. S. ; de Cesaris Araujo Tavares, R.; Wilen, C. B.; Pyle, A. M. Comprehensive in vivo secondary structure of the SARS‐CoV‐2 genome reveals novel regulatory motifs and mechanisms. Mol. Cell 2021, 81, 584–598.E5. [DOI] [PMC free article] [PubMed]
  • 43. Lavezzo, E. ; Berselli, M. ; Frasson, I. ; Perrone, R. ; Palu, G. ; Brazzale, A. R. ; Richter, S. N. ; Toppo, S. G‐quadruplex forming sequences in the genome of all known human viruses: A comprehensive guide. PLoS Comput. Biol. 2018, 14, e1006675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Tan, J. ; Vonrhein, C. ; Smart, O. S. ; Bricogne, G. ; Bollati, M. ; Kusov, Y. ; Hansen, G. ; Mesters, J. R. ; Schmidt, C. L. ; Hilgenfeld, R. The SARS‐unique domain (SUD) of SARS coronavirus contains two macrodomains that bind G‐quadruplexes. PLoS Pathog. 2009, 5, e1000428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Panera, N. ; Tozzi, A. E. ; Alisi, A. The G‐Quadruplex/Helicase World as a Potential Antiviral Approach Against COVID‐19. Drugs 2020, 80, 941–946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Bartas, M. ; Brazda, V. ; Bohalova, N. ; Cantara, A. ; Volna, A. ; Stachurova, T. ; Malachova, K. ; Jagelska, E. B. ; Porubiakova, O. ; Cerven, J. ; Pecinka, P. In‐Depth Bioinformatic Analyses of Nidovirales Including Human SARS‐CoV‐2, SARS‐CoV., MERS‐CoV Viruses Suggest Important Roles of Non‐canonical Nucleic Acid Structures in Their Lifecycles. Front. Microbiol. 2020, 11, 1583. [DOI] [PMC free article] [PubMed]
  • 47. Zhang, R. ; Xiao, K. ; Gu, Y. ; Liu, H. ; Sun, X. Whole Genome Identification of Potential G‐Quadruplexes and Analysis of the G‐Quadruplex Binding Domain for SARS‐CoV‐2. Front. Genet. 2020, 11, 587829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Cui, H. ; Zhang, L. G‐Quadruplexes Are Present in Human Coronaviruses Including SARS‐CoV‐2. Front. Microbiol. 2020, 11, 567317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Ji, D. ; Juhas, M. ; Tsang, C. M. ; Kwok, C. K. ; Li, Y. ; Zhang, Y. Discovery of G‐quadruplex‐forming sequences in SARS‐CoV‐2. Brief Bioinform. 2021, 22, 1150–1160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Belmonte‐Reche, E. ; Serrano‐Chacon, I. ; Gonzalez, C. ; Gallo, J. ; Banobre‐Lopez, M. Potential G‐quadruplexes and i‐Motifs in the SARS‐CoV‐2. PLoS One 2021, 16, e0250654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Zhao, C. ; Qin, G. ; Niu, J. ; Wang, Z. ; Wang, C. ; Ren, J. ; Qu, X. Targeting RNA G‐Quadruplex in SARS‐CoV‐2: A Promising Therapeutic Target for COVID‐19? Angew. Chem. Int. Ed. 2021, 60, 432–438. [DOI] [PubMed] [Google Scholar]
  • 52. Qin, G. ; Zhao, C. ; Liu, Y. ; Zhang, C. ; Yang, G. ; Yang, J. ; Wang, Z. ; Wang, C. Y. ; Tu, C. C. ; Guo, Z. D. ; Ren, J. S. ; Qu, X. G. RNA G‐quadruplex formed in SARS‐CoV‐2 used for COVID‐19 treatment in animal models. Cell Discov. 2022, 8, 86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Miclot, T. ; Hognon, C. ; Bignon, E. ; Terenzi, A. ; Marazzi, M. ; Barone, G. ; Monari, A. Structure and Dynamics of RNA Guanine Quadruplexes in SARS‐CoV‐2 Genome. Original Strategies against Emerging Viruses. J. Phys . Chem. Lett. 2021, 12, 10277–10283. [DOI] [PubMed] [Google Scholar]
  • 54. Oliva, R. ; Mukherjee, S. ; Manisegaran, M. ; Campanile, M. ; Del Vecchio, P. ; Petraccone, L. ; Winter, R. Binding Properties of RNA Quadruplex of SARS‐CoV‐2 to Berberine Compared to Telomeric DNA Quadruplex. Int. J. Mol. Sci. 2022, 23, 5690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Mukherjee, S. K. ; Knop, J. M. ; Winter, R. Modulation of the Conformational Space of SARS‐CoV‐2 RNA Quadruplex RG‐1 by Cellular Components and the Amyloidogenic Peptides alpha‐ Synuclein and hIAPP. Chemistry 2022, 28, e202104182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Bezzi, G. ; Piga, E. J. ; Binolfi, A. ; Armas, P. CNBP Binds and Unfolds in vitro G‐Quadruplexes Formed in the SARS‐CoV‐2 Positive and Negative Genome Strands. Int. J. Mol. Sci. 2021, 22, 2614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Neidle, S. Human telomeric G‐quadruplex: the current status of telomeric G‐quadruplexes as therapeutic targets in human cancer. FEBS J. 2010, 277, 1118–1125. [DOI] [PubMed] [Google Scholar]
  • 58.Qiao, J.; Li, Y. S.; Zeng, R.; Liu, F. L.; Luo, R. H.; Huang, C.; Wang, Y. F.; Zhang, J.; Quan, B.; Shen, C.; Mao, X.; Liu, X.; Sun, W.; Yang, W.; Ni, X.; Wang, K.; Xu, L.; Duan, Z. L.; Zou, Q. C.; Zhang, H. L.; Qu, W.; Long, Y. H.; Li, M. H.; Yang, R. C.; Liu, X.; You, J.; Zhou, Y.; Yao, R.; Li, W. P.; Liu, J. M.; Chen, P.; Liu, Y.; Lin, G. F.; Yang, X.; Zou, J.; Li, L.; Hu, Y.; Lu, G. W.; Li, W. M.; Wei, Y. Q.; Zheng, Y. T.; Lei, J.; Yang, S. SARS‐CoV‐2 M(pro) inhibitors with antiviral activity in a transgenic mouse model. Science 2021, 371, 1374–1378. [DOI] [PMC free article] [PubMed]
  • 59. Yang, H. ; Rao, Z. Structural biology of SARS‐CoV‐2 and implications for therapeutic development. Nat. Rev. Microbiol. 2021, 19, 685–700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Zu, S. ; Deng, Y. Q. ; Zhou, C. ; Li, J. ; Li, L. ; Chen, Q. ; Li, X. F. ; Zhao, H. ; Gold, S. ; He, J. ; Li, X. ; Zhang, C. ; Yang, H. ; Cheng, G. ; Qin, C. F. 25‐Hydroxycholesterol is a potent SARS‐CoV‐2 inhibitor. Cell Res. 2020, 30, 1043–1045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Harrison, R. J. ; Gowan, S. M. ; Kelland, L. R. ; Neidle, S. Human telomerase inhibition by substituted acridine derivatives. Bioorg. Med. Chem. Lett. 1999, 9, 2463–2468. [DOI] [PubMed] [Google Scholar]
  • 62. Burger, A. M. ; Dai, F. ; Schultes, C. M. ; Reszka, A. P. ; Moore, M. J. ; Double, J. A. ; Neidle, S. The G‐quadruplex‐interactive molecule BRACO‐19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function. Cancer Res. 2005, 65, 1489–1496. [DOI] [PubMed] [Google Scholar]
  • 63. Gowan, S. M. ; Harrison, J. R. ; Patterson, L. ; Valenti, M. ; Read, M. A. ; Neidle, S. ; Kelland, L. R. A G‐quadruplex‐interactive potent small‐molecule inhibitor of telomerase exhibiting in vitro and in vivo antitumor activity. Mol. Pharmacol. 2002, 61, 1154–1162. [DOI] [PubMed] [Google Scholar]
  • 64. Artusi, S. ; Nadai, M. ; Perrone, R. ; Biasolo, M. A. ; Palu, G. ; Flamand, L. ; Calistri, A. ; Richter, S. N. The Herpes Simplex Virus‐1 genome contains multiple clusters of repeated G‐quadruplex: Implications for the antiviral activity of a G‐quadruplex ligand. Antiviral. Res. 2015, 118, 123–131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Biswas, B. ; Kandpal, M. ; Vivekanandan, P. A G‐quadruplex motif in an envelope gene promoter regulates transcription and virion secretion in HBV genotype B. Nucleic Acids Res. 2017, 45, 11268–11280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Lv, L. ; Cui, H. ; Chen, Z. ; Zhou, Y. ; Zhang, L. G‐quadruplex ligands inhibit chikungunya virus replication. J. Med. Virol. 2022, 94, 2519–2527. [DOI] [PubMed] [Google Scholar]
  • 67. Parkinson, G. N. ; Ghosh, R. ; Neidle, S. Structural basis for binding of porphyrin to human telomeres. Biochemistry 2007, 46, 2390–2397. [DOI] [PubMed] [Google Scholar]
  • 68. Izbicka, E. ; Wheelhouse, R. T. ; Raymond, E. ; Davidson, K. K. ; Lawrence, R. A. ; Sun, D. ; Windle, B. E. ; Hurley, L. H. ; Von Hoff, D. D. Effects of cationic porphyrins as G‐quadruplex interactive agents in human tumor cells. Cancer Res. 1999, 59, 639–644. [PubMed] [Google Scholar]
  • 69. Grand, C. L. ; Han, H. ; Munoz, R. M. ; Weitman, S. ; Von Hoff, D. D. ; Hurley, L. H. ; Bearss, D. J. The cationic porphyrin TMPyP4 down‐ regulates c‐MYC and human telomerase reverse transcriptase expression and inhibits tumor growth in vivo. Mol. Cancer Ther. 2002, 1, 565–573. [PubMed] [Google Scholar]
  • 70. Shi, D. F. ; Wheelhouse, R. T. ; Sun, D. ; Hurley, L. H. Quadruplex‐ interactive agents as telomerase inhibitors: synthesis of porphyrins and structure‐activity relationship for the inhibition of telomerase. J. Med. Chem. 2001, 44, 4509–4523. [DOI] [PubMed] [Google Scholar]
  • 71. Piekna‐Przybylska, D. ; Bambara, R. A. ; Maggirwar, S. B. ; Dewhurst, S. G‐quadruplex ligands targeting telomeres do not inhibit HIV promoter activity and cooperate with latency reversing agents in killing latently infected cells. Cell Cycle 2020, 19, 2298–2313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Spinner, C. D.; Gottlieb, R. L.; Criner, G. J.; Arribas Lopez, J. R.; Cattelan, A. M.; Soriano Viladomiu, A.; Ogbuagu, O.; Malhotra, P.; Mullane, K. M.; Castagna, A.; Chai, L. Y. A.; Roestenberg, M.; Tsang, O. T. Y.; Bernasconi, E.; Le Turnier, P.; Chang, S. C.; SenGupta, D.; Hyland, R. H.; Osinusi, A. O.; Cao, H.; Blair, C.; Wang, H.; Gaggar, A.; Brainard, D. M.; McPhail, M. J.; Bhagani, S.; Ahn, M. Y.; Sanyal, A. J.; Huhn, G.; Marty, F. M.; GS‐US‐540‐5774 Investigators. Effect of Remdesivir vs Standard Care on Clinical Status at 11 Days in Patients with Moderate COVID‐19: A Randomized Clinical Trial. JAMA 2020, 324, 1048–1057. [DOI] [PMC free article] [PubMed]
  • 73. Liu, G. ; Du, W. ; Sang, X. ; Tong, Q. ; Wang, Y. ; Chen, G. ; Yuan, Y. ; Jiang, L. ; Cheng, W. ; Liu, D. ; Tian, Y. ; Fu, X. RNA G‐quadruplex in TMPRSS2 reduces SARS‐CoV‐2 infection. Nat. Commun. 2022, 13, 1444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Koirala, D. ; Dhakal, S. ; Ashbridge, B. ; Sannohe, Y. ; Rodriguez, R. ; Sugiyama, H. ; Balasubramanian, S. ; Mao, H. A single‐molecule platform for investigation of interactions between G‐quadruplexes and small‐molecule ligands. Nat. Chem. 2011, 3, 782–787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Rodriguez, R. ; Muller, S. ; Yeoman, J. A. ; Trentesaux, C. ; Riou, J. F. ; Balasubramanian, S. A novel small molecule that alters shelterin integrity and triggers a DNA‐damage response at telomeres. J. Am. Chem. Soc. 2008, 130, 15758–15759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Liu, L. Y. ; Ma, T. Z. ; Zeng, Y. L. ; Liu, W. ; Mao, Z. W. Structural Basis of Pyridostatin and Its Derivatives Specifically Binding to G‐Quadruplexes. J. Am. Chem. Soc. 2022, 144, 11878–11887. [DOI] [PubMed] [Google Scholar]
  • 77. Kumar, S. ; Choudhary, D. ; Patra, A. ; Bhavesh, N. S. ; Vivekanandan, P. Analysis of G‐quadruplexes upstream of herpesvirus miRNAs: evidence of G‐quadruplex mediated regulation of KSHV miR‐K12‐1‐9,11 cluster and HCMV miR‐US33. BMC Mol. Cell Biol. 2020, 21, 67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Prado Martins, R. ; Findakly, S. ; Daskalogianni, C. ; Teulade‐Fichou, M. P. ; Blondel, M. ; Fahraeus, R. In Cellulo Protein‐mRNA Interaction Assay to Determine the Action of G‐Quadruplex‐Binding Molecules. Molecules 2018, 23, 3124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Lavigne, M. ; Helynck, O. ; Rigolet, P. ; Boudria‐Souilah, R. ; Nowakowski, M. ; Baron, B. ; Brule, S. ; Hoos, S. ; Raynal, B. ; Guittat, L. ; Beauvineau, C. ; Petres, S. ; Granzhan, A. ; Guillon, J. ; Pratviel, G. ; Teulade‐Fichou, M. P. ; England, P. ; Mergny, J. L. ; Munier‐Lehmann, H. SARS‐CoV‐2 Nsp3 unique domain SUD interacts with guanine quadruplexes and G4‐ligands inhibit this interaction. Nucleic Acids Res. 2021, 49, 7695–7712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Hung, I. F.; Lung, K. C.; Tso, E. Y.; Liu, R.; Chung, T. W.; Chu, M. Y.; Ng, Y. Y.; Lo, J.; Chan, J.; Tam, A. R.; Shum, H. P.; Chan, V.; Wu, A. K.; Sin, K. M.; Leung, W. S.; Law, W. L.; Lung, D. C.; Sin, S.; Yeung, P.; Yip, C. C.; Zhang, R. R.; Fung, A. Y.; Yan, E. Y.; Leung, K. H.; Ip, J. D.; Chu, A. W.; Chan, W. M.; Ng, A. C.; Lee, R.; Fung, K.; Yeung, A.; Wu, T. C.; Chan, J. W.; Yan, W. W.; Chan, W. M.; Chan, J. F.; Lie, A. K.; Tsang, O. T.; Cheng, V. C.; Que, T. L.; Lau, C. S.; Chan, K. H.; To, K. K.; Yuen, K. Y. Triple combination of interferon beta‐1b, lopinavir‐ritonavir, and ribavirin in the treatment of patients admitted to hospital with COVID‐19: an open‐label, randomised, phase 2 trial. Lancet 2020, 395, 1695–1704. [DOI] [PMC free article] [PubMed]
  • 81. Unal, M. A. ; Bitirim, C. V. ; Summak, G. Y. ; Bereketoglu, S. ; Cevher Zeytin, I. ; Besbinar, O. ; Gurcan, C. ; Aydos, D. ; Goksoy, E. ; Kocakaya, E. ; Eran, Z. ; Murat, M. ; Demir, N. ; Aksoy Ozer, Z. B. ; Somers, J. ; Demir, E. ; Nazir, H. ; Ozkan, S. A. ; Ozkul, A. ; Azap, A. ; Yilmazer, A. ; Akcali, K. C. Ribavirin shows antiviral activity against SARS‐CoV‐2 and downregulates the activity of TMPRSS2 and the expression of ACE2 in vitro. Can. J. Physiol. Pharmacol. 2021, 99, 449–460. [DOI] [PubMed] [Google Scholar]
  • 82. Nishio, M. ; Tsukakoshi, K. ; Ikebukuro, K. G‐quadruplex: Flexible conformational changes by cations, pH, crowding and its applications to biosensing. Biosens. Bioelectron. 2021, 178, 113030. [DOI] [PubMed] [Google Scholar]
  • 83. Carvalho, J. ; Lopes‐Nunes, J. ; Figueiredo, J. ; Santos, T. ; Miranda, A. ; Riscado, M. ; Sousa, F. ; Duarte, A. P. ; Socorro, S. ; Tomaz, C. T. ; Felgueiras, M. ; Teixeira, R. ; Faria, C. ; Cruz, C. Molecular Beacon Assay Development for Severe Acute Respiratory Syndrome Coronavirus 2 Detection. Sensors (Basel) 2021, 21, 7015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Chen, F. ; Li, G. ; Wu, C. ; Wang, W. ; Ma, D. L. ; Leung, C. H. A rapid and label‐free DNA‐based interference reduction nucleic acid amplification strategy for viral RNA detection. Biosens. Bioelectron. 2022, 198, 113829. [DOI] [PubMed] [Google Scholar]
  • 85. Lee, H. ; Lee, H. ; Hwang, S. H. ; Jeong, W. ; Kim, D. E. Detection of SARS‐CoV‐2 RNA through tandem isothermal gene amplification without reverse transcription. Anal. Chim. Acta 2022, 1212, 339909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86. Zhang, R. ; Wu, J. ; Ao, H. ; Fu, J. ; Qiao, B. ; Wu, Q. ; Ju, H. A Rolling Circle‐Amplified G‐Quadruplex/Hemin DNAzyme for Chemiluminescence Immunoassay of the SARS‐CoV‐2 Protein. Anal. Chem. 2021, 93, 9933–9938. [DOI] [PubMed] [Google Scholar]
  • 87. Gupta, A. ; Anand, A. ; Jain, N. ; Goswami, S. ; Anantharaj, A. ; Patil, S. ; Singh, R. ; Kumar, A. ; Shrivastava, T. ; Bhatnagar, S. ; Medigeshi, G. R.; Sharma, T. K.; DBT India Consortium for COVID‐19 Research. A novel G‐quadruplex aptamer‐based spike trimeric antigen test for the detection of SARS‐CoV‐2. Mol. Ther . Nucleic Acids 2021, 26, 321–332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88. Chou, S. H. ; Chin, K. H. ; Wang, A. H. DNA aptamers as potential anti‐HIV agents. Trends Biochem. Sci. 2005, 30, 231–234. [DOI] [PubMed] [Google Scholar]
  • 89. Mashima, T. ; Matsugami, A. ; Nishikawa, F. ; Nishikawa, S. ; Katahira, M. Unique quadruplex structure and interaction of an RNA aptamer against bovine prion protein. Nucleic Acids Res. 2009, 37, 6249–6258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90. Reyes‐Reyes, E. M. ; Salipur, F. R. ; Shams, M. ; Forsthoefel, M. K. ; Bates, P. J. Mechanistic studies of anticancer aptamer AS1411 reveal a novel role for nucleolin in regulating Rac1 activation. Mol. Oncol. 2015, 9, 1392–1405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91. Woo, H. M. ; Kim, K. S. ; Lee, J. M. ; Shim, H. S. ; Cho, S. J. ; Lee, W. K. ; Ko, H. W. ; Keum, Y. S. ; Kim, S. Y. ; Pathinayake, P. ; Kim, C. J. ; Jeong, Y. J. Single‐stranded DNA aptamer that specifically binds to the influenza virus NS1 protein suppresses interferon antagonism. Antiviral Res. 2013, 100, 337–345. [DOI] [PubMed] [Google Scholar]
  • 92. Blaum, B. S. ; Wunsche, W. ; Benie, A. J. ; Kusov, Y. ; Peters, H. ; Gauss‐Muller, V. ; Peters, T. ; Sczakiel, G. Functional binding of hexanucleotides to 3C protease of hepatitis A virus. Nucleic Acids Res. 2012, 40, 3042–3055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93. Michalowski, D. ; Chitima‐Matsiga, R. ; Held, D. M. ; Burke, D. H. Novel bimodular DNA aptamers with guanosine quadruplexes inhibit phylogenetically diverse HIV‐1 reverse transcriptases. Nucleic Acids Res. 2008, 36, 7124–7135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94. Ruggiero, E. ; Zanin, I. ; Terreri, M. ; Richter, S. N. G‐Quadruplex Targeting in the Fight against Viruses: An Update. Int. J. Mol. Sci. 2021, 22, 10984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95. Artusi, S. ; Perrone, R. ; Lago, S. ; Raffa, P. ; Di Iorio, E. ; Palu, G. ; Richter, S. N. Visualization of DNA G‐quadruplexes in herpes simplex virus 1‐infected cells. Nucleic Acids Res. 2016, 44, 10343–10353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96. Lista, M. J. ; Martins, R. P. ; Billant, O. ; Contesse, M. A. ; Findakly, S. ; Pochard, P. ; Daskalogianni, C. ; Beauvineau, C. ; Guetta, C. ; Jamin, C. ; Teulade‐Fichou, M. P. ; Fahraeus, R. ; Voisset, C. ; Blondel, M. Nucleolin directly mediates Epstein‐Barr virus immune evasion through binding to G‐quadruplexes of EBNA1 mRNA. Nat. Commun. 2017, 8, 16043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97. Murat, P. ; Zhong, J. ; Lekieffre, L. ; Cowieson, N. P. ; Clancy, J. L. ; Preiss, T. ; Balasubramanian, S. ; Khanna, R. ; Tellam, J. G‐quadruplexes regulate Epstein‐Barr virus‐encoded nuclear antigen 1 mRNA translation. Nat .Chem. Biol. 2014, 10, 358–364. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Chinese Journal of Chemistry are provided here courtesy of Wiley

RESOURCES