Skip to main content
Fungal Systematics and Evolution logoLink to Fungal Systematics and Evolution
. 2022 Oct 26;10:127–137. doi: 10.3114/fuse.2022.10.05

Globisporangium coniferarum sp. nov., associated with conifers and Quercus spp.

F Salmaninezhad 1, F Aloi 2, A Pane 2, R Mostowfizadeh-Ghalamfarsa 1,*, SO Cacciola 2,*
PMCID: PMC9875696  PMID: 36741557

Abstract

During a survey of gardens in Shiraz County, Iran, aimed at identifying oomycetes associated with roots of ornamental trees, a species of Globisporangium with distinctive morphological characters separating it from other known species in this genus was recovered from conifers and occasionally from a Quercus sp. Five isolates of this species were characterised. Phylogenetic analyses of nuclear (ITS and βtub) and mitochondrial (cox1 and cox2) loci using Bayesian inference and maximum likelihood analyses as well as their distinct morphological and cultural characteristics (e.g., abundant production of chlamydospores; globose, ellipsoid to ovoid sporangia; amorphous oogonia with a smooth wall; paragynous to rarely hypogynous antheridia and 1–5 antheridia per oogonium; mostly plerotic oospores) revealed that these isolates belong to a new Globisporangium species grouping in the phylogenetic clade G of Pythium sensu lato. This paper formally describes Globisporangium coniferarum sp. nov. as a new species and compares it with other phylogenetically related and already known Globisporangium species, including G. nagaii, G. violae, G. paddicum, G. okanoganense, G. iwayamae and G. canariense.

Citation: Salmaninezhad F, Aloi F, Pane A, Mostowfizadeh-Ghalamfarsa R, Cacciola SO (2022). Globisporangium coniferarum sp. nov., associated with conifers and Quercus spp. Fungal Systematics and Evolution 10: 127–137. doi: 10.3114/fuse.2022.10.05

Keywords: Conifers, Globisporangium, new taxon, oomycete, phylogenetic analyses, Pythiaceae

INTRODUCTION

Green spaces are of great significance for the quality of urban life (Nowak et al. 2005). Persian gardens have a long tradition and inspire the design of many historical gardens in other parts of the world, from the Alhambra in Spain to the Taj Mahal and Humayun’s tomb in India. Shiraz, the capital of Fars province (Iran), is famous for its gardens, such as the Eram Garden, a historical Persian landscape garden that was declared a World Heritage site. Numerous oomycetes have been reported to be associated with the roots and rhizosphere of landscape trees. Phytophthora species have been reported to cause root rot and decline of trees, including conifers, in gardens, parks and nature reserve areas worldwide (Erwin & Ribeiro 1996, Barber et al. 2013, Jung et al. 2019, Giordana et al. 2020, Khdiar et al. 2020, Riolo et al. 2020, La Spada et al. 2022). Several oomycetes have been reported from conifers in Iran, including P. nicotianae (from Cupressus arizonica and Pinus pinaster), P. citrophthora (from Pinus sylvestris and Pinus elderica), P. cactorum (from Pinus nigra), P. citricola (from Pinus taeda), and Pythium sp. (from Pinus sylvestris) (Mirabolfathy & Ershad 1993, Mirabolfathy & Ershad 1996, Ershad 2009).

The genus Pythium was previously divided into 11 phylogenetic clades (A–K) based on DNA sequence data of the ITS region. Clades E, F, G, I and J produced globose to ovoid sporangia (Lévesque & de Cock 2004). Members of clade K were allocated in a new genus, Phytopythium (de Cock et al. 2015). Uzuhashi et al. (2010) confirmed the findings of previous molecular studies, indicating Pythium to be a paraphyletic genus, and divided it into five phylogenetic clades (1–5) using phylogenetic data of the 28S rDNA and cox2 gene regions. Clade 4, the largest clade, was described as a new genus, Globisporangium, encompassing clades E–G, I and J sensu Lévesque & de Cock (2004). According to Uzuhashi et al. (2010) species of Globisporangium produce globose, internally proliferating sporangia, although other shapes of sporangia may also sporadically occur in this genus. Based on both phylogeny and morphology, Uzuhashi et al. (2010) emended Pythium sensu stricto (s.s.) encompassing clades A–D sensu Lévesque & de Cock (2004), and, along with Globisporangium, segregated from Pythium sensu lato (s.l.) three other new genera, Ovatisporangium (phylogenetic clade K, syn. Phytopythium), Elongisporangium (clade H) and Pilasporangium, the last not coinciding with any of the 11 clades introduced by Lévesque & de Cock (2004). Very recently, the split of Pythium s.l. into several genera was confirmed and consolidated using a phylogenomic approach, and the generic names introduced by Uzuhashi et al. (2010) were accepted, with the only exception of Ovatisporangium, which was shown to be a later synonym of Phytopythium (Nguyen et al. 2022). There are only a few reports of Globisporangium species from Iran, among which G. nunn (from Zea mais, Oryza sativa and Robidia hispida) and G. debaryanum (from Oryza sativa) (Bolboli & Mostowfizadeh-Ghalamfarsa 2015, Salmaninezhad & Mostowfizadeh-Ghalamfarsa 2017, 2019a). Moreover, some species of Pythium reported from Iran phylogenetically group within the genus Globisporangium and have been renamed accordingly by Nguyen et al. (2022); they include G. ershadii (formerly, P. ershadii, typus from uncultivated soil), G. iranense (formerly P. iranense, typus from soil under Prunus armeniaca), G. kandovanense (formerly P. kandovanense, typus from leaves of Lolium perenne), G. monoclinum (formerly P. monoclinum, typus from uncultivated soil), G. pyrioosporum (formerly P. pyrioosporum, typus from soil under Capsicum annuum), and G. urmianum (formerly P. urmianum, typus from soil under P. dulcis).

Globisporangium has a worldwide distribution and species of this genus, including among others G. splendens and G, ultimum, have been reported on conifers (Lazreg et al. 2013, Uzuhashi et al. 2019). Moreover, several species of Pythium s.l., including P. intermedium, P. irregulare and P. ultimum were reported to be responsible for damping-off of coniferous seedlings in numerous countries. After the taxonomic revisions of Uzuhashi et al. (2010) and Nguyen et al. (2022), these three species were included in the genus Globisporangium and renamed G. intermedium, G. irregulare and G. ultimum, respectively (Darvas et al. 1978, Elvira-Recuenco et al. 2020). However, there are no reports of Globisporangium species on conifers in Iran.

The present paper describes a new species of Globisporangium isolated from conifers and occasionally from a Quercus sp. during a survey of gardens in Shiraz County, Iran, aimed at identifying oomycetes associated to roots of declining ornamental trees. This new species shows unique morphological features and has also been distinguished based on multi-locus phylogenetic analysis.

MATERIALS AND METHODS

Isolation

Samples were randomly collected from rhizosphere soil of ornamental trees showing symptoms of decline in Shiraz gardens, Fars Province, during 2017 to 2019. The trees had brown to black crowns and generally showed decline symptoms such as wilting, defoliation, and dieback, as well as root and crown rot. The disease affected Pinus elderica trees more than other hosts. Coordinates were recorded for each sampling site by Global Positioning System (GPS) (Table 1). Samples were transported to the Mycology Laboratory of the Department of Plant Protection, Shiraz University. One hundred grams of each soil sample were placed in a plastic container and flooded with tap water to 1 cm above the soil surface (Tan 1996). Isolates were recovered from samples by baiting with 5 mm surface sterilized bitter orange (Citrus aurantium) leaf disks or 5 mm pieces of sterile meadow grass (Poa annua) at 25 °C every 8 h for 40 h in total, and plating on CMA-PARP (cornmeal agar, ground corn extract 40 g/L; agar 15 g/L; amended with 10 μg/mL pimaricin, 200 μg/mL ampicillin, 10 μg/mL rifampicin and 25 μg/mL PCNB) (Jeffers & Martin 1986). Isolates were purified via hyphal tips on water agar (WA, Agar 10 g/L) and stored on CMA (extract of 40 g/L ground corn; agar 15 g/L) slopes at 15 °C. Stock cultures were maintained on CMA slopes at 15 °C in the dark.

Table 1.

List of Globisporangium coniferarum isolates recovered from conifers and Quercus sp. in Shiraz County, Iran, with their corresponding CBS and GenBank accession numbers.

Isolate codes1 Date of collection Location Longitude Latitude Matrix GenBank accession number
ITS βtub a cox1 b cox2 c
GbCu04-2* = CBS 148568 Jul. 2018 Shiraz; Golestan BLVD 29.620.813 52.562.442 Cupressus arizonica (Root tissue) ON554847 MZ020764 MZ020754 MZ020759
ChQu06 = CBS 148564 Jun. 2018 Shiraz; Chamran BLVD 29.663.553 52.487.497 Quercus sp. (Crown tissue) ON554845 MZ020767 MZ020757 MZ020762
ErCu18 = CBS 148565 Sep. 2018 Shiraz; Eram Garden 29.635.622 52.525.659 Cupressus sempervirens (Soil) ON554846 MZ020766 MZ020756 MZ020761
MgPi02 = CBS 148566 Aug. 2018 Shiraz; Mahmoudieh BLVD 29.670.653 52.490.953 Pinus elderica (Crown tissue) ON554844 MZ020763 MZ020753 MZ020758
ErLa03 = CBS 148567 Aug. 2018 Shiraz; Eram BLVD 29.635.622 52.525.657 Cupressus sempervirens (Soil) ON554843 MZ020765 MZ020755 MZ020760

1 Abbreviations of isolates and culture collections: CBS = Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; other isolate names and numbers are as given by the collectors. * ex-holotype species.

a β-tubulin. b cytochrome c oxidase subunit I; c cytochrome c oxidase subunit II.

Morphological characterisation

In order to observe asexual organs (sporangia, vesicles and zoospores), isolates were transferred to CMA containing sterile hemp (Cannabis sativa) seeds or turfgrass (Poa sp.) leaves (Mostowfizadeh-Ghalamfarsa & Banihashemi 2005) for 24 h. Hemp seeds or turfgrass were then transferred to Petri dishes containing distilled water (Ho et al. 2012), sterile soil extract (McLeod et al. 2009) or Schmitthenner solution (Schmitthenner 1973) under fluorescent light for 48 h and were checked every 8 h for six times. Sporangia formation was also examined using French bean agar medium (FBA, extract of 30 g/L French bean; agar 15 g/L) (Jeffers & Martin 1986) and sterile soil extract (Mostowfizadeh-Ghalamfarsa et al. 2008). Sexual organs were obtained with hemp seed agar (HSA, ground hemp seed extract 60 g/L; agar 15 g/L) and carrot agar (CA, carrot extract 250 g/L; agar 15 g/L) incubated in darkness. To study colony morphology, isolates were grown on CMA, HSA, CA, potato-dextrose agar (PDA, potato extract 300 g/L; dextrose 20 g/L; agar 15 g/L) and malt extract agar (MEA, 25 g/L; agar 15 g/L) (Mostowfizadeh-Ghalamfarsa & Banihashemi 2005). Plugs (5 mm diam) from the edge of a 3-d-old culture were placed on Petri dishes, each containing 20 mL of a test medium (i.e., CMA, HSA, CA, MEA, and PDA). The plates were incubated at 25 °C for 48 h. Temperature-growth relationships were tested on PDA with three replicate plates per isolate and incubated at 0, 5, 10, 15, 20, 25, 30, 35 and 40 °C. Growth rate was recorded 2–12 d after the onset of linear growth.

DNA extraction, PCR, sequencing and phylogenetic analyses

The method described by Mirsoleimani & Mostowfizadeh-Ghalamfarsa (2013) was employed for DNA extraction. Potato extract broth (extract of 300 g/L boiled potato in distilled water) was used for growth of isolates. Mycelium was harvested, freeze dried, and DNA extract was obtained using the DNGTM-PLUS extraction kit (CinnaGen, Teheran, Iran) according to the manufacturer’s instruction. DNA quality was examined with an MD-1000 NanoDrop machine (NanoDrop Technologies, Wilmington, DE, USA). The primers used for amplification and sequencing of nuclear (internal transcribed spacers 1, 2 and 5.8S gene of rDNA = ITS and β-tubulin gene = βtub) as well as mitochondrial (cytochrome c oxidase subunit I = cox1 and cytochrome c oxidase subunit II = cox2) loci are listed in Table S1. The PCR conditions for these loci are listed in Table S2. PCR products were detected in 1 % agarose gel and purified products were sequenced by Macrogen Europe (Amsterdam, The Netherlands). The sequence quality of the ITS region using ITS4 and ITS6 region was quite low and this region was consequently cloned to obtain clear sequences. The ITS amplification of the primer pairs DC6 and LR0 (Tables S3, S4) were diluted by a factor of 10 and cloned into Escherichia coli using the StrataClone PCR cloning kit (Agilent Technologies, USA) following the manufacturer’s instructions. Single colonies were transferred into 20 μL of distilled molecular biology grade water and PCR conducted with Mango DNA polymerase (Bioline, UK). Reaction mixes of 12.5 μL contained 1× Mango Reaction buffer, 200 μM dNTPs, 2 mM MgCl2, 0.8 μg BSA (bovine serum albumin, Carl Roth GmbH, Germany), 0.4 μM of M13 forward (5’- GTAAAACGACGGCCAG- 3’) and M13 reverse (5’- CAGGAAACAGCTATGAC -3’) plasmid primers, 0.5 U of Mango DNA Polymerase and 0.5 μL of the colony suspension as a template. PCR was carried out on an Eppendorf Mastercycler pro S system equipped with a vapo.protect lid with an initial denaturation at 96 °C for 10 min, 36 cycles at 96 °C for 20 s, 54 °C for 20 s and 72 °C for 60 s, concluding with a final elongation at 72 °C for 4 min. Positive clones were sent for sequencing to the laboratory centre of the Senckenberg Biodiversity and Climate Research Centre (BiK-F, Frankfurt, Germany) using the plasmid primer T3 (5’- ATTAACCCTCACTAAAGGGA) and T7 (5’- TAATACGACTCACTATAGGG) as well as DC6 and LR0. Sequence data were deposited into GenBank.

Resulting sequences were edited by BioEdit (Hall 1999). Sequence alignment was performed using ClustalX (Thompson et al. 1997) with subsequent visual adjustment. Partition homogeneity tests were conducted on combined nuclear and mitochondrial gene alignments by PAUP v. 4.0a136 (Swofford 2002) using 100 replicates and heuristic general search option. BLAST similarity searches were performed with blastn (for nucleotide-versus-nucleotide comparison) (Altschul et al. 1990). In order to reconstruct the phylogenetic trees, Bayesian inference analyses on individual and concatenated ITS, βtub , cox1, and cox2 loci were carried out with MrBayes v. 3.1 (Ronquist & Huelsenbeck 2003), imposing a general time reversible (GTR) substitution model with gamma (G) and proportion of invariable site (I) parameters to accommodate variable rates across sites. Bayesian analyses were conducted with the same dataset according to Safaiefarahani et al. (2015) and Salmaninezhad & Mostowfizadeh-Ghalamfarsa (2019b). The best nucleotide substitution model was determined by MrModelTest v. 2.3 (Nylander 2004). Two independent runs of Markov Chain Monte Carlo (MCMC) using four chains were run over 1 000 000 generations. Trees were saved each 1 000 generations, resulting in 2 002 trees. Burn-in was set at 5 % of the saved trees. To conduct phylogenetic comparisons, maximum likelihood was also used by PHYLIP DNAML (Felsenstein 1993) for the combined tree. The robustness of the maximum likelihood trees was estimated by 1 000 bootstraps. Elongisporangium anandrum was chosen as outgroup (Table S3). Phylogenetic trees were edited and displayed with TREEGRAPH (Stöver & Muller 2010). The alignments and trees were submitted to Figshare (https://www.figshare.com; doi: 10.6084/m9.figshare.20893672).

RESULTS

During the survey of urban gardens in Shiraz County, various oomycete isolates were sourced, including 500 isolates of Pythium s.l. Among 365 isolates of Globisporangium spp. recovered from conifers, one distinct group was detected, which was not referable to any known Globisporangium species; this group also included an isolate from Quercus sp. (Table 1). This group clustered into clade 4, Globisporangium sensu Uzuhashi et al. (2010), according to phylogenetic trees based on ITS, βtub, cox1, and cox2 sequences (Figs S1S4), each of which showed that this group constituted a well-supported monophyletic lineage. Isolates of this group produced globose to subglobose and pedicellate sporangia as well as detaching vesicles, and smooth-walled oogonia. The oogonia showed diverse shapes, from globose to ovoid or ellipsoid. The combination of morphological characteristics of this group of isolates was unique compared to the other known species of Globisporangium.

Phylogenetic analyses

Isolates of this group had identical sequences of both nuclear and mitochondrial genes. The βtub sequences of the isolates showed 99 % similarity with G. nagaii (JX397970), G. sylvaticum (MK752998), and 98 % similarity with Pythium sp. (EF195140), and Phytopythium oedochilum (DQ071326). The cox1 sequences of the isolates showed 98 and 99 % similarity with Pythium sp. (MG182704) and G. mamillatum (GU071819), respectively. The cox2 sequences had 99 % similarity with G. nagaii (JX397984), G. attrantheridium (GU071764), and G. spinosum (MN381730). Despite our repeated efforts for sequencing, ITS sequences using ITS4 and ITS6 primer pairs as well as DC6 and LR0 primer pairs alone, showed extremely poor quality. To address the problem of low-quality ITS sequences, we conducted cloning of the ITS region. At first, using T3 and T7 universal primer pairs for sequencing did not work well and only the 18S region of ITS rDNA had a good sequencing quality. To address this problem, we performed two main approaches: (1) Performing the colony PCR using M13 forward and reverse primer after allowing the clones to grow for 24 h, and (2) Sequencing of the inserted region in the plasmid using DC6 and LR0 primers. Using these two approaches, we obtained high-quality sequences of the ITS region. The ITS sequences of the isolates showed 88.77 % similarity with Pythium sp. MNS2014a (KM047893.1), Globisporangium sp. MT2021c (LC644723.1), and 88.47 % similarity with G. nagaii (KU211238.1).

The final alignment length was 508 bp for cox2, 457 bp for βtub, 610 bp for cox1, 1406 bp for ITS, and 3 011 bp for combined gene regions (Table S4). All trees resulting from Bayesian inference and maximum likelihood analyses showed similar topologies, hence, Bayesian trees were shown with both Bayesian posterior probability and maximum likelihood bootstrap values. The new group of isolates formed a well-supported monophyletic clade in all phylogenetic trees (Bayesian posterior probability 0.89–1.00; maximum likelihood bootstrap support 100 %; Fig. 1). In the βtub tree, the isolates clustered in the vicinity of G. nagaii, G. nunn and G. perplexum (Fig. S1). In other trees, the isolates clustered in the proximity of G. nagaii, G. okanoganense, G. violae, G. iwayamae, and G. paddicum (Figs S2S4).

Fig. 1.

Fig. 1.

Phylogenetic relationships of Globisporangium isolates from conifers and Quercus sp. (Shiraz County, Iran) among 20 Globisporangium species based on Bayesian analysis of multigene genealogies of nuclear (ITS and βtub) and mitochondrial (cox1 and cox2) sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

Taxonomy

Globisporangium coniferarum Salmaninezhad & Mostowf., sp. nov. MycoBank MB 838368.

Etymology: The name refers to the conifers, the host plants from which isolates of this species were recovered most frequently.

Typus: Iran, Fars Province, Shiraz (29.620.813, 52.562.442), isolated from the roots of Cupressus arizonica, 10 Jul. 2018 (Table 1), F. Salmaninezhad (holotype CBS 148568 stored in a metabolically inactive state, fungarium of the Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; culture ex-type GbCu04-2 = CBS 148568); GenBank: βtub = MZ020764; cox2 = MZ020759; cox1 = MZ020754; ITS = ON554847.

Colonies on CMA show a chrysanthemum pattern, on PDA and MEA show an intermediate and rosette pattern, respectively, and on HSA show a radial submerged pattern (Fig. 2). Main hyphae have 3.1–7.3 (av. 7) μm width. Abundant chlamydospores formed both in liquid and solid media (i.e., CMA and HSA). Chlamydospores are globose, subglobose, and ovoid, terminal and intercalary, and are 17.5–23.8 (av. 23) μm diam (Fig. 3). Sporangia are ellipsoid, globose to ovoid, with pedicels, without papillae, non-proliferating, mostly terminal and rarely intercalary, 16.3–17.6 (av. 17) μm diam (Fig. 3). In contrast to the abundant chlamydospore formation, few vesicles and zoospores form after 36–72 h at 25–30 °C. Vesicle formation is unique in this taxon, in which the vesicle smoothly separates from the sporangium and discharges in a farther position from the sporangium. Zoospore release does not easily progress in this taxon, and it lasts for at least 20 min. Oogonia are globose, ovoid, and ellipsoid, smooth, terminal and intercalary, 25.9–27.6 (av. 27) μm (Fig. 3). Antheridia are 1–5 per oogonium, clavate to no specific shape, terminal and intercalary, diclinous and monoclinous, with a terminal contact, paragynous, rarely hypogynous (Fig. 3). Antheridium origination in monoclinous oospores is near oogonium stalk. Oospores are globose, mostly plerotic 21.3–23.2 (av. 22.0) μm with a wall which is 1.9–3.1 (av. 3 μm) μm thick. Morphometric results are shown in Table 2. Colonies on PDA have an average radial growth rate of 6 mm at 25 °C. Cardinal temperatures: optimum 30 °C, minimum 15 °C, and maximum 40 °C (Fig. 4). Key characteristics that distinguish Globisporangium coniferarum from other closely related species of Globisporangium are shown in Table 3.

Fig. 2.

Fig. 2.

Colony morphology of Globisporangium coniferarum CBS 148568 (after 48 h) on various media at 25 °C; top (from left to right): carrot agar, malt extract agar and potato-dextrose agar; bottom (from left to right): cornmeal agar and hempseed agar.

Fig. 3.

Fig. 3.

Morphology of Globisporangium coniferarum. A, B. Sporangia: A. Terminal ovoid sporangium with pedicel (arrow); B. Globose sporangia. C–K. Sexual structures: C. Formation of intercalary aplerotic oogonium with paragynous diclinous antheridium (arrow); D. Plerotic ellipsoid oospore; E. Asymmetrical plerotic oospore with diclinous clavate antheridium (arrow); F. Plerotic terminal oospore; G. Nearly aplerotic globose oospore; H. Ovoid oospore with intercalary, paragynous and diclinous antheridium (arrow); I. Intercalary plerotic oospore with hypogynous antheridia (arrows); J. Globose oospore; K. Intercalary nearly aplerotic oospore with paragynous, monoclinous antheridium originated near oogonium (arrow). L–N. Chlamydospores: L. Terminal globose chlamydospore; M. Intercalary globose chlamydospore; N. Intercalary ovoid chlamydospore. O. Amorphous to ovoid chlamydospore. Scale bar = 10 μm.

Table 2.

Morphological and morphometrical (μm) features of Globisporangium coniferarum isolates from conifers and Quercus sp. in Shiraz County, Iran.

Isolates Sporangium
Main hypha
Oogonium
Oospore
Antheridium
Average Range Shape Average Range Shape Average Range Type Average Range Wall Shape Average Range
GbCu04-2 23.412 12.815–29.701 Mostly globose 3.414 ± 0.5 2.501–6.011 Globose to amorphous 25.432 ± 1.5 17.741–26.911 Aplerotic 19.122 ± 1.5 16.631–26.104 1.111 ± 0.5 Clavate 5.311 4.324–6.211
ChQu06 23.534 15.548–30.005 Mostly globose 3.124 ± 1.0 2.555–5.841 Globose to amorphous 25.392 ± 1.1 18.003–27.843 Aplerotic 20.003 ± 1.2 17.238–26.004 1.512 ± 1.1 Clavate 5.234 4.031–6.004
ErCu18 25.005 20.013–30.342 Mostly globose 3.659 ± 1.3 3.005–6.124 Globose to amorphous 26.362 ± 0.5 17.751–26.555 Aplerotic 19.321 ± 0.5 16.385–25.474 1.323 ± 1.0 Clavate 5.405 4.127–6.124
MgPi02 24.301 19.984–30.012 Mostly globose 3.103 ± 1.1 2.381–5.003 Globose to amorphous 25.471± 1.2 17.304–26.711 Aplerotic 19.113 ± 2.5 16.112–26.120 1.396 ± 1.5 Clavate 6.004 4.983–6.549
ErLa03 23.013 16.873–27.564 Mostly globose 3.013 ± 1.5 2.444–6.013 Globose to amorphous 26.001 ± 1.0 18.683–27.904 Aplerotic 20.43 ± 0.7 17.005–26.492 1.123 ± 0.7 Clavate 5.125 4.005–6.139

Fig. 4.

Fig. 4.

Average radial growth rate of Globisporangium coniferarum isolates on potato-dextrose agar at different temperatures.

Table 3.

Comparison of morphological features of Globisporangium coniferarum with closely related species.

Character G. coniferarum G. canariense G. nagaii G. paddicum G. okanoganense G. iwayamae G. violae G. monoclinum
Cardinal Temperatures (°C) 15;30;40 No data 9;28;35 No data 5;20;<30 5;25;30 5;25;35 5;25;35
Daily Growth Rate at 25 °C (mm) 6 14–15 25 No data 4 14 15 14
Colony Pattern on CMA Radial submerged Chrysanthemum No data No data Submerged Submerged, vaguely radiate With aerial mycelium Submerged
Hyphae (μm) 3.1–7.3 7 4 No data 8 6.6 6 5
Chlamydospore (+), (sub)globose, ovoid - - - - + - -
Sporangium or Hyphal Swelling Production (μm) (+) 16.3–17.6 (+) 18–30 (+) (+) 25–30 (+) 30–35 (+) 28–48 × 44 (+) 25–30 (+) 15–26
Sporangium or Hyphal Swelling Shape Ellipsoid, globose, ovoid, with pedicel Spherical, (sub)globose, pyriform, peanut-shape, dumb-bell shape, elongated Ovoid, pyriform (Sub)globose, oval, limoniform (Sub)globose to pyriform Spherical, ellipsoidal, ovoid, papillate Globose Globose to occasionally subglobose
Sporangium Proliferation - - + + + - - -
Sporangium or Hyphal Swelling Position Mostly terminal Mostly intercalary and catenulate Terminal Terminal Terminal Termianl Terminal or intercalary Terminal or intercalary
Zoospore Production + + + + + + - -
Homothallic/Heterothallic Homothallic Homothallic Homothallic Homothallic Homothallic Homothallic Homothallic Homothallic
Oogonium Ornamentation Smooth Smooth Smooth Ornamented Smooth Smooth Smooth Smooth
Oogonium Shape and Dimensions (μm) Globose, ovoid, ellipsoid, 25.9–26.7 Spherical, 19–30 Globose, sometimes irregular, 14–22 Globose (No data) Globose, 24–30 Globose (No data) Globose, 27–38 (Sub)globose, rarely elongated, 16–26
Antheridium Shape Clavate to no specific shape Mostly sessile Clavate Clavate to sessile Crook-naked Clavate Sessile Sessile
Antheridium Type and Number per Oogonium Monoclinous and diclinous, paragynous, rarely hypogynous, 1–5 Monoclinous, paragynous, 1–6 Monoclinous, 1 (disappears after fertilization) Monoclinous and diclinous, 1–4 Monoclinous and diclinous, 1–3 Monoclinous and diclinous, 1–3 Mostly monoclinous,1-8 Mostly monoclinous, 1–2
Oospore Type and Dimensions (μm) Aplerotic and plerotic, 21.3–23.2 Plerotic, 17–29 Aplerotic, 12–19 Aplerotic, (No data) Aplerotic to mostly plerotic, 22–27 Aplerotic and plerotic, 19–24 Aplerotic, 24–30 Plerotic, rarely aplerotic, 10–24
Oospore Wall (μm) 1.9–3.1 2–4 0.8 No data 1.5–3 No data 3 2
Number of Oospore per Oogonium 1 1 1 1 1 1 1 1

Additional isolates examined (paratypes , stored as metabolically inactive cultures): Iran, Fars Province, Shiraz (29.663.553, 52.487.497), from the crown of Quercus sp., 9 Jun. 2018, F. Salmaninezhad, ChQu06 (culture ex-paratype CBS 148564), GenBank: βtub = MZ020767; cox2 = MZ020762; cox1 = MZ020757; ITS = ON554845; Fars Province, Shiraz (29.635.622, 52.525.659), from rhizosphere soil of Cupressus sempervirens, 16 Apr. 2018, F. Salmaninezhad, ErCu18 (culture ex-paratype CBS 148565), GenBank: βtub = MZ020766; cox2 = MZ020756; cox1 = MZ020761; ITS = ON554846; Fars Province, Shiraz (29.670.653, 52.490.953), from the crown tissue of Pinus elderlica, 12 May 2018, F. Salmaninezhad, MgPi02 (culture ex-paratype CBS 148566), GenBank: βtub = MZ020763; cox2 = MZ020758; cox1 = MZ020753; ITS = ON554844; Fars Province, Shiraz (29.635.622, 52.525.657), from rhizosphere soil of Melaleosa citrina, 15 Jun. 2018, F. Salmaninezhad, ErLa03 (culture ex-paratype CBS 148567), GenBank: βtub = MZ020765; cox2 = MZ020760; cox1 = MZ020755; ITS = ON554843 (Table 1).

Notes: Globisporangium coniferarum belongs to clade 4 of Globisporangium sensu Uzuhashi et al. (2010), clustering in the proximity of G. nagaii (Fig. 1). Globisporangium coniferarum is differentiated from other known species by its high temperature requirement, amorphous oogonia, its specific vesicle formation and zoospore release, and its unique sequences of mitochondrial and nuclear genes. Isolates were recovered from various sites in Shiraz County in Iran.

DISCUSSION

During 2013–2019, diverse oomycete isolates including 500 Pythium sensu lato isolates were sourced from rhizosphere soil of ornamental trees in Shiraz County. The great number and diversity of Pythium species (Salmaninezhad & Mostowfizadeh-Ghalamfarsa 2019a) recovered during the survey indicate that high humidity and warm temperatures in urban gardens provide a favourable ecological niche for these soilborne microorganisms. The majority of Pythium s.l. isolates recovered from ornamental trees were referred to the genus Globisporangium sensu Uzuhashi et al. (2010). Phylogenetic analysis revealed a new distinct lineage in Globisporangium encompassing isolates with peculiar morphological traits which differentiate this group of isolates from all other described Globisporangium species. This lineage was formally described as a new species, G. coniferarum, an epithet stressing that most of these isolates were recovered from conifers. The split of Pythium into five distinct genera and the segregation of Globisporangium as a separate genus by Uzuhashi et al. (2010) were questioned by De Cock et al. (2015) as this, although justified based on morphological characters and nomenclaturally valid, was not well-supported by phylogenetic analysis. Consequently, authors in general have been cautious in using the name Globisporangium to describe new species or report new records, and in most cases they have preferred the well-established name Pythium. Despite this, after the formal introduction of the genus Globisporangium, there have been numerous reports of Globisporangium species from across the world and a few have been from Iran (Bolboli & Mostowfizadeh-Ghalamfarsa 2015, Salmaninezhad & Mostowfizadeh-Ghalamfarsa 2017, 2019a). Quite recently, a new species, G. lacustre, has been described formally and two new nomenclatural combinations were added to the genus (Uzuhashi et al. 2019). In the taxonomic revision of Nguyen et al. (2022) not only the distinction between Globisporangium and Pythium s.s. has been corroborated by phylogenomic analysis, but also the use of the name Globisporangium sensu Uzuhashi et al. (2010) has been recommended.

Phylogenetically, Globisporangium coniferarum is closely related to G. nagaii, G. violae, G. cederbergense, G. okanoganense, G. paddicum, G. iwayamae, and G. canariense. Furthermore, according to the cox1 phylogeny (Fig. S2), G. coniferarum appeared as a sister taxon to G. monoclinum, which was not consistent with the ITS tree where G. monoclinum was a diverged lineage to clade G of Globisporangium. Several unique morphological features separate G. coniferarum from other species. For instance, G. nagaii is known to produce sporangia with proliferation whereas no proliferation has been observed in G. coniferarum isolates. Moreover, G. nagaii has been reported to produce monoclinous and single antheridia, smooth and terminal oogonia (Van der Plaats-Niterink 1981), while G. coniferarum produces irregular oogonia and monoclinous or diclinous, clavate antheridia. Besides, cardinal temperatures for G. nagaii are 9, 28 and 35 °C, while cardinal temperatures for G. coniferarum are higher, i.e., 15, 30 and 40 °C, respectively.

Sporangial production is unknown in G. violae. It only forms aplerotic oospores with up to eight sessile-shaped antheridia which are mostly monoclinous (Van der Plaats-Niterink 1981). Unlike abundant zoospore production in G. coniferarum, G. violae has never been reported to produce zoospores. Symmetrical oospores and paragynous antheridia were rarely observed in G. coniferarum, whereas G. violae is known to produce only symmetrical oospores with mostly monoclinous antheridia. Besides, G. violae produces aerial mycelium on CMA (Van der Plaats-Niterink 1981), while no aerial mycelium was observed on any media in case of G. coniferarum. Moreover, cardinal temperatures for G. violae isolates were between 5 and 35 °C (Van der Plaats-Niterink 1981), while in G. coniferarum were between 15 to 40 °C and the isolates could not tolerate less than 9 °C.

Globisporangium cederbergense does not produce zoospores (Bahramisharif et al. 2013). However, production of terminal and globose hyphal swellings, terminal, or intercalary oospores with up to two monoclinous antheridia has been reported in this species (Bahramisharif et al. 2013). Furthermore, terminal to intercalary hyphal swellings, clavate antheridia, and both mono- and diclinous antheridia were observed in G. coniferarum. Additionally, G. cederbergense is known to produce only aplerotic oospores (Bahramisharif et al. 2013), whereas G. coniferarum produces both plerotic and aplerotic oospores. Minimum temperature for growth in G. cederbergense is 3 to 5 °C, whereas G. coniferarum could not tolerate temperatures below 15 °C.

Globisporangium okanoganense produces only terminal sporangia with different shapes, i.e., from globose to pyriform which are infrequently proliferating and borne in sympodial succession (Van der Plaats-Niterink 1981) whereas G. coniferarum does not have proliferated sporangia and sympodial succession was never observed in this species. Although both G. coniferarum and G. okanoganense produce smooth, terminal to intercalary oospores with monoclinous to diclinous antheridia, G. okanoganense is well-known to have globose to subglobose oogonia with unequally thickness in its wall and antheridia are terminally attached to the oogonium (Van der Plaats-Niterink 1981). However, G. coniferarum produces mostly asymmetrical oogonia with both terminal and lateral attached antheridia to oogonia. Besides, antheridial stalks are mostly swollen in G. okanoganense which was not observed in G. coniferarum.

Formation of ornamented oospores with up to four antheridia separates G. paddicum from G. coniferarum (Van der Plaats-Niterink 1981). None of the isolates assigned to G. coniferarum evaluated in this study produced ornamented oogonia.

The most closely related species to G. coniferarum is G. iwayamae regarding its morphology. They both produce terminal to intercalary, smooth oogonia, mono- or diclinous, clavate antheridia, globose chlamydospores, and ovoid to ellipsoid sporangia (Van der Plaats-Niterink 1981). However, production of both terminal and intercalary sporangia, mostly plerotic oospores, more antheridia per oogonium (up to 5) and unbranched antheridial stalks by G. coniferarum, completely separates it morphologically from G. iwayamae. Besides, cardinal temperatures in G. iwayamae are 5, 25, and 30 °C, while in G. coniferarum are 15, 30, and 40 °C.

Globisporangium canariense forms spherical to pyriform papillate, intercalary, and sometimes catenulate sporangia with up to six antheridia per oogonium which crowded the oogonium (Paul 2002). However, G. coniferarum does not have any catenulated sporangia and no more than five antheridia were observed in this species. Besides, apical and lateral attachment of antheridia to oogonia, production of pedicellate sporangia, and specific formation of zoospores in G. coniferarum separates it from G. canariense.

Globisporangium monoclinum does not produce any sporangia or zoospores which separates it from G. coniferarum (Badali et al. 2020). In addition, catenulated oogonia was reported in G. monoclinum (Badali et al. 2020), which was never observed in G. coniferarum. Globisporangium monoclinum has only been identified based on ITS and cox1 loci, hence, we did not add it to our concatenated phylogeny.

Production of abundant chlamydospores in liquid media is a unique characteristic of G. coniferarum, which separates it from all other known Globisporangium species. Moreover, formation of pedicellate sporangia, slow release of zoospores, amorphous oogonia, clavate, paragynous to hypogynous antheridia differentiated this species from other known Globisporangium species.

Multiple gene genealogy studies of nuclear (ITS and βtub) and mitochondrial (cox2 and cox1) sequences revealed that all isolates examined in this study formed a monophyletic group in clade G of Pythium sensu Lévesque & de Cock (2004) which is now included in Globisporangium (Uzuhashi et al. 2010, Nguyen et al. 2022). Analysing the ITS region of the clones showed that the maximum nucleotide diversity can be observed in ITS1 and ITS2 regions. Aligning these sequences with other Globisporangium species sequences showed that all Globisporangium species show this diversity in their ITS1 and ITS2 regions (Table S4). Hence, it can be concluded that all Globisporangium species have very conserved yet diverse ITS1 and ITS2 regions, similar to other Pythium s.l. species which separates them as a different genus.

The presence of multiple divergent copies of the ITS region is a well-known character among Pythium s.l. species, such as Phytopythium helicoides, Pp. litorale, Pp. mercuriale, Pp. vexans complex, G. mamillatum, G. splendens, G. heterothallicum, G. rostratifingenes, G. irregulare, G. cryptoirregulare, G. ultimum, G. spinosum, G. perplexum, P. acanthicum complex, P. arrhenomanes and P. graminicola (Kageyama et al. 2007, Belbahri et al. 2008, McLeod et al. 2009, Spies et al. 2011). All the mentioned species have intraspecific ITS sequence variability. Globisporangium coniferarum ITS sequences of the clones showed that the ITS region of G. coniferarum had many insertions (data not shown). These insertions led to the overlapping of the direct sequences, disruption of the electropherograms, and consequently low-quality sequences. Furthermore, G. coniferarum isolates also showed intraspecific ITS sequence variability (Table S2). In addition, sequences had multiple tandem repeats (data not shown). Using the resulting contigs of ITS clones, we showed that G. coniferarum is a new species located in a separate lineage close to G. nagaii. Other loci sequences (i.e., βtub, cox1, and cox2) showed a very high quality and strongly supported the separation of this new species.

Members of clade E, F, G, and I of Pythium s.l. are known to produce ovoid and internally proliferating sporangia as well as oogonia with smooth walls (Uzuhashi et al. 2016). The exception is P. paddicum which produces ornamented oospores. The results showed that G. coniferarum isolates had these features and are closely related to G. nagaii, G. nunn, G. perplexum, and G. rostratum. However, morphological and phylogenetic analyses strongly discriminate G. coniferarum as a new taxon. Data of βtub sequences did not show any signs of ambiguous signals in nucleotide positions that could be inferred as evidence for hybrid origin of this lineage. Phylogenetic analysis of ITS regions derived from cloning-based sequencing also revealed the same results and showed that G. coniferarum is a new species close to G. nagaii.

This study describes a new Globisporangium species in clade G of Pythium s.l. found prevalently associated with the roots and rhizosphere soil of conifers and recovered occasionally also from rhizosphere soil of Quercus sp. in Iran. The ecology, pathogenicity and the host-range of this new species deserve to be further investigated to clarify its role, if any, in the decline of ornamental trees in urban gardens of Iran.

Acknowledgments

Authors would like to thank Prof. Marco Thines for his valuable technical assistance. They wish to thank Mrs Ann Davis for revising the English text. This research was funded by the Iran National Science Foundation (INSF, award number 4001002) and by the University of Catania, Italy, Investigation of phytopathological problems of the main Sicilian productive contexts and eco-sustainable defense strategies (MEDIT-ECO) PiaCeRi-PIAno di inCEntivi per la Ricerca di Ateneo 2020-22 linea 2 5A722192155. F.A. has been granted a fellowship by the PON RICERCA E INNOVAZIONE 2014–2020, Azione II – Obiettivo Specifico 1b – Progetto Miglioramento delle produzioni agroalimentari mediterranee in condizioni di carenza di risorse idriche – WATER4AGRIFOOD, cod. CUP: B64I20000160005.

Footnotes

Conflict of interest: The authors declare that there is no conflict of interest.

Supplementary Material: http://fuse-journal.org/

Fig. S1.

Phylogenetic relationships of Globisporangium spp. from conifers and Quercus sp. (Shiraz County, Iran) among 17 Globisporangium species based on Bayesian analysis of βtub sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

fuse-2022-10-5-SF1.jpg (222.1KB, jpg)
Fig. S2.

Phylogenetic relationships of Globisporangium spp. from conifers and Quercus sp. (Shiraz County, Iran) among 16 Globisporangium species based on Bayesian analysis of cox1 sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

fuse-2022-10-5-SF2.jpg (591.8KB, jpg)
Fig. S3.

Phylogenetic relationships of Globisporangium spp. from conifers and Quercus sp. (Shiraz County, Iran) among 17 Globisporangium species based on Bayesian analysis of cox2 sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

fuse-2022-10-5-SF3.jpg (273.6KB, jpg)
Fig. S4.

Phylogenetic relationships of Globisporangium spp. from conifers and Quercus sp. (Shiraz County, Iran) among 33 Globisporangium species based on Bayesian analysis of Internal transcribed spacer (ITS) sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

fuse-2022-10-5-SF4.jpg (615.6KB, jpg)
Table S1.

List of primers used in this study.

fuse-2022-10-5-SD1.jpg (221.2KB, jpg)
Table S2.

Polymerase chain reaction conditions for primers used in this study.

fuse-2022-10-5-SD2.jpg (150.1KB, jpg)
Table S3.

Information of all the Globisporangium isolates used in the phylogenetic analyses, including local, international, and alternative isolate identifications. GenBank accession numbers for sequences obtained in present study are shown in bold.

fuse-2022-10-5-SD3-1.jpg (370.8KB, jpg)
fuse-2022-10-5-SD3-2.jpg (480.4KB, jpg)
Table S4.

Base pairs differences across β-tub, ITS, cox1 and cox2 sequences showing the inter- and intraspecific variation of G. coniferarum (CON), and other related species, including, G. nagaii (NAG), G. violae (VIO), G. paddicum (PAD), G. okanoganense (OKA), G. canariense (CAN), G. monoclinum (MON), and G. iwayamae (IWA).

fuse-2022-10-5-SD4.jpg (201.8KB, jpg)

REFERENCES

  1. Altschul SFW, Gish W, Miller EW, et al. (1990). Basic local alignment search tool. Journal of Molecular Biology 215: 403–410. [DOI] [PubMed] [Google Scholar]
  2. Bahramisharif A, Lamprecht SC, Spies CF, et al. (2013). Pythium cederbergense sp. nov. and related taxa from Pythium clade G associated with the South African indigenous plant Aspalathus linearis (rooibos). Mycologia 105: 1174–1189. [DOI] [PubMed] [Google Scholar]
  3. Badali F, Abrinbana M, Abdollahzadeh J. (2020). Morphological and molecular taxonomy of Pythium monoclinum Abrinbana, Abdollahz. & Badali, sp. nov., and P. iranense sp. nov., from Iran. Cryptogamie Mycologie 41: 179–191. [Google Scholar]
  4. Barber PA, Paap T, Burgess TI, et al. (2013). A diverse range of Phytophthora species are associated with dying urban trees. Urban Forestry & Urban Greening 12: 569–575. [Google Scholar]
  5. Belbahri L, McLeod A, Paul B, et al. (2008). Intraspecific and within-isolate sequence variation in the ITS rRNA gene region of Pythium mercuriale sp. nov. (Pythiaceae). FEMS Microbiology Letters 284: 17–27. [DOI] [PubMed] [Google Scholar]
  6. Bolboli Z, Mostowfizadeh-Ghalamfarsa R. (2015). Phylogenetic relationships and taxonomic characteristics of Pythium spp. isolates in cereal fields of Fars province. Iranian Journal of Plant Pathology 51: 471–492. [Google Scholar]
  7. Bonants P, Hagenaar-de Weerdt M, et al. (1997). Detection and identification of Phytophthora fragariae Hickman by polymerase chain reaction. European Journal of Plant Pathology 103: 345–355. [Google Scholar]
  8. Cooke DEL, Drenth A, Duncan JM, et al. (2000). A molecular phylogeny of Phytophthora and related oomycetes. Fungal Genetics and Biology 30:13–32. [DOI] [PubMed] [Google Scholar]
  9. Darvas JM, Scott DB, Kotze JM. (1978). Fungi associated with damping-off in coniferous seedlings in South African nurseries. South African Forestry Journal 104: 15–19. [Google Scholar]
  10. De Cock AWAM, Lodhi AM, Rintoul TL, et al. (2015). Phytopythium: molecular phylogeny and systematics. Persoonia 34: 25–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Elvira-Recuenco M, Cacciola SO, Sanz-Ros AV. et al. (2020). Potential interactions between invasive Fusarium circinatum and other pine pathogens in Europe. Forests 11: 7. [Google Scholar]
  12. Ershad D. (2009). Fungi of Iran. 2nd edn. Iranian Research Institute of Plant Protection: Tehran, Iran. [Google Scholar]
  13. Erwin DC, Ribeiro O. (1996). Phytophthora diseases worldwide. 1st edn. APS Press: St Paul, MN, USA. [Google Scholar]
  14. Felsenstein J. (1993). PHYLIP (phylogeny inference package). Version 3.5c. Distributed by the author, Seattle, USA: University of Washington, Department of Genetics. [Google Scholar]
  15. Giordana G, Kitzberger T, La Manna L. (2020). Anthropogenic factors control the distribution of a southern conifer Phytophthora disease in a peri-urban area in northern Patagonia, Argentina. Forests 11: 1183. [Google Scholar]
  16. Hall TA. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acid Science 41: 95–98. [Google Scholar]
  17. Ho HH, Chen XX, Zeng HC, et al. (2012). The occurrence distribution of Pythium species in Hanian South Island of China. Botanical Studies 53: 525–534. [Google Scholar]
  18. Jeffers SN, Martin SB. (1968). Comparison of two media selective for Phytophthora and Pythium species. Plant Disease 70: 1035–1043. [Google Scholar]
  19. Jung T, La Spada F, Pane A. et al. (2019). Diversity and distribution of Phytophthora species in protected natural areas in Sicily. Forests 10: 259. [Google Scholar]
  20. Kageyama K, Senda M, Asano T, et al. (2007). Intra-isolate heterogeneity of the ITS region of rDNA in Pythium helicoides. Mycological Research 111: 416–423. [DOI] [PubMed] [Google Scholar]
  21. Khdiar MY, Barber PA, Hardy GEStJ, et al. (2020). Association of Phytophthora with declining vegetation in an urban forest environment. Microorganisms 8: 973–989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kobayashi S, Uzuhashi S, Tojo M, et al. (2010). Characterization of Pythium nunn newly recorded in Japan and its antagonistic activity against P. ultimum var. ultimum. Journal of General Plant Pathology 76: 278–283. [Google Scholar]
  23. La Spada F, Cock PJA, Randall E. et al. (2022). DNA metabarcoding and isolation by baiting complement each other in revealing Phytophthora diversity in anthropized and natural ecosystems. Journal of Fungi 8: 330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lazreg F, Belabid L, Sanchez J, et al. (2013). First report of Globisporangium ultimum causing Pythium Damping-Off on Aleppo Pine in Algeria, Africa, and the Mediterranean Region. Plant Disease 97: 1111. [DOI] [PubMed] [Google Scholar]
  25. Lévesque CA, De Cock AW. (2004). Molecular phylogeny and taxonomy of the genus Pythium. Mycological Research 108: 1363–1383. [DOI] [PubMed] [Google Scholar]
  26. McLeod A, Botha WJ, Meitz JC, et al. (2009). Morphological and phylogenetic analysis of Pythium species in South Africa. Mycological Research 113: 933–951. [DOI] [PubMed] [Google Scholar]
  27. Mirabolfathy M, Ershad D. (1993). Isolation of Phytophthora species from root, crown and stem of ornamental plants. Iranian Journal of Plant Pathology 29: 62–70. [Google Scholar]
  28. Mirabolfathy M, Ershad D. (1996). Studies on the conifer damping-off in the forest nurseries of northern and central Iran. Iranian Journal of Plant Pathology 32: 6–13. [Google Scholar]
  29. Mirsoleimani Z, Mostowfizadeh-Ghalamfarsa R. (2013). Characterization of Phytophthora pistaciae, the causal agent of pistachio gummosis, based on host range, morphology and ribosomal genome. Phytopathologia Mediterranea 53: 501–506. [Google Scholar]
  30. Moncalvo JM, Wang HH, Hseu RS. (1995). Phylogenetic relationships in Ganoderma inferred from the internal transcribed spacers and 25S ribosomal DNA sequences. Mycologia 87: 223–223. [Google Scholar]
  31. Mostowfizadeh-Ghalamfarsa R. (2016). Pythium species in Iran. 1st edn. Shiraz University Press, Shiraz, Iran. [Google Scholar]
  32. Mostowfizadeh-Ghalamfarsa R, Banihashemi Z. (2005). Identification of soil Pythium species in Fars Province of Iran. Iranian Journal of Science and Technology Transaction A-Science 29: 79–87. [Google Scholar]
  33. Mostowfizadeh-Ghalamfarsa R, Cooke DEL, Banihashemi Z. (2008). Phytophthora parsiana sp. nov., a new high-temperature tolerant species. Mycological Research 112: 783–794. [DOI] [PubMed] [Google Scholar]
  34. Nowak DJ, Walton JT. (2005). Projected urban growth (2000–2050) and its estimated impact on the US forest resource. Journal of Forest 103: 383–389. [Google Scholar]
  35. Nylander JAA. (2004). MrModeltest v. 2.3. Program distributed by the author. Sweden: Uppsala University, Evolutionary Biology Centre. [Google Scholar]
  36. Nguyen HDT, Dodge A, Dadej K. et al. (2022). Whole genome sequencing and phylogenomic analysis show support for the splitting of genus Pythium. Mycologia 114: 501–515. [DOI] [PubMed] [Google Scholar]
  37. Paul B. (2002). ITS region of Pythium canariense sp. nov., its morphology and its interaction with Botrytis cinerea. FEMS Microbiology Letters 208: 135–141. [DOI] [PubMed] [Google Scholar]
  38. Riolo M, Aloi F, La Spada F, et al. (2020). Diversity of Phytophthora communities across different type of Mediterranean vegetation in a nature reserve area. Forests 11: 853–874. [Google Scholar]
  39. Robideau GP, De Cock AWAM, Coffey MD, et al. (2011). DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Molecular Ecology Resources 11: 1002–1011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rounquist F, Huelsenbeck JP. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. [DOI] [PubMed] [Google Scholar]
  41. Safaeifarahani B, Mostowfizadeh-Ghalamfarsa R, Hardy GEStJ, et al. (2015). Re-evaluation of Phytophthora cryptogea species complex and the description of a new species, Phytophthora pseudocryptogea sp. nov. Mycological Progress 14: 108–120. [Google Scholar]
  42. Salmaninezhad F, Mostowfizadeh-Ghalamfarsa R. (2017). Taxonomy, phylogeny and pathogenicity of Pythium species in rice paddy fields of Fars Province. Iranian Journal of Plant Pathology 53: 31–53. [Google Scholar]
  43. Salmaninezhad F, Mostowfizadeh-Ghalamfarsa R. (2019a). Oomyceteous flora of ornamental trees of Shiraz County (Iran). Rostaniha 20: 29–43. [Google Scholar]
  44. Salmaninezhad F, Mostowfizadeh-Ghalamfarsa R. (2019b). Three new Pythium species from rice paddy fields. Mycologia 111: 274–290. [DOI] [PubMed] [Google Scholar]
  45. Schmitthenner AF. (1973). Isolation and identification methods for Phytophthora and Pythium. Proceedings of the Woody Ornamental Disease Workshop. Colombia, Missouri, USA, 24th Jan. 1973, University of Missouri: 128. [Google Scholar]
  46. Spies CFJ, Mazzola M, McLeod A. (2011). Characterization and detection of Pythium and Phytophthora species associated with grapevines in South Africa. European Journal of Plant Pathology 131: 103–119. [Google Scholar]
  47. Stöver BC, Müller KF. (2010). TreeGraph 2: combining and visualizing evidence from different phylogenetic analyses. BMC Bioinformatics 11: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Swofford D. (2002). PAUP*: Phylogenetic analysis using parsimony (*and other methods). Sunderland: Sinauer Associates. [Google Scholar]
  49. Tan KH. (1996). Soil sampling, preparation and analysis. 1st edn. Marcel Dekker Inc. New York, USA. [Google Scholar]
  50. Thompson JD, Gibson TJ, Plewniak F, et al. (1997). The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: 4876–4882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Uzuhashi S, Hata K, Matsuura S, et al. (2016). Globisporangium oryzicola sp. nov., causing poor seedling establishment of directly seeded rice. Antonie van Leeuwenhoek 110: 543–552. [DOI] [PubMed] [Google Scholar]
  52. Uzuhashi S, Ikeda H, Kamekawa A, et al. (2019). Presence of two species-level groups in Globisporangium splendens isolates in Japan. European Journal of Plant Pathology 154: 751–766. [Google Scholar]
  53. Uzuhashi S, Nakagawa S, Abdelzaher HMA, et al. (2019). Phylogeny and morphology of new species of Globisporangium. Fungal Systematics and Evolution 3: 13–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Uzuhashi S, Tojo M, Kakishima M. (2010). Phylogeny of the genus Pythium and description of new genera. Mycoscience 51: 337–365. [Google Scholar]
  55. Van der Plaats-Niterink AJ. (1981). Monograph of the genus Pythium. Studies in Mycology 21: 1–244. [Google Scholar]
  56. Villa NO, Kageyama K, Asano T, et al. (2006). Phylogenetic relationships of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and β-tubulin gene sequences. Mycologia 98: 410–422. [DOI] [PubMed] [Google Scholar]
  57. White TJ, Bruns T, Lee S, Taylor JW. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In: PCR protocols: a guide to methods and applications. (Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds). Academic Press, USA: 315–322. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1.

Phylogenetic relationships of Globisporangium spp. from conifers and Quercus sp. (Shiraz County, Iran) among 17 Globisporangium species based on Bayesian analysis of βtub sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

fuse-2022-10-5-SF1.jpg (222.1KB, jpg)
Fig. S2.

Phylogenetic relationships of Globisporangium spp. from conifers and Quercus sp. (Shiraz County, Iran) among 16 Globisporangium species based on Bayesian analysis of cox1 sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

fuse-2022-10-5-SF2.jpg (591.8KB, jpg)
Fig. S3.

Phylogenetic relationships of Globisporangium spp. from conifers and Quercus sp. (Shiraz County, Iran) among 17 Globisporangium species based on Bayesian analysis of cox2 sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

fuse-2022-10-5-SF3.jpg (273.6KB, jpg)
Fig. S4.

Phylogenetic relationships of Globisporangium spp. from conifers and Quercus sp. (Shiraz County, Iran) among 33 Globisporangium species based on Bayesian analysis of Internal transcribed spacer (ITS) sequences. Numbers on branches represent posterior probability based on Bayesian analysis and the bootstrap support based on maximum likelihood analysis, respectively.

fuse-2022-10-5-SF4.jpg (615.6KB, jpg)
Table S1.

List of primers used in this study.

fuse-2022-10-5-SD1.jpg (221.2KB, jpg)
Table S2.

Polymerase chain reaction conditions for primers used in this study.

fuse-2022-10-5-SD2.jpg (150.1KB, jpg)
Table S3.

Information of all the Globisporangium isolates used in the phylogenetic analyses, including local, international, and alternative isolate identifications. GenBank accession numbers for sequences obtained in present study are shown in bold.

fuse-2022-10-5-SD3-1.jpg (370.8KB, jpg)
fuse-2022-10-5-SD3-2.jpg (480.4KB, jpg)
Table S4.

Base pairs differences across β-tub, ITS, cox1 and cox2 sequences showing the inter- and intraspecific variation of G. coniferarum (CON), and other related species, including, G. nagaii (NAG), G. violae (VIO), G. paddicum (PAD), G. okanoganense (OKA), G. canariense (CAN), G. monoclinum (MON), and G. iwayamae (IWA).

fuse-2022-10-5-SD4.jpg (201.8KB, jpg)

Articles from Fungal Systematics and Evolution are provided here courtesy of Westerdijk Fungal Biodiversity Institute

RESOURCES