Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Feb 1.
Published in final edited form as: J Mol Endocrinol. 2023 Jan 9;70(2):e220175. doi: 10.1530/JME-22-0175

ERα/ERβ-directed CBS Transcription Mediates E2β-stimulated hUAEC H2S Production

Jin Bai 1, Thomas J Lechuga 1,*, Joshua Makhoul 1, Hao Yan 1, Carol Major 1, Afshan Hameed 1, Dong-bao Chen 1
PMCID: PMC9876575  NIHMSID: NIHMS1860934  PMID: 36476832

Abstract

Elevated endogenous estrogens stimulate human uterine artery endothelial cell (hUAEC) hydrogen sulfide (H2S) production by selectively upregulating the expression of H2S synthesizing enzyme cystathionine β-synthase (CBS), but the underlying mechanisms are underdetermined. We hypothesized that CBS transcription mediates estrogen-stimulated pregnancy-dependent hUAEC H2S production. Estradiol-17β (E2β) stimulated CBS but not cystathionine γ-lyase (CSE) expression in pregnant human UA ex vivo, which was attenuated by the estrogen receptor (ER) antagonist ICI 182,780. E2β stimulated CBS mRNA/protein and H2S production in primary hUAEC from nonpregnant and pregnant women, but with greater responses in pregnant state; all were blocked by ICI 182,780. Human CBS promoter contains multiple estrogen-responsive elements (EREs), including one ERE preferentially binding ERα (αERE) and three EREs preferentially binding ERβ (βERE), and one full ERE (α/βERE) and one half ERE (½α/βERE) binding both ERα and ERβ. Luciferase assays using reporter genes driven by human CBS promoter with a series of 5’-deletions identified the α/βEREs binding both ERα and ERβ (α/βERE and ½α/βERE) to be important for baseline and E2β-stimulated CBS promoter activation. E2β stimulated ERα/ERβ heterodimerization by recruiting ERα to α/βEREs and βERE, and ERβ to βERE, α/βEREs, and αERE. ERα or ERβ agonist alone trans-activated CBS promoter, stimulated CBS mRNA/protein and H2S production to levels comparable to that of E2β-stimulated, while ERα or ERβ antagonist alone abrogated E2β-stimulated responses. E2β did not change human CSE promoter activity and CSE mRNA/protein in hUAEC. Altogether, estrogen-stimulated pregnancy-dependent hUAEC H2S production occurs by selectively upregulating CBS expression via ERα/ERβ-directed gene transcription.

Keywords: Estrogens, Estrogen receptor, H2S biosynthesis, CBS transcription, Pregnancy

INTRODUCTION

Normal pregnancy is associated with profound uterine artery (UA) dilation exemplified by ~20–50-fold rises in uterine blood flow (UtBF) in late pregnant (P) vs. nonpregnant (NP) state, which results in a large volume of maternal blood to be delivered to the maternal-fetal interface to perfuse the placenta (Rosenfeld, 1977, Palmer et al., 1992). UtBF carries out the bidirectional maternal-fetal gas (i.e., O2 and CO2) exchanges and provides nutrients to support fetal and placental growth and survival (Sanghavi and Rutherford, 2014, Thornburg et al., 2000). Abnormal UA Doppler flow is linked to preeclampsia (Yu et al., 2008) and constrained UtBF results in intrauterine growth restriction (Roth et al., 2017).

Pregnancy-associated UA dilation is accompanied by elevated endogenous estrogens whose total levels in the third trimester in women can reach as high as 1000-fold that of NP state (Magness et al., 1998). Daily estradiol-17β (E2β) treatment increases baseline UtBF 30–45% for up to 10 days in intact and ovariectomized NP ewes (Magness et al., 1993); acute E2β treatment provokes rapid (20–30 min) and even more robust up to 10-fold rise in UtBF within 90–120 min (Magness and Rosenfeld, 1989, Reynolds et al., 1998). Enhanced UA endothelial cell (EC) production of nitric oxide (NO) via increased endothelial NO synthase (eNOS) expression and activation is known to mediate estrogen-induced UA dilation (Rosenfeld et al., 1996, Magness et al., 2001, Chen et al., 2004). Estrogen receptor (ER) antagonist ICI 182,780 (ICI) inhibits exogenous and endogenous estrogen-induced rises in UtBF in sheep (Magness et al., 2005), to the extent similar to that of UA local NO blockade by L-NG-nitro arginine methyl ester (L-NAME) (Van Buren et al., 1992, Rosenfeld et al., 1996, Magness et al., 2005, Rosenfeld and Roy, 2014), establishing proximal physiological cause-effect relationships among endogenous estrogen-mediated ER activation, local NO production, and estrogen-induced UA dilation in pregnancy. However, both ICI and L-NAME only block ~70% of E2β-induced and ~26% of baseline pregnancy-associated rises in UtBF (Van Buren et al., 1992, Rosenfeld et al., 1996, Magness et al., 2005, Rosenfeld and Roy, 2014), suggesting other mechanisms to mediate uterine hemodynamics.

The proangiogenic vasodilator hydrogen sulfide (H2S) is endogenously produced mainly from L-cysteine by cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE) (Papapetropoulos et al., 2009, Yang et al., 2008). We have recently shown that through selective upregulation of EC and smooth muscle (SM) CBS expression (Lechuga et al., 2015, Lechuga et al., 2019b, Sheibani et al., 2017), UA H2S production is stimulated by exogenous E2β treatment in ovariectomized sheep (Lechuga et al., 2015) and also positively correlates with endogenous estrogens in sheep (Lechuga et al., 2019c) and women (Sheibani et al., 2017). H2S stimulates pregnancy-dependent relaxation of pressurized UA ex vivo (Sheibani et al., 2017, Li et al., 2020) via activating SM large conductance Ca2+-activated and voltage-dependent potassium channels (Li et al., 2020) for estrogen-induced UA dilation in pregnancy (Rosenfeld et al., 2001, Rosenfeld and Roy, 2012). Thus, H2S is a novel UA dilator that regulates uterine hemodynamics in pregnancy.

Mechanistically, E2β stimulates primary ovine UAEC and UASMC H2S production in vitro by stimulating specific-ER dependent upregulation of CBS transcription, involving ERα and ERβ (Lechuga et al., 2019b, Lechuga et al., 2019a). However, E2β also stimulates CSE expression in these ovine UA cell models, contrasting to in vivo conditions (Sheibani et al., 2017, Lechuga et al., 2015, Lechuga et al., 2019c). Moreover, the nuclear events underlying ERα/ERβ-mediated CBS transcription that mediates E2β stimulation of UA H2S biosynthesis in pregnancy are currently unknown. ERα and ERβ are nuclear transcription factors (TFs); ligated ERα and ERβ can initiate transcription via direct interactions with estrogen response elements (EREs) to stimulate the expression of target genes (Driscoll et al., 1998). We hypothesized that estrogens stimulate pregnancy-dependent UA H2S production through selective upregulation of CBS transcription via ERα and ERβ interaction with the EREs in the CBS promoter. By using ex vivo cultures of freshly prepared UA rings and primary NP and P human UAECs (NP and P hUAEC), we showed herein that E2β stimulates pregnancy/specific ER-dependent human UA H2S production by selective upregulation of CBS mRNA and protein expression at the level of transcription involving direct interactions between ERα/ERβ and the proximal CBS promoter EREs.

MATERIALS AND METHODS

Antibodies and chemicals

Antibodies used in this study were summarized in Table 1. ICI 182,780, 4,4,4-(4-propyl-[1H]-pyrazole-1,3,5-triyl)trisphenol (PPT), diarylpropionitrile (DPN), 1,3-Bis(4-hydroxyphenyl)-4-methyl-5-[4-(2-piperidinylethoxy) phenol]-1Hpyrazoledihydrochloride (MPP), 4-[2-Phenyl-5,7-bis (trifluoromethyl)pyrazolo[1,5-a] pyrimidin-3yl]phenol (PHTPP) were from Tocris (Ellisville, MO). β-cyano-L-alanine (BCA) was from Cayman Chemical (Ann Arbor, MI). Estradiol-17β (E2β), fatty acid free bovine serum albumin (BSA), O-(carboxymethyl) hydroxylamine hemihydrochloride (CHH), fetal bovine serum (FBS), sodium dodecyl sulfate (SDS), hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES), and all other chemicals unless specified were from Sigma (St. Louis, MO).

Table 1:

Antibodies used in this study

Target antigen Vendor/Source Catalog# Working Conc.
human β-actin Life Technology AM4302 1:2000 for WB
human CD31 DAKO M0823 1:50 for IF
human CBS Abcam 140600 1:1000 for WB
human CSE Santa Cruz S374249 1:500 for WB
rabbit IgG Cell Signaling 2729 1:100 for ChIP
1:1000 for IF
Alexa568-labeled goat anti-mouse IgG Fisher A-11004 1:1000 for IF
Alexa488-labeled goat anti-mouse IgG Thermo Scientific A-11001 1:1000 for IF
Alexa488-labeled donkey anti-rabbit IgG Thermo Scientific A-21206 1:1000 for IF
goat anti-mouse IgG (H+L), HRP Invitrogen 32430 1:1000 for WB
goat anti-rabbit IgG (H+L), HRP Invitrogen 32460 1:1000 for WB

Human subjects and UA collection

The main UAs were collected with written consent from NP and P women (n = 5/group) in the event of hysterectomy at the University of California Irvine Medical Center, with ethical approval (HS #2013-9763) from Institutional Review Board for Human Research. The NP subjects were recruited from women aged 39–76 years who were no on steroid treatment and underwent elective hysterectomy due to fibroids, including a 39 year-old in the proliferative phase and a 42 year-old in the secretory phases of the menstrual cycle and three postmenopausal woman. The P subjects were recruited from women aged 24 to 38 years with suspected placental accrete; UAs were collected immediately after Cesarean hysterectomy between 35–36 weeks’ gestation. Subjects’ characteristics were summarized in Table 2. UAs were dissected from parametrium, paracervical tissues, and adjacent myometrium, placed in chilled endothelial cell medium (ECM, ScienCell, La Jolla, CA) with 1% antibiotics, and transported to the laboratory within 1 h.

Table 2:

Clinical characteristics of human subjects (n = 5/group)

Nonpregnant Pregnant P-value
Maternal age (years) 55.2 ± 15.55 33 ± 5.29 0.016
Heart rate (bpm) 73.2 ± 13.10 83.0 ± 8.80 0.202
Gestation age (weeks) n/a 34.9 ± 0.78 n/a
BMI (kg/m2) 22.4 ± 1.72 28.14 ± 4.94 0.041
SBP (mmHg) 117.4 ± 10.4 114.6 ± 6.0 0.616
DBP (mmHg) 73.2 ± 13.1 68.8 ± 7.22 0.529
Birth Weight (g) n/a 2639 ± 190.34 n/a

Ex vivo UA ring studies and immunofluorescence microscopy

Isolated pregnant UAs were cut into small rings (0.5 cm long) and were cultured in fibronectin (Sigma)-coated dish with phenol red free M199 (Gibco Laboratories, Thermo Scientific) containing 0.1% fatty acid-free BSA, 0.5% charcoal-stripped FBS, 1% penicillin/streptomycin, and 25 mM HEPES. The rings were treated with 10 nM E2β in the absence or presence of 1 μM of ICI 182,78 for 24 h; the rings were fixed in 4% paraformaldehyde, paraffin embedded, and then sectioned for analyzing CBS and CSE proteins by immunofluorescence microscopy. Briefly, sections (6 μm) were blocked in non-specific binding in phosphate buffered saline (PBS) containing 1% BSA at room temperature (RMT) for 30 min, then incubated with 1 μg/ml anti-CD31 (Dako) in 0.5% BSA-PBS overnight at 4°C. Following three 5-minute washes in PBS, the sections were incubated with Alexa568 mouse immunoglobin G (IgG, 2 μg/ml) at RMT for 1 h. After three 20-min washes in PBS, sections were blocked with 1% BSA-PBS and then incubated with 1 μg/ml of anti-CBS or anti-CSE antibodies at 4°C overnight, followed by Alexa488 rabbit IgG or Alexa488 mouse IgG (2 μg/ml) at RMT for 1 h. IgG was used as a negative control. The sections were washed and mounted with SlowFade gold antifade mountant containing 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen) for labeling nuclei. The sections were examined under a confocal laser scanning microscope Olympus FV3000 (Olympus Corporation, Tokyo, Japan). Images were acquired for quantifying CBS and CSE proteins in smooth muscle cells (SMC) and EC as previously described (Lechuga et al., 2015). Briefly, the average mean gray-value of cells from negative control without primary antibody accounted for autofluorescence and nonspecific background, which was subtracted from all counts generated from specific antibody-treated samples. CBS and CSE protein levels were presented as fold changes relative to average fluorescence intensity of smooth cells in untreated controls.

Cell isolation, culture, and treatment

Human UA endothelial cells (hUAEC) were isolated as described previously (Zhang, et.al., 2017; Bai and Chen, 2021). Briefly, UAs were dissected free of connective tissues and rinsed free of blood by phosphate buffered saline (PBS). Intact UA segments (~4 cm long) were filled with PBS containing 2 mg/mL collagenase II with ends tightened and allowed for digestion at 37°C for 45 min. Endothelial cell sheets were flushed out and plated in a 100-mm culture dish and cultured in complete ECM containing 5% FBS, endothelial growth supplements, and 1% penicillin/streptomycin. Endothelial cell colonies were manually picked and separately plated in 24-well plate. After purification and EC determination, cells were stored in liquid N2 at passage 2. Frozen UAEC aliquots were thawed and subcultured in complete ECM for experimental use within 5 passages. Subconfluent (~80% confluence) NP and P hUAECs were starved in phenol red free M199 containing 0.1% fatty acid-free BSA, 0.5% charcoal-stripped FBS, 1% penicillin/streptomycin, and 25 mM HEPES, overnight. Cells were treated with E2β, ER agonists, or E2β with or without ER antagonists as previously described (Lechuga et al., 2019b). Ethanol was the vehicle for dissolving E2β and ER agonists and antagonists. Final ethanol concentrations used were less than 0.5% and did not alter cellular responses surveyed in this study.

RNA extraction, reverse transcription (RT), polymerase chain reaction (PCR), and quantitative real-time PCR (qPCR)

RNA extraction, RT, PCR, and qPCR were performed as previously described (Lechuga et al., 2019b); gene-specific primers used for PCR and qPCR were listed in Table 3, Fig. 5B&6C. The relative mRNA levels by qPCR were calculated by using ΔΔCT method with L19 as the internal reference.

Table 3:

Primers used for RT-qPCR of CBS and CSE mRNAs

Gene Forward Reverse Product size

CBS TGAGATTGTGAGGACGCCCAC TCACACTGCTGCAGGATCTC 177 bp
CSE TTGTATGGATGATGTGTATGGAAGG CCAAACAAGCTTGGTTTCTGGTG 141 bp
L19 AGACCCCAATGAGACCAATG GTGTTTTTCCGGCATCGAGC 129 bp

Fig. 5. E2β on ERα and ERβ recruitments to estrogen-responsive elements (EREs) in human CBS promoter.

Fig. 5.

A: Pregnant human uterine artery cells (4×106 cells/treatment) were treated with or without 10 nM E2β for 24 h. Cells were harvested and DNA was crosslinked to protein by 1% formaldehyde and sheared by digestion. Chromatin was immunoprecipitated with specific ERα and ERβ antibodies and IgG was used for negative control. The ChIP samples were used for amplifying the five amplicons containing specific human CBS promoter EREs as illustrated in Fig. 4A using specific primers listed in B. Gel images shown represent one experiment of each amplicon from three studies with similar results using cells from different subjects. Input was amplified from 1% of the ChIP sample. C: Signal intensity of each amplicon was calculated as a ratio to that of input and expressed as fold of control. Data (means ± SEM) were from cells of three different subjects. *, p<0.05, **, p<0.01.

Fig. 6. E2β on ERα and ERβ recruitments to estrogen-responsive elements (EREs) in human CSE promoter.

Fig. 6.

A: Bioinformatics analysis of human CSE promoter revealed two EREs (αERE1 and αERE2) that preferentially bind ERα and a half ERE (½α/βERE) that preferentially bind ERβ. The promoter regions containing αERE1/αERE2 and ½α/βERE were annotated in amplicon 1 and 2, which were designed for chromatin immunoprecipitation (ChIP)-qPCR assay. B: Pregnant human uterine artery endothelial cells (hUAEC, 4 × 106 cells/group) were treated with or without 10 nM E2β for 24 h. Cells were harvested and DNA was crosslinked to protein by 1% formaldehyde and sheared by digestion. Chromatin was immunoprecipitated with specific ERα and ERβ antibodies and IgG was used for negative control. The ChIP samples were used for amplifying the two amplicons containing specific human CSE promoter EREs indicated in A, using specific primers listed in C. Gel images in B showing one experiment represent similar results using cells from 2 different subjects. Input was amplified from 1% of the ChIP sample. There was no difference in all groups (p >0.05).

Cell transfection and luciferase assay

To determine the effects of estrogens on CBS or CSE transcription, a 914 bp 5′ promoter of human CBS gene and a 942 bp 5’ promoter of human CSE gene were subcloned into the luciferase-expression reporter pGL3.Basic (Promega) to generate the pCBS(−753).Luc and pCSE(−942).Luc constructs and then transfected in hUAEC for reporter gene expression studies. The pGL3 firefly luciferase plasmid DNA and pRL-TK control renilla luciferase constructs were co-transfected by using GenJet in vitro DNA transfection kit (1:4, μl/ng) overnight at 37°C. Cells transfected with a blank vector and SV-40 promoter vector were served as negative and positive transfection controls, respectively. To further delineate the promoter region(s) responsible for estrogen induction, 5′ deletion analysis of the wild-type CBS promoter in pCBS(−753).Luc was conducted using a Mung Bean Nuclease 5′ Deletion Kit for Kilo-Sequencing (TaKara Bio Inc., Kusatsu, Japan) as previously described (Bai et al., 2019).

The DNA fragments of the full-length CBS promoter containing mutated α/βERE2 (−699 -CGCGGCCTCCGGtattTG- −682) and mutated ½α/βERE1 (−338-GAAatGCAAGAAGTTAAC- −321) sites in pCBS(−753).Luc construct were synthesized from Azenta (Chelmsford, MA) and subcloned into luciferase-expression reporter pGL3.Basic (Promega). The α/βERE2/½α/βERE1 double mutated construct (mα/βERE2/½α/βERE1) was with the same mutations in both α/βERE2 and ½α/βERE1 sites. After transfection, cells were recovered for 18–20 h in ECM containing 5% FBS. Cells were serum starved overnight and treated with vehicle or E2β (10 nM) for 24 h. Cells were harvested for measuring firefly luciferase and renilla luciferase activities using a Dual-GloR Luciferase Assay Kit (Promega, Madison, WI), as described (Bai and Chen, 2021). Renilla luciferase activity was normalized to firefly luciferase activity and then calculated as % of control to determine promoter activity.

Chromatin immunoprecipitation (ChIP)-qPCR

To characterize the effects of estrogens on ERα or ERβ interactions with specific EREs in human CBS and CSE promoters in hUAEC, ChIP-qPCR studies were performed using a SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, Before, MA) with specific ERα or ERβ antibodies, respectively. Briefly, pregnant hUAEC (~4 × 106 cells/group) were treated with 10 nM E2β for 24 h, fixed in 1% formaldehyde for 8 min, followed by quenching with 1M glycine for 5min at RMT. Cells were harvested with a cell scraper, pelleted by centrifugation, and then dissolved in 50 μl ChIP buffer with protease inhibitor complex. The samples were digested with a 0.1 μl of Micrococcal Nuclease at 37 °C for 20 min to shear chromatin with fragment size of 0.1–0.8 kb. After a 10 μl aliquot of the cell lysate was saved as the input control (1:100 dilution), the rest of the sample was subjected to immunoprecipitation using ChIP certified antibodies of ERα (1:200, Active Motif, Carlsbad, CA) or ERβ (1:200, Thermo), following instructions of the assay kit with minor modifications (Bai and Chen, 2021). Rabbit IgG was used as the negative control for ChIP. After decrosslinking by heating at 65°C for 2 h, qPCR was performed to amplify the amplicons containing specific EREs in the human CBS or CSE promoters as predicted in Fig. 5&6, respectively, using primers listed in Fig. 5B &6C, respectively. All amplicons were gel analyzed and ethidium bromide staining for image acquisition. Signal intensity was normalized by that amplified using the input sample and then calculated as fold of untreated control.

Immunoblotting

Total cell lysate (20 μg proteins/lane) was subjected to SDS-PAGE and immunoblotting with CBS (1:1000; Abcam) or CSE (1:500; Santa Cruz), respectively as previously described (Lechuga et al., 2019b). Parallel blotting for β-actin was conducted to serve as the loading control using a monoclonal antibody from Ambion (1:10000; Austin, TX). Band intensity was quantified by using NIH ImageJ, normalized to β-actin, and presented as fold of corresponding controls.

Methylene blue assay

H2S production was determined by the methylene blue assay as described (Lechuga et al., 2019b). To determine the specific contribution of CBS and CSE in H2S production, CHH or BCA at a final concentration of 2 mM was added to the reaction mixtures prior to initiate the assay. Briefly, primary hUAEC were seeded at the density of 0.5 × 106/ml in duplicate and treated with or without E2β (10 nM) for 24 h. Cells were harvested and homogenized in 50 mM ice-cold potassium phosphate buffer with pH 8.0. Concentrations of H2S was calculated by a calibration curve generated with NaHS solutions.

Statistical analysis

Each experiment was repeated at least three times with cells derived from different NP and P subjects. Data are presented as means ± SEM and analyzed by one-way analysis of variance (ANOVA), followed by the Newman Keuls test for multiple comparisons using GraphPad Prism (GraphPad Software). Non-paired student t-test was used for comparison of data between two groups. Significance was defined as P < 0.05 unless higher statistical power is indicated in the figure legends.

RESULTS

E2β on CBS and CSE protein expression in isolated human UA ex vivo

Human UA EC and SMC CBS, but not CSE, protein increases in pregnancy in association with elevated circulating estrogens (Sheibani et al., 2017). By using semi-quantitative immunofluorescence microscopic analysis (Lechuga et al., 2019c, Lechuga et al., 2015, Sheibani et al., 2017), we determined whether estrogens regulate cellular (EC vs. SMC) CBS and CSE protein expression in cultures of isolated P human UA rings ex vivo. In untreated UA rings, CBS and CSE proteins were immunolocalized in both EC and SMC, and baseline CBS and CSE proteins in EC were ~ 7 times higher than that in SMC. Treatment with 10 nM E2β, a physiological relevant concentration in human pregnancy (Abbassi-Ghanavati et al., 2009), for 24 h increased CBS protein expression (fold, EC: 2.21 ± 0.11, p<0.05; SMC: 10.53 ± 2.41, p<0.05), without altering CSE protein. Treatment with ICI completely blocked E2β-stimulated CBS protein expression in both EC and SMC in P UA cultures (Fig. 1). In addition, baseline CBS mRNA in P UA rings was 3.37 ± 0.54 fold (p<0.05) greater to that in NP UA rings; baseline CBS protein (measured by immunoblotting) in P UA rings was 2.34-fold higher than that in NP UA rings. E2β stimulated CBS mRNA by 3.04 ± 0.36 fold in NP and 2.85 ± 0.17 fold (p<0.01) in P UA rings ex vivo. E2β also stimulated CBS protein in NP and P UA rings ex vivo; ICI blocked E2β-stimulated CBS mRNA and protein expressions in NP and P human UA rings ex vivo. UA total CSE mRNA and protein did not differ in pregnancy and were unaltered by estrogens (Fig. S1).

Fig. 1: E2β on pregnant human uterine artery CBS/CSE expression ex vivo.

Fig. 1:

(A) Freshly prepared pregnant (P) human UA rings were treated with vehicle, 10 nM estradiol-17β (E2β), 1 μM ICI 182 780 (ICI), or both for 24 h. The rings were paraffin-embedded and then subjected to immunofluorescence labeling of cystathionine β-synthase (CBS) and cystathionine γ -lyase (CSE) proteins by specific CBS or CSE antibodies, with CD31 antibody for co-labeling endothelial cells (EC) distinct from smooth muscle cells (SMC). After incubation with corresponding fluorescently labeled secondary antibodies, sections were mounted with DAPI to label nuclei and examined under confocal microscopy. Negative control treated with IgG is shown with scale bar at 100 μm. lu: lumen. (B) Graphs summarizing levels of EC and SMC CBS and CSE proteins. Images were taken to determine CBS and CSE proteins (relative green fluorescence intensity; RFI) using Image J and summarized as fold changes relative to untreated smooth muscles in the graphs. Data (means ± SEM) were collected from sections of different cultured P hUA rings from three different subjects. *, p<0.05, **, p<0.01 vs control. Bars with different superscripts differ significantly (p< 0.05).

E2β on H2S biosynthesis in primary NP and P human UAECs in vitro

E2β stimulated EC and SMC CBS mRNA and protein in both NP and P UA ex vivo (Fig. 1 and Fig. S1). We focused our well-defined primary NP and P hUAEC models (Zhang et al., 2017) to explore the mechanisms underlying estrogen regulation of UA H2S biosynthesis in pregnancy in vitro. Baseline H2S production in P hUAEC was 2.07 ± 0.09 fold (p<0.05) greater that of NP hUAEC. Treatment with 10 nM E2β for 48 h stimulated H2S production in hUAEC (fold; NP, 3.22 ± 0.07 fold, p<0.05; P, 2.51 ± 0.09 fold, p<0.05). ICI blocked E2β-stimulated H2S production in NP and P hUAEC (Fig. 2A, left). Treatment with an CBS inhibitor O-(carboxymethyl) hydroxylamine hemihydrochloride (CHH, 1 mM) inhibited baseline H2S production by ~50% in both NP and P hUAEC; treatment with an CSE inhibitor β-cyano-L-alanine (BCA, 1 mM) did not alter baseline H2S production and had no additive effect to CHH (Fig. 2A, right). Baseline CBS mRNA levels in P hUAEC were 3.36 ± 0.54 fold (P<0.05) to that of NP hUAEC. Treatment with 10 nM E2β for 48 h stimulated CBS mRNA by 3.04 ± 0.36 fold (p<0.05) in NP hUAEC and 2.84 ± 0.20-fold (P<0.05) in P hUAEC (Fig. 2B). Consistently, baseline CBS protein levels in P hUAEC were 4.29 ±1.25 fold to that of NP hUAEC (p < 0.05). E2β increased CBS protein by 1.66 ± 0.21 fold (p<0.05) in NP hUAEC and 2.27 ± 0.66 fold (p<0.05) in P hUAEC; (Fig. 2C). ICI completely blocked E2β-stimulated CBS mRNA and protein in NP and P hUAEC (Fig. 2B&C). Baseline CSE mRNA and protein levels did not differ in NP and P hUAEC and E2β also had no effects on CSE mRNA and protein in NP and P hUAEC (Fig. 2AC).

Fig. 2: E2β on human uterine artery endothelial cell H2S biosynthesis in vitro.

Fig. 2:

Primary uterine artery endothelial cells from nonpregnant (NP) and pregnant (P) women (NP and P hUAEC, respectively) were treated with vehicle or estradiol-17β (E2β, 10 nM) with or without the estrogen receptor (ER) antagonist ICI 182780 (ICI, 1 μM) for 48 h. The cells were used for measuring H2S production (A) by the methylene blue assay, CBS and CSE mRNA (B) by RT-qPCR, and protein (C) by immunoblotting. In the right panel of A, protein extracts from NP and P hUAEC cells were used for H2S production in an inhibitor of CBS (CHH, 2 mM), CSE (BCA, 2 mM), or both. RT-qPCR assay of mRNA was performed with specific primers listed in Table 1, by using L-19 as an internal control for quantitation. Immunoblotting of CBS or CSE proteins was performed with β-actin as the loading control for quantitation. Data were from cells of three different subjects and calculated as means ± SEM. Bars with different superscripts differ significantly (p< 0.05). *, p<0.05, vs. control; $, p<0.05 for P vs. NP.

E2β on CBS and CSE promoter activation in NP and P hUAECs

Baseline CBS promoter activity was 1.92 ± 0.03 fold (p< 0.01) in P vs. NP hUAEC. Treatment with 10 nM E2β for 24 h increased CBS promoter activity by 1.64 ± 0.05 fold (p<0.05 vs. untreated controls) in NP hUAEC, and with more potency by 2.23 ± 0.14 fold (p < 0.01 vs. controls and p <0.01 vs. NP cells) in P hUAEC (Fig. 3A). In P hUAEC, treatment with increasing doses (0.01–100 nM) of E2β for 24 h stimulated CBS promoter activity in a dose-dependent manner; CBS promoter activity significantly increased with 0.1 nM E2β and maximized with 10 nM E2β (2.03 ± 0.03 fold vs. untreated controls, p<0.001) (Fig. 3B). Baseline CSE promoter activity did not differ in NP and P hUAEC; E2β at all concentrations did not alter CSE promoter activity in NP and P hUAEC (Fig. 3A&B).

Fig. 3. E2β on human CBS/CSE promoter activation.

Fig. 3.

Primary human uterine artery endothelial cells (hUAEC) were transfected with luciferase constructs driven by wild-type human CBS promoter (−753/+161) or human CSE promoter (−942/+98) and co-transfected with the thymidine kinase renilla luciferase vector. After treatments, cells were harvested for determining firefly/renilla luciferase activities. Promoter activation was calculated as a ratio of firefly/renilla luciferase activities. A: Cells from nonpregnant (NP) and pregnant (P) women, i.e., NP and P hUAECs, were treated with E2β (10 nM) for 24 h. Data were expressed as mean ± SEM from three independent experiments. *, p<0.05 and ** p<0.01, vs. control; ## and $ $, p<0.01 for P vs. NP; n.s., not different. B: Pregnant hUAEC were treated with increasing concentrations (0–100 nM) of E2β for 24 h. Data (means ± SEM, n=3) were expressed as fold of baseline in resting cells transfected with CBS or CSE promoter constructs. Bars with different superscripts differ significantly (p < 0.05).

ERα and ERβ in E2β activation of CBS Promoter

hUAEC expresses both ERα and ERβ (Mishra et al., 2019). ICI blockade of E2β-stimulated CBS mRNA/protein expression (Fig. 1&2) suggest ERα and ERβ interactions with CBS promoter EREs in CBS transcription. We then searched putative EREs in human CBS (ID: NG_008938.1) promoter by using the Length-Aware Site Alignment Guided by Nucleotide Association (LASAGNA) motif search tool (https://biogridlasagna.engr.uconn.edu/lasagna_search/index.php). We found that that the proximal 914 bp human CBS promoter contains one putative ERE that preferentially binds ERα, three putative EREs that preferentially binds ERβ, and one full and a half putative EREs that bind both ERα and ERβ, and we designated them as αERE, βERE, α/βERE, and ½α/βERE, respectively (Fig. 4A).

Fig. 4. Characterization of estrogen-responsive elements (ERRs) in human CBS promoter.

Fig. 4.

A: Bioinformatics analysis of human CBS promoter revealed putative EREs that preferentially bind ERα ERβ, or both, designated as one αERE, three 3 βEREs, and a full α/βERE and a half ½α/βERE. In the table, EREs were annotated in amplicons designed for chromatin immunoprecipitation (ChIP)-qPCR assay in Fig. 5. Pregnant hUAEC were transfected with luciferase reporter constructs driven by the wild-type (wt) human CBS promoter [−753/+161, pCBS(−753).Luc] or a series of its 5’ deletions (B) or by pCBS(−753).Luc construct (wt) or its mutations in α/βERE2, ½α/βERE1, or both. Cells were co-transfected with a thymidine kinase-renilla luciferase vector as internal control. After treatment with 10 nM E2β for 24 h, cells were harvested for determining firefly/renilla luciferase activities. CBS promoter activation was calculated as a ratio of firefly/renilla luciferase activities. Data (means ± SEM, n=3) were expressed as fold of baseline in resting cells transfected with wt CBS promoter construct. Bars with different letters differ significantly (p < 0.05). *, p<0.05, **, p<0.01.

To determine the estrogen-responsive region(s) in proximal human CBS promoter, we performed luciferase reporter gene expression assays using a series of 5’-deletion constructs of pCBS(−753).Luc reporter gene construct, with decreasing lengths of human CBS promoter from the position −753 to +18. When transfected in P hUAEC, baseline full-length CBS promoter activity began to significantly decrease from position −753 to −617 bp that contains βERE3 and α/βERE2 sites. A deletion from position −617 to −486 bp further decreased basal CBS promoter activity, although no ERE was present. A further deletion from position −349 to −259 bp in which the ½α/βERE1 site is present abolished E2β-stimulated CBS promoter activity (Fig. 4B). Thus, the region (−753 to −617 bp) that contains α/βERE2 (−699 to −682 bp) and the region (−349 to −259 bp) that contains ½α/βERE1 (−338 to −321 bp) are crucial for baseline and E2β-stimulated CBS promoter activity.

We further compared baseline and E2β-stimulated full-length CBS promoter activity with its mutants in which these two sites were mutated to verify the importance of the α/βERE2 and ½α/βERE1 sites in human CBS transcription. Mutations in either α/βERE2 or ½α/βERE1 resulted in ~40% (p < 0.01) reduction in baseline human CBS promoter activity; double mutations in both sites were not additive in decreasing baseline CBS promoter activity. E2β stimulated 1.82 ± 0.11 and 1.68 ± 0.29 increases (p < 0.01 vs. baseline) in human full-length CBS promoter in which either α/βERE2 or ½α/βERE1 was mutated; these responses did not differ from that of E2β-stimulated wild-type human CBS promoter activity (1.80 ± 0.07 fold, p < 0.01 vs baseline). However, the response of E2β-stimulated activity of CBS promoter with mutations in both these two sites was significantly reduced to 1.44 ± 0.10 fold (p<0.01) to that of baseline, which was also significantly lower than that of E2β-stimulated wild-type CBS promoter activity (Fig. 4C).

ERα and ERβ Interactions with proximal human CBS and CSE Promoters

We further analyzed ERα and ERβ Interactions with CBS and CSE Promoters by ChIP-PCR. We found that in untreated P hUAEC, ERα was readily recruited to αERE1 (amplicon 2) and that ERβ was readily recruited to βERE1 (amplicon 1), βERE2, and ½α/βERE1 (amplicon 3), and βERE3 (amplicon 5) in the proximal human CBS promoter; treatment with 10 nM E2β for 24 h did not alter the binding intensities in the sites that preferentially bind ERα or ERβ, respectively, as predicted by bioinformatics analysis (Fig. 4A). In untreated P hUAEC, baseline ERα bindings to α/βERE2 (amplicon 4) and βERE2 and ½α/βERE1 (amplicon 3) were barely detectable; treatment with 10 nM E2β for 24 h increased ERα binding to α/βERE2 site (amplicon 4) by 2.20 ± 0.21 fold (p<0.01) and to βERE2 and ½α/βERE1 sites (amplicon 3) by 1.97 ± 0.06 fold (p<0.01), suggesting that E2β recruits ERα dimerization with ERβ at the βERE or α/βERE sites. As expected, treatment with E2β increased ERβ binding to βERE2 and ½α/βERE1 (amplicon 3) by 2.20 ± 0.32 fold (p < 0.05). ERβ was readily bound to αERE1 (amplicon 2) and α/βERE2 (amplicon 4) in untreated cells; however, E2β treatment increased ERβ binding to αERE1 (amplicon 2) and α/βERE2 (amplicon 4) by 1.89 ± 0.34 and 1.88 ± 0.16 fold (p<0.05), respectively, suggesting ERβ dimerization with ERα at αERE in human CBS promoter by E2β.

Bioinformatics analysis using LASAGNA also revealed that the proximal 590 bp human CSE (ID: NG_008041.1) promoter contains two putative EREs (αERE1 and αERE2) that preferentially binds ERα and one putative half EREs (½βERE) that preferentially bind ERβ. In unstimulated P hUAEC, ERβ was readily recruited to ½βERE, and ERα and ERβ were readily recruited to αERE1 and αERE2; E2β treatment did not alter the bindings of ERα and ERβ to these EREs (Fig. 6).

ERα and ERβ in E2β-stimulated hUAEC H2S biosynthesis

We used specific agonists and antagonists of ERα and ERβ to determine the specific roles of ERα and ERβ in E2β stimulation of H2S biosynthesis in P hUAEC. Treatment with 10 nM E2β for 24 h stimulated CBS promoter activity by 2.28 ± 0.26 fold and mRNA expression by 2.41 ± 0.31 fold (p<0.05). These stimulations were mimicked by either ERα agonist PPT or ERβ agonist DPN alone; their combination had no additive effects. In addition, E2β-stimulated CBS promoter activation and mRNA expression were blocked by either ERα antagonist MPP, ERβ antagonist PHTPP, or their combination (Fig. 7A&B). PPT, DPN, or their combination significantly increased CBS protein and H2S production to levels comparable to that of E2β (CBS protein: 2.12 ± 0.23-fold vs control, H2S production: 1.96 ± 0.18-fold vs control). MPP but not PHTPP alone significantly inhibited E2β-stimulated CBS protein expression; MPP in combination PHTPP completely blocked E2β-stimulated CBS protein expression. Either MPP or PHTPP and their combination completely blocked E2β-stimulated H2S production (Fig. 7C&D).

Fig. 7: Specific roles of ERα and ERβ in E2β-stimulated H2S biosynthesis.

Fig. 7:

ERα or ERβ activation: Pregnant human uterine artery endothelial cells were treated with vehicle, 10 nM of E2β, PPT (ERα agonist), DPN (ERβ agonist), or PPT + DPN for 24 h (A) or 48 h (B, C). ERα or ERβ inhibition: P hUAEC were treated with vehicle or estradiol-17β (E2β) (10 nM) with or without 1 μM MPP (ERα antagonist), PHTPP (ERβ antagonist), or MPP + PHTPP. CBS promoter activity (A), mRNA (B) and protein (C) were determined. Data (means ± SEM) were from cells of three different subjects. Bars with different letters differ significantly (p <0.05).

DISCUSSION

Our present study delineated the transcriptional mechanism underlying estrogen-stimulated uterine artery H2S biosynthesis in pregnancy. Here we show that E2β stimulates specific ER-dependent EC and SMC CBS (but not CSE) mRNA/protein expression in human UA ex vivo. E2β also stimulates ER-dependent CBS (but not CSE) mRNA/protein and H2S production in both NP and P hUAECs in vitro; however, the estrogen responses are significantly greater in P state, demonstrating pregnancy dependence of estrogen-stimulated hUAEC H2S biosynthesis. ERα and ERβ readily occupy their respective α and β EREs in proximal human CBS promoter in the NP state, while E2β stimulates ERα heterodimerization with ERβ and vice versa, to occupy these EREs in pregnant state. Activation of either ERα or ERβ mimics E2β-induced H2S biosynthesis, including CBS promoter activation, CBS mRNA/protein expression, and H2S production. Moreover, E2β does not activate human CSE promoter containing EREs which are readily occupied by ERα and ERβ and nor alter ER interactions with human CSE promoter EREs. Thus, estrogens stimulate pregnancy dependent hUA H2S biosynthesis via selective activation of CBS gene transcription via heterodimerization of ERα and ERβ to interact with the proximal CBS promoter EREs.

The human CBS gene contains five transcription starting sites, i.e., 1a, 1b, 1c, 1d, and 1e, respectively, to encode multiple transcripts with different 5′-untranslated regions, among which the ones containing exon 1a and 1b are the most abundant (Gaustadnes et al., 1998). Previously, we have shown that E2β activates human CBS-1b promoter in ovine UAEC and UASMC (Lechuga et al., 2019b, Lechuga et al., 2019a), suggesting that human CBS-1b promoter contains EREs. Here, we first confirmed the specific ER-dependent stimulatory effect of E2β on human CBS-1b promoter in hUAEC by using luciferase reporter gene expression studies using luciferase reporter construct driven by the human CBS-1b promoter. We then used luciferase reporter construct driven by human CBS-1b promoter with a series of 5′ deletions identified the promoter sequence (−753 to −259 bp) to be the major region responsible for trans-activating CBS promoter by E2β in hUAEC.

The proximal human CBS promoter contains multiple putative EREs, including one αERE and three βEREs that preferentially bind ERα and ERβ, respectively. There are also one full α/βERE and one half ERE (½α/βERE) that bind both ERα and ERβ. They are presented in the region (−753 to −259 bp) pivotal for mediating E2β-induced trans-activation of CBS promoter in hUAEC. Mutation of either α/βERE2 or ½α/βERE1 site resulted in lower baseline CBS promoter activity, further supporting the importance of these sites in basal CBS expression. However, a single mutation in either α/βERE2 or ½α/βERE1 site did not affect CBS promoter trans-activation by E2β. Double mutation in both sites not only reduces basal CBS promoter activity, but also results in decreased response to E2β stimulation. Hence, the α/βERE2 and ½α/βERE1 sites are needed to maintain optimal baseline CBS expression and more importantly both sites are required for CBS promoter trans-activation by E2β in hUAEC.

In resting P hUAEC, ERα binding to αERE1 and βERE1&3 sites and ERβ binding to βERE1 and βERE3 sites are high; these ER/ERE interactions are not altered by E2β, suggesting that these baseline ER/ERE interactions may contribute to baseline EC CBS expression in pregnancy (Sheibani et al., 2017). ERα and ERβ binding to α/βERE2 or ½α/βERE1 sites are very low and ERβ barely binds to αERE1 in NP state. However, treatment with E2β significantly stimulates the recruitment of ERα to α/βERE2 ½α/βERE1 and βERE2 sites, and ERβ to βERE2-α/βERE2, ½α/βERE1, and αERE1 sites. These data show that estrogens differentially regulate ERα and ERβ interactions with specific EREs and that ERα and ERβ heterodimerize onto the α/βERE2 and ½α/βERE1 sites in the major estrogen-responsive region (−753 to −259 bp) in the human CBS promoter in hUAEC.

Human UAEC express ERα and ERβ; pregnancy augments ERβ expression to mediate estrogen-stimulated hUAEC angiotensin type-2 receptor expression (Mishra et al., 2019). Our current study shows that both ERα and ERβ are required for trans-activating human CBS promoter by E2β. Consistently, we show that either PPT or DPN alone can activate CBS promoter and CBS mRNA/protein expression and H2S production to levels comparable to that of E2β-stimulated. Co-treatment with either MPP or PHTPP alone can effectively attenuate E2β-stimulated CBS promoter activity, CBS mRNA expression, and H2S production, showing either ERα or ERβ suffices to mediate E2β-stimulated H2S biosynthesis in hUAEC.

Of note, deletion of −753 to −617 bp in human CBS promoter results in decreases baseline activity, suggesting other TFs to be involved since this region does not contain ERE. Human CBS promoter contains Sp1 and YY1 sites to mediate enhanced H2S production via CBS transcription upon stimulation with vascular endothelial growth factor (Bai and Chen, 2021). ERα and ERβ can interact with Sp1 (Safe, 2001). Further studies are needed to explore whether other ER-interacting TFs are involved in trans-activating CBS promoter to participate in estrogen-stimulated H2S biosynthesis in pregnancy.

Unlike our previous ovine UAEC studies in which E2β stimulates both CBS and CSE expression in vitro (Lechuga et al., 2019b), our current study shows that E2β selectively stimulates CBS expression without altering CSE in NP and P hUAECs with greater responses in P state. Thus, our human UAEC models provide physiologically relevant data closely mimicking our in vivo findings (Sheibani et al., 2017, Lechuga et al., 2015, Lechuga et al., 2019c), together consistently supporting a conclusion that estrogens stimulate pregnancy-dependent hUAEC H2S biosynthesis by selectively upregulating CBS expression via direct ERα and ERβ interactions with EREs in the proximal CBS promoter.

Conclusion

Our current study demonstrates that estrogens stimulate pregnancy-dependent H2S production by specific nuclear ER-dependent upregulation of CBS transcription via direct ERα and ERβ interactions with the proximal CBS promoter EREs in hUAEC, thereby informing a novel mechanism for mediating estrogen-induced uterine vasodilation in pregnancy (Fig. 8). Pregnancy is a physiological state of elevated endogenous estrogens whose major role is to stimulate maternal-fetal interface vasodilation and angiogenesis and collectively these mechanisms raise UtBF to execute the bidirectional exchanges obligatory for fetal growth (Berkane et al., 2017, Thornburg et al., 2000, Magness, 1998). Constrained UtBF and dysregulated estrogen biosynthesis and metabolism in pregnancy contribute to the pathogenesis of preeclampsia (Kanasaki et al., 2008, Berkane et al., 2017, Jobe et al., 2013); yet, how estrogens regulate UtBF remains incompletely understood. UA CBS/H2S production is upregulated by estrogen replacement therapy (Lechuga et al., 2015) and pregnancy (Sheibani et al., 2017). Enhanced local CBS/H2S stimulates maternal-fetal interface vasodilation and angiogenesis (Li et al., 2020, Qi et al., 2020, Sheibani et al., 2017, Chen et al., 2017), thus emerging as a novel pathway for regulating estrogen-induced uterine hemodynamics in pregnancy. Administration of H2S donors rescue animal models of preeclampsia (Wang et al., 2013, Holwerda et al., 2014). Thus, data from this study implicate that targeting CBS/H2S pathway may provide a novel strategy for developing therapeutic interventions for hypertension-related pregnancy disorders such as preeclampsia with intrauterine growth restriction.

Fig. 8: Mechanism underlying estrogen-induced uterine artery endothelial cell hydrogen sulfide (H2S) biosynthesis in pregnancy.

Fig. 8:

Elevated endogenous estrogens stimulate pregnancy-dependent recruitment of estrogen receptors ERα and ERβ to their corresponding estrogen response elements (EREs) in the proximal promoter of human cystathionine β-synthase (CBS) gene to upregulate CBS expression and H2S production in human uterine artery.

Supplementary Material

01

Acknowledgments:

The authors thank all the volunteers for donating the tissue samples.

Sources of funding:

The present study was supported in part by American Heart Association (AHA) postdoctoral fellowships AHAPOST903757 (JB) and AHAPOST34380384 (TJL) and the National Institutes of Health (NIH) grants RO1HL70562, R01HD105699, and R21HD097498 (to D-b C). The content is solely the responsibility of the authors and does not necessarily represent the official view of AHA and NIH.

Footnotes

Disclosure: The authors declare no conflict of interest.

REFERENCES

  1. Abbassi-Ghanavati M, Greer LG & Cunningham FG 2009. Pregnancy and laboratory studies: a reference table for clinicians. Obstet Gynecol 114 1326–1331. DOI: 10.1097/AOG.0b013e3181c2bde8. [DOI] [PubMed] [Google Scholar]
  2. Bai J & Chen DB 2021. Enhanced Sp1/YY1 expression directs CBS transcription to mediate VEGF-stimulated pregnancy-dependent H2S production in human uterine artery endothelial cells. Hypertension 78 1902–1913. DOI: 10.1161/HYPERTENSIONAHA.121.18190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bai J, Jiang X, He M, Chan BCB & Wong AOL 2019. Novel mechanisms for IGF-I regulation by glucagon in carp hepatocytes: up-regulation of HNF1alpha and CREB expression via signaling crosstalk for IGF-I gene transcription. Front Endocrinol (Lausanne) 10 605. DOI: 10.3389/fendo.2019.00605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Berkane N, Liere P, Oudinet JP, Hertig A, Lefevre G, Pluchino N, Schumacher M & Chabbert-Buffet N 2017. From pregnancy to preeclampsia: a key role for estrogens. Endocr Rev 38 123–144. DOI: 10.1210/er.2016-1065. [DOI] [PubMed] [Google Scholar]
  5. Chen DB, Bird IM, Zheng J & Magness RR 2004. Membrane estrogen receptor-dependent extracellular signal-regulated kinase pathway mediates acute activation of endothelial nitric oxide synthase by estrogen in uterine artery endothelial cells. Endocrinology 145 113–25. DOI: 10.1210/en.2003-0547. [DOI] [PubMed] [Google Scholar]
  6. Chen DB, Feng L, Hodges JK, Lechuga TJ & Zhang H 2017. Human trophoblast-derived hydrogen sulfide stimulates placental artery endothelial cell angiogenesis. Biol Reprod 97 478–489. DOI: 10.1093/biolre/iox105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Driscoll MD, Sathya G, Muyan M, Klinge CM, Hilf R & Bambara RA 1998. Sequence requirements for estrogen receptor binding to estrogen response elements. J Biol Chem 273 29321–30. DOI: 10.1074/jbc.273.45.29321. [DOI] [PubMed] [Google Scholar]
  8. Gaustadnes M, Kluijtmans LA, Jensen OK, Rasmussen K, Heil SG, Kraus JP, Blom HJ, Ingerslev J & Rudiger N 1998. Detection of a novel deletion in the cystathionine beta-synthase (CBS) gene using an improved genomic DNA based method. FEBS Lett 431 175–9. DOI: 10.1016/s0014-5793(98)00743-1. [DOI] [PubMed] [Google Scholar]
  9. Holwerda KM, Burke SD, Faas MM, Zsengeller Z, Stillman IE, Kang PM, van Goor H, McCurley A, Jaffe IZ, Karumanchi SA & Lely AT 2014. Hydrogen sulfide attenuates sFlt1-induced hypertension and renal damage by upregulating vascular endothelial growth factor. J Am Soc Nephrol 25 717–25. DOI: 10.1681/ASN.2013030291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Jobe SO, Tyler CT & Magness RR 2013. Aberrant synthesis, metabolism, and plasma accumulation of circulating estrogens and estrogen metabolites in preeclampsia implications for vascular dysfunction. Hypertension 61 480–7. DOI: 10.1161/HYPERTENSIONAHA.111.201624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kanasaki K, Palmsten K, Sugimoto H, Ahmad S, Hamano Y, Xie L, Parry S, Augustin HG, Gattone VH, Folkman J, Strauss JF & Kalluri R 2008. Deficiency in catechol-O-methyltransferase and 2-methoxyoestradiol is associated with pre-eclampsia. Nature 453 1117–21. DOI: 10.1038/nature06951. [DOI] [PubMed] [Google Scholar]
  12. Lechuga TJ, Bilg AK, Patel BA, Nguyen NA, Qi QR & Chen DB 2019a. Estradiol-17beta stimulates H2S biosynthesis by ER-dependent CBS and CSE transcription in uterine artery smooth muscle cells in vitro. J Cell Physiol 234 9264–9273. DOI: 10.1002/jcp.27606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lechuga TJ, Qi QR, Kim T, Magness RR & Chen DB 2019b. E2beta stimulates ovine uterine artery endothelial cell H2S production in vitro by estrogen receptor-dependent upregulation of cystathionine beta-synthase and cystathionine gamma-lyase expression. Biol Reprod 100 514–522. DOI: 10.1093/biolre/ioy207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lechuga TJ, Qi QR, Magness RR & Chen DB 2019c. Ovine uterine artery hydrogen sulfide biosynthesis in vivo: effects of ovarian cycle and pregnancy. Biol Reprod 100 1630–1636. DOI: 10.1093/biolre/ioz027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lechuga TJ, Zhang HH, Sheibani L, Karim M, Jia J, Magness RR, Rosenfeld CR & Chen DB 2015. Estrogen replacement therapy in ovariectomized nonpregnant ewes stimulates uterine artery hydrogen sulfide biosynthesis by selectively up-regulating cystathionine beta-synthase expression. Endocrinology 156 2288–98. DOI: 10.1210/en.2015-1086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li Y, Bai J, Yang YH, Hoshi N & Chen DB 2020. Hydrogen sulfide relaxes human uterine artery via activating smooth muscle BKCa channels. Antioxidants (Basel) 9. DOI: 10.3390/antiox9111127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Magness RR 1998. Maternal cardiovascular and other physiologic responses to the endocrinology of pregnancy., In: Bazer FW (eds) Endocrinology of Pregnancy. Contemporary Endocrinology, Vol 9, Humana Press, Totowa, NJ.(Chapter 2) pp 507–539. DOI: 10.1007/978-1-4612-1804-3_18. [DOI] [Google Scholar]
  18. Magness RR, Parker CR Jr & Rosenfeld CR 1993. Systemic and uterine responses to chronic infusion of estradiol-17 beta., Am J Physiol 265 E690–8. DOI: 10.1152/ajpendo.1993.265.5.E690. [DOI] [PubMed] [Google Scholar]
  19. Magness RR, Phernetton TM, Gibson TC & Chen DB 2005. Uterine blood flow responses to ICI 182 780 in ovariectomized oestradiol-17beta-treated, intact follicular and pregnant sheep. J Physiol 565 71–83. DOI: 10.1113/jphysiol.2005.086439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Magness RR, Phernetton TM & Zheng J 1998. Systemic and uterine blood flow distribution during prolonged infusion of 17beta-estradiol. Am J Physiol 275 H731–43. DOI: 10.1152/ajpheart.1998.275.3.H731. [DOI] [PubMed] [Google Scholar]
  21. Magness RR & Rosenfeld CR 1989. Local and systemic estradiol-17 beta: effects on uterine and systemic vasodilation. Am J Physiol 256 E536–42. DOI: 10.1152/ajpendo.1989.256.4.E536. [DOI] [PubMed] [Google Scholar]
  22. Magness RR, Sullivan JA, Li Y, Phernetton TM & Bird IM 2001. Endothelial vasodilator production by uterine and systemic arteries. VI. Ovarian and pregnancy effects on eNOS and NOx. Am J Physiol Heart Circ Physiol 280 H1692–8. DOI: 10.1152/ajpheart.2001.280.4.H1692. [DOI] [PubMed] [Google Scholar]
  23. Mishra JS, Te Riele GM, Qi QR, Lechuga TJ, Gopalakrishnan K, Chen DB & Kumar S (2019) Estrogen receptor-beta mediates estradiol-induced pregnancy-specific uterine artery endothelial cell angiotensin type-2 receptor expression. Hypertension 74 967–974. DOI: 10.1161/HYPERTENSIONAHA.119.13429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Palmer SK, Zamudio S, Coffin C, Parker S, Stamm E & Moore LG 1992. Quantitative estimation of human uterine artery blood flow and pelvic blood flow redistribution in pregnancy. Obstet Gynecol 80 1000–6. Available at: https://www.ncbi.nlm.nih.gov/pubmed/1448242. [PubMed] [Google Scholar]
  25. Papapetropoulos A, Pyriochou A, Altaany Z, Yang G, Marazioti A, Zhou Z, Jeschke MG, Branski LK, Herndon DN, Wang R & Szabo C 2009. Hydrogen sulfide is an endogenous stimulator of angiogenesis. Proc Natl Acad Sci U S A 106 21972–7. DOI: 10.1073/pnas.0908047106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Qi QR, Lechuga TJ, Patel B, Nguyen NA, Yang YH, Li Y, Sarnthiyakul S, Zhang QW, Bai J, Makhoul J & Chen DB 2020. Enhanced stromal cell CBS-H2S production promotes estrogen-stimulated human endometrial angiogenesis. Endocrinology 161. DOI: 10.1210/endocr/bqaa176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Reynolds LP, Kirsch JD, Kraft KC, Knutson DL, McClaflin WJ & Redmer DA 1998. Time-course of the uterine response to estradiol-17beta in ovariectomized ewes: uterine growth and microvascular development. Biol Reprod 59 606–12. DOI: 10.1095/biolreprod59.3.606. [DOI] [PubMed] [Google Scholar]
  28. Rosenfeld CR 1977. Distribution of cardiac output in ovine pregnancy. Am J Physiol 232 H231–5. DOI: 10.1152/ajpheart.1977.232.3.H231. [DOI] [PubMed] [Google Scholar]
  29. Rosenfeld CR, Cornfield DN & Roy T 2001. Ca2+-activated K+ channels modulate basal and E2beta-induced rises in uterine blood flow in ovine pregnancy. Am J Physiol Heart Circ Physiol 281 H422–31. DOI: 10.1152/ajpheart.2001.281.1.H422. [DOI] [PubMed] [Google Scholar]
  30. Rosenfeld CR, Cox BE, Roy T & Magness RR 1996. Nitric oxide contributes to estrogen-induced vasodilation of the ovine uterine circulation. J Clin Invest 98 2158–66. DOI: 10.1172/JCI119022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rosenfeld CR & Roy T 2012. Large conductance Ca2+-activated and voltage-activated K+ channels contribute to the rise and maintenance of estrogen-induced uterine vasodilation and maintenance of blood pressure. Endocrinology 153 6012–20. DOI: 10.1210/en.2012-1717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rosenfeld CR & Roy T 2014. Prolonged uterine artery nitric oxide synthase inhibition modestly alters basal uteroplacental vasodilation in the last third of ovine pregnancy. Am J Physiol Heart Circ Physiol 307 H1196–203. DOI: 10.1152/ajpheart.00996.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Roth CJ, Haeussner E, Ruebelmann T, Koch FV, Schmitz C, Frank HG & Wall WA 2017. Dynamic modeling of uteroplacental blood flow in IUGR indicates vortices and elevated pressure in the intervillous space - a pilot study. Sci Rep 7 40771. DOI: 10.1038/srep40771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Safe S 2001. Transcriptional activation of genes by 17 beta-estradiol through estrogen receptor-Sp1 interactions. Vitam Horm 62 231–52. DOI: 10.1016/s0083-6729(01)62006-5. [DOI] [PubMed] [Google Scholar]
  35. Sanghavi M & Rutherford JD 2014. Cardiovascular physiology of pregnancy. Circulation 130 1003–8. DOI: 10.1161/CIRCULATIONAHA.114.009029. [DOI] [PubMed] [Google Scholar]
  36. Sheibani L, Lechuga TJ, Zhang H, Hameed A, Wing DA, Kumar S, Rosenfeld CR & Chen DB 2017. Augmented H2S production via cystathionine-beta-synthase upregulation plays a role in pregnancy-associated uterine vasodilation. Biol Reprod 96 664–672. DOI: 10.1095/biolreprod.116.143834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Thornburg KL, Jacobson SL, Giraud GD & Morton MJ 2000. Hemodynamic changes in pregnancy. Semin Perinatol 24 11–4. DOI: 10.1016/s0146-0005(00)80047-6. [DOI] [PubMed] [Google Scholar]
  38. Van Buren GA, Yang DS & Clark KE 1992. Estrogen-induced uterine vasodilatation is antagonized by L-nitroarginine methyl ester, an inhibitor of nitric oxide synthesis. Am J Obstet Gynecol 167 828–33. DOI: 10.1016/s0002-9378(11)91597-x. [DOI] [PubMed] [Google Scholar]
  39. Wang K, Ahmad S, Cai M, Rennie J, Fujisawa T, Crispi F, Baily J, Miller MR, Cudmore M, Hadoke PW, Wang R, Gratacos E, Buhimschi IA, Buhimschi CS & Ahmed A 2013. Dysregulation of hydrogen sulfide producing enzyme cystathionine gamma-lyase contributes to maternal hypertension and placental abnormalities in preeclampsia. Circulation 127 2514–22. DOI: 10.1161/CIRCULATIONAHA.113.001631. [DOI] [PubMed] [Google Scholar]
  40. Yang G, Wu L, Jiang B, Yang W, Qi J, Cao K, Meng Q, Mustafa AK, Mu W, Zhang S, Snyder SH & Wang R 2008. H2S as a physiologic vasorelaxant: hypertension in mice with deletion of cystathionine gamma-lyase. Science 322 587–90. DOI: 10.1126/science.1162667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yu CK, Khouri O, Onwudiwe N, Spiliopoulos Y, Nicolaides KH & Fetal Medicine Foundation Second-Trimester Screening G 2008. Prediction of pre-eclampsia by uterine artery Doppler imaging: relationship to gestational age at delivery and small-for-gestational age. Ultrasound Obstet Gynecol, 31(3), pp. 310–3. DOI: 10.1002/uog.5252. [DOI] [PubMed] [Google Scholar]
  42. Zhang HH, Chen JC, Sheibani L, Lechuga TJ & Chen DB 2017. Pregnancy augments VEGF-stimulated in vitro angiogenesis and vasodilator (NO and H2S) production in human uterine artery endothelial cells. J Clin Endocrinol Metab 102 2382–2393. DOI: 10.1210/jc.2017-00437. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

RESOURCES