Skip to main content
NCBI home page
Wiley - PMC COVID-19 Collection logoLink to Wiley - PMC COVID-19 Collection
. 2022 Dec 1;95(1):e28281. doi: 10.1002/jmv.28281

Bovine lactoferrin inhibits SARS‐CoV‐2 and SARS‐CoV‐1 by targeting the RdRp complex and alleviates viral infection in the hamster model

Shi‐ting He 1, Hongbo Qin 1, Lin Guan 1, Ke Liu 1, Bixia Hong 1, Xiaoxu Zhang 2, Fuxing Lou 1, Maochen Li 1, Wei Lin 1, Yangzhen Chen 1, Chengzhi He 2, Feitong Liu 3, Shanshan Lu 1, Shengdong Luo 4, Shaozhou Zhu 1, Xiaoping An 1, Lihua Song 1, Huahao Fan 1,✉, Yigang Tong 1,✉
PMCID: PMC9878033  PMID: 36329614

Abstract

Breast milk has been found to inhibit coronavirus infection, while the key components and mechanisms are unknown. We aimed to determine the components that contribute to the antiviral effects of breastmilk and explore their potential mechanism. Lactoferrin (Lf) and milk fat globule membrane inhibit severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2)‐related coronavirus GX_P2V and transcription‐ and replication‐competent SARS‐CoV‐2 virus‐like particles in vitro and block viral entry into cells. We confirmed that bovine Lf (bLf) blocked the binding between human angiotensin‐converting enzyme 2 and SARS‐CoV‐2 spike protein by combining receptor‐binding domain (RBD). Importantly, bLf inhibited RNA‐dependent RNA polymerase (RdRp) activity of both SARS‐CoV‐2 and SARS‐CoV in vitro in the nanomolar range. So far, no biological macromolecules have been reported to inhibit coronavirus RdRp. Our result indicated that bLf plays a major role in inhibiting viral replication. bLf treatment reduced viral load in lungs and tracheae and alleviated pathological damage. Our study provides evidence that bLf prevents SARS‐CoV‐2 infection by combining SARS‐CoV‐2 spike protein RBD and inhibiting coronaviruses' RdRp activity, and may be a promising candidate for the treatment of coronavirus disease 2019.

Keywords: coronavirus, lactoferrin, RNA‐dependent RNA polymerase, SARS‐CoV‐2

1. INTRODUCTION

During the coronavirus disease 2019 (COVID‐19) pandemic, mothers of newborn babies may be concerned about the vertical transmission of severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) via breast milk from mothers to babies whose immune systems are not yet well developed. Although the human breast milk from a woman infected with SARS‐CoV‐2 RNA has been detected, no infectious SARS‐CoV‐2 particles have been isolated yet. 1 , 2 , 3 Furthermore, our previous study revealed that human milk and bovine formula milk potently inhibited SARS‐CoV‐2 pseudovirus and SARS‐CoV‐2‐like pangolin coronavirus GX_P2V, indicating the anti‐SARS‐CoV‐2 property of breast milk components. 4

Breast milk helps the infant build an immune barrier due to the biologically active components it confers. 5 Lactoferrin (Lf) is one of the key bioactive proteins in human milk that exists in the whey portion and accounts for 15%–20% of the total human milk protein. Lf is a well‐known iron‐binding protein found in mammalian fluids, including breast milk, saliva, and serum. 6 Cai et al. 7 revealed that the mean concentrations of human Lf in colostrum, transitional milk, and mature milk are 3.85, 1.58, and 1.13 g/L, respectively. The Lf content varies among species, of which humans and bovines are the most abundant sources. Milk fat globule membrane (MFGM) is a natural component of human and bovine milk. MFGM is a complex component consisting of a monolayer of polar lipids, membrane and secretory proteins, gangliosides, cholesterol, choline, and sialic acid. 8 MFGM has been reported to inhibit rotavirus infectivity in vitro. 9

Research on authentic SARS‐CoV‐2 is restricted to biosafety level 3 (BSL‐3) laboratories, which impedes the progress of COVID‐19 vaccine development and antiviral drug evaluation. 10 , 11 Pangolin coronavirus GX_P2V exhibits high genomic homology with SARS‐CoV‐2, shares an amino acid identity of 92.2% in the spike protein, and employs the same host receptor as SARS‐CoV‐2. 12 It has been successfully demonstrated as a surrogate model for drug research on SARS‐CoV‐2. 4 , 13 , 14 In addition, transcription‐ and replication‐competent SARS‐CoV‐2 virus‐like particles (SARS‐CoV‐2 trVLPs) and SARS‐CoV‐2 pseudovirus are ideal alternative tools for studying antiviral drugs against SARS‐CoV‐2. 15 , 16

Here, we identified two milk components that possess anti‐SARS‐CoV‐2 properties and discovered that bovine Lf (bLf) inhibited SARS‐CoV‐2 variants by blocking the interaction of the viral spike with the functional receptor human angiotensin‐converting enzyme 2 (hACE2) and interfered with SARS‐CoV‐2/SARS‐CoV‐1 RNA‐dependent RNA polymerase (RdRp) activity, a conserved target for drug development. Our study is the first to identify the intracellular coronavirus target for Lf. The in vivo evaluation verified the therapeutic efficacy of Lf, as evidenced by the reduced viral load and improved pathological changes. Finally, bLf can also induce immune mediators that interrupt viral infections.

2. MATERIALS AND METHODS

2.1. Cells and virus cultivation

African green monkey kidney cell lines Vero E6, human embryonic kidney cell line HEK‐293T, HEK‐293T‐ACE2, BHK21‐ACE2, human colon epithelial cancer cell line Caco‐2, and human bronchial adenocarcinoma cell line Calu‐3 were obtained from American Type Culture Collection and were maintained in Dulbecco's modified Eagle's medium (Gibco) with 10% fetal bovine serum and 1% antibiotic–antimycotic supplemented. The coronavirus GX_P2V (accession no. MT072864.1) was isolated from smuggled, dead Manis javanica in 2017. 12 , 17 GX_P2V was maintained and multiplied in Vero E6 cells. All cells and viruses were cultured at 37°C in a 5% CO2 incubator.

2.2. EC50 and CC50 evaluation

The evaluation of 50% effective concentration (EC50) and 50% cytotoxic concentration (CC50) was performed as previously described. 13

2.3. TCID50 determination and plaque assay

The median tissue culture infectious dose (TCID50) and plaque assays were determined as previously described to evaluate infectious virion production. 18

2.4. Viral attachment assay

The components were incubated with GX_P2V (multiplicity of infection [MOI] = 10) for 2 h at 4°C and then incubated in Vero E6 cells for 2 h at 4°C. After GX_P2V was attached to the cells, the unbound GX_P2V was removed, and cells were washed with phosphate‐buffered saline (PBS) three times and then subjected to reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) analysis.

2.5. Pseudovirus‐based inhibition assay

SARS‐CoV‐2 spike protein pseudotyped variants were prepared using a vesicular stomatitis virus pseudotyped virus packaging system, and the packing and quantification procedures were conducted as previously described. 16

2.6. Surface plasmon resonance (SPR) assay

Binding affinities and kinetic parameters between bLf and the SARS‐CoV‐2 spike were analyzed by SPR (open SPR, Nicoya) at 25°C. Streptavidin (0.5 μM) was applied to a biotin sensor chip. The SARS‐CoV‐2 spike (wild type [WT]; 20 μg/ml) was fixed on a streptavidin‐functionalized sensor chip. 19 At a flow rate of 20 μl/min, 50–5 μg/ml bLf was administered into the channel. The data were analyzed using TraceDrawer software.

2.7. Enzyme‐linked immunosorbent assay (ELISA)

To determine the interference of bLf/MFGM with the binding of SARS‐CoV‐2 spike protein and hACE2, hACE2 was precoated on a 96‐well enzyme immunoassay and radioimmunoassay (EIA/RIA) plate, and then blocked with 2% bovine serum albumin. bLf and SARS‐CoV‐2 spike protein were mixed, added to the plate in triplicate, and incubated for 1 h at 25°C. After washing the spike, the plate was developed with a His‐tag antibody and goat anti‐mouse IgG. Finally, the plate was developed with a TMB (3,3′,5,5′‐tetramethylbenzidine) substrate. Absorbance was measured at 370/450 nm.

For the binding test between bLf and purified SARS‐CoV‐2 nonstructural protein 12 (nsp12), the 96‐well EIA/RIA plate was coated with bLf. After blocking, nsp12 (His‐tag) at 200 μg/well was added in triplicate. After 1 h of incubation at 25°C, His‐tag antibody and goat anti‐mouse IgG were added and incubated successively. Finally, the plate was developed with TMB substrate and quenched with HCl. Absorbance was measured at 450 nm.

2.8. Determination of the post‐entry inhibitory effect

The experimental design and procedure were performed as previously described. 20 Vero E6 and Caco‐2‐N cells were infected with GX_P2V and SARS‐CoV‐2 trVLPs at an MOI of 0.001 and 0.01, respectively, for 2 h. The virus inoculum was removed, and the cells were recovered using media containing bLf, remdesivir, or chloroquine at concentrations of 1 mg/ml, 15 μM, and 25 μM, respectively. The infected cell lysates and supernatants were collected at different time points for RT‐qPCR analysis.

2.9. Fluorescence resonance energy transfer (FRET)‐based protease assays with the SARS‐CoV‐2 3CLpro

FRET‐based 3CL protease inhibitory assay was performed using the 2019‐nCoV Mpro/3CLpro Inhibitor Screening Kit (Beyotime; cat. no.: P0312S).

2.10. FRET‐based RNA unwinding assay with the SARS‐CoV‐2 helicase

The SARS‐CoV‐2 helicase inhibition assays were performed as previously described. 21 The sequence of nsp13 (helicase) was inserted into pK27Sumo with codon optimization. The protein was expressed in Escherichia coli BL21(DE3) and purified by Ni‐NTA agarose and SUMO protease. RNA oligonucleotides FL‐Cy3 (5′‐CGCAGUCUUCUCCUGGUGCUCGAACAGUGAC(Cy3)‐3′) and RL‐BHQ2 (5′‐(BHQ2)GUCACUGUUCGAGCACCA‐3′) were annealed. Two micromolar of helicase and bLf were incubated at 25°C. The unwinding of RNA duplex was triggered at 37°C by adding 1 mM ATP and competitor DNA 5′‐GTCACTGTTCGAGCACCA‐3′ in helicase reaction buffer (20 mM Tris‐HCl, 150 mM NaCl, 5 mM MgCl2, 1 mM dithiothreitol). The final concentration of RNA duplex and competitor DNA was 0.4 and 4 μM, respectively. The fluorescence (λ ex = 550 nm, λ em = 620 nm) was measured.

2.11. In vitro RNA primer extension assay using RdRp complex

The SARS‐CoV‐2 and SARS‐CoV RdRp core complex comprise three nsps, a catalytic subunit nsp12, and accessory subunits nsp7 and nsp8. 22 Plasmids expressing SARS‐CoV‐2/SARS‐CoV‐1 nsp12, nsp7, and nsp8 were purchased from Adddgene or constructed in this study (Supporting Information: Table S1). 23 The RdRp inhibition assays were performed as previously described. 24 The proteins were expressed in E. coli BL21(DE3) cells and purified by Ni‐NTA agarose (Supporting Information: Figure S4C). 23 A template RNA (5′‐CUAUCCCCAUGUGAUUUUAAUAGCUUCUUAGGAGAAUGAC‐3′) was annealed to a primer (5′‐FAM‐GUCAUUCUCCUAAGAAGCUA‐3′). The RdRp core complex was prepared by mixing nsp12, nsp7, and nsp8. Drugs were mixed with the RdRp core complex for 45 min at 25°C. The primer RNA extension was initiated at 30°C by adding 1 μM RNA duplex and 1 mM NTPs to the RdRp core complex in a buffer containing 2 mM MgCl2. The reaction was quenched after 30 min by adding quenching buffer (95% formamide, 20 mM EDTA, 0.01% bromophenol blue) and incubated at 100°C for 10 min. The product was loaded onto 20% urea‐denaturing polyacrylamide gel electrophoresis and separated at 200 V. Images were captured using a Tanon 5200 system.

2.12. Protein–protein docking analysis

The analyzed proteins were obtained from the PBD database. The structure of the SARS‐CoV‐2 spike protein receptor‐binding domain (RBD) was extracted from the corresponding WT and variant spike proteins for docking analysis (WT: 6VXX and 6VYB; B.1.351: 7LYQ; B.1.617.2: 7BNN; P1: 7M8K; B.1.1.529: 7TGW). The structure of the RdRp core complex and nsp12 were extracted from the RdRp‐SARS‐CoV‐2 RNA conjugate (ID: 7B3C). bLf was obtained from a bovine source (ID:1bLf). Docking analysis between bLf and SARS‐CoV‐2 spike protein RBD or nsp12 was carried out using ZDOCK Server 3.0.2 (https://zdock.umassmed.edu/). 25 The top predicted complexes were further analyzed using the PDBePISA server.

2.13. RNA‐sequencing (RNA‐seq) processing and analysis

Four experimental groups were set up: (i) Vero E6 cells treated with 2 mg/ml bLf; (ii) Vero E6 cells infected with GX_P2V and treated with 2 mg/ml bLf; (iii) Vero E6 cells infected with GX_P2V; (iv) Vero E6 cells. RNA was collected after 48 h of culture and sequenced using the standard Illumina protocol (Annoroad Gene Technology). Reads were mapped to the genome using HISAT2. Each gene was counted using the HTSeq. The R package DESeq. 2 was used to identify the differentially expressed genes (DEGs). DEGs were defined as genes with a fold change of ≥2 and an adjusted p value of ≤0.05.

2.14. Antiviral evaluation in the golden hamster model

The animal experiments were conducted in the BSL‐2 laboratory of the Fifth Medical Center (Chinese PLA People's Liberation Army General Hospital) with the permission of experimental animal welfare and ethics (Approval ID: IACUC‐2018‐0020). Sixteen golden hamsters, eight females and eight males, aged 8–9 weeks old, were divided into four groups. The hamsters in the bLf or remdesivir treatment group were intraperitoneally administered bLf diluted in PBS at a dose of 15 mg/kg on Days 0, 1, 2, and 3 post‐infection (dpi). The control group was intraperitoneally administered the same amount of PBS daily. Hamsters in the groups above were challenged with 50 μl of 2 × 105 PFU/ml GX_P2V at 0 dpi with nasal infection, while hamsters in the mock group were challenged with 50 μl of PBS and treated with PBS for the following days.

The animals were killed and anatomized at 4 dpi. Lung tissues were obtained anatomically. Partial lung tissues were collected to quantify the viral yield using RT‐qPCR analysis. Lung tissues soaked in PBS were ground to harvest the homogenate using a freeze grinder. Lung and trachea tissues were subjected to H&E staining for pathological analysis.

2.15. Statistical analysis

Statistical analysis was performed using GraphPad Prism 8.0.2. An unpaired t‐test was used to evaluate the difference between the two groups. p values ≤ 0.05 was regarded as significant for the analysis. *p  <  0.05; **p  <  0.01; ***p  <  0.001; ****p  <  0.0001.

3. RESULT

3.1. bLf and MFGM were effective antiviral components in breast milk

To screen for effective antiviral components in milk, we selected the bioactive components that abound to test the antiviral ability of coronaviruses GX_P2V. Among these components, bLf and MFGM (bovine source) possessed prominent inhibitory effects (Figure 1A). α‐Lactalbumin exhibited a modest inhibitory effect of ~60% at 5 mg/ml. Sialylated human milk oligosaccharides 3′‐sialyllactose (3′‐SL) and 6′‐sialyllactose (6′‐SL) showed 50% and 41% inhibition, respectively, at 10 mg/ml, but lost their effect at 5 mg/ml (Figure 1A and Supporting Information: Figure S1A). The EC50 of bLf and MFGM was calculated, and the EC50 of bLf was 0.397 mg/ml for infected cells, 0.774 mg/ml for supernatant, the EC50 of MFGM was 0.443 mg/ml for infected cells, and 0.417 mg/ml for the supernatant (Figure 1B,C). Neither compound showed cytotoxicity at any of the tested concentrations. Western blot analysis further confirmed that bLf and MFGM almost completely abrogated nucleocapsid (N) protein production at 5 and 10 mg/ml (Figure 1D). bLf showed a better inhibitory effect than MFGM, with infectious virion production decreased by 1.5–2 log10 (Figure 1E,F).

Figure 1.

Figure 1

Open in a new tab

Antiviral effect of major milk components on pangolin coronavirus GX_P2V model. (A) Antiviral evaluation of main components of milk. Vero E6 cells were infected (MOI = 0.01) for 48 h and relative expression of viral RNA was measured by RT‐qPCR. All experiments were performed twice. Inhibition rates were calculated based on the viral load ratio of the treatment group/control. (B, C) Anti‐GX_P2V activity of bLf (B) and MFGM (C). (D) The western blot image of bLf‐ and MFGM‐treated Vero E6 cells challenged by GX_P2V. (E, F) Infectious GX_P2V particles determination by TCID50 and plaque formation assay. bLF, bovine lactoferrin; GAPDH, glyceraldehyde phosphate dehydrogenase; MFGM, milk fat globule membrane; MOI, multiplicity of infection; NP, nucleocapsid protein; RT‐qPCR, reverse transcription‐quantitative polymerase chain reaction; TCID50, median tissue culture infectious dose.

The EC50 values of bLf and MFGM on SARS‐CoV‐2 trVLP infection were 0.053 and 0.571 mg/ml, respectively (Figure 2A). In SARS‐CoV‐2 trVLP, the viral N gene was replaced by the GFP reporter gene, and both bLf and MFGM reduced the GFP fluorescence production (Figure 2C). The sequence identity of bLf and human Lf was ~70%. Compared to bLf, human Lf exhibited inferior inhibition of SARS‐CoV‐2 trVLP infection, with an EC50 of 0.299 mg/ml, and only reached 90.09% inhibition at 2.5 mg/ml (Figure 2B). In addition, bLf inhibited SADS‐CoV, the coronavirus that infects swine, with an EC50 of 0.4308 mg/ml (Supporting Information: Figure S5B,C).

Figure 2.

Figure 2

Open in a new tab

Antiviral effect of bLf and MFGM on SARS‐CoV‐2‐GFP/ΔN trVLP and GX_P2V infection in different cell lines. (A) The anti‐SARS‐CoV‐2 trVLP activity of bLf and MFGM in Caco‐2‐N cells. The EC50 of bLf and MFGM is determined based on the viral load in cell lysates. (B) Antiviral activity of hLf on Caco‐2‐N cells. (C) GFP expression as observed in Caco‐2‐N cells at 48 h post‐infection. Both bLf and MFGM significantly reduce the production of the virion. (D) Anti‐GX_P2V ability of bLf and MFGM was tested on 293T‐hACE2 cells. (E) Ability of anti‐GX_P2V of bLf and MFGM was tested on Caco‐2 cells. (F) Ability of anti‐GX_P2V bLf and MFGM tested on Calu‐3 cells. bLF, bovine lactoferrin; EC50, evaluation of 50% effective concentration; GFP, green fluorescent protein; hACE2, human angiotensin‐converting enzyme 2; MFGM, milk fat globule membrane; SARS‐CoV‐2, severe acute respiratory syndrome coronavirus 2; trVLP, transcription‐ and replication‐competent virus‐like particle.

3.2. blf and MFGM inhibited coronavirus infection on different human cell lines

Coronaviruses employ two pathways to enter cells: the membrane fusion pathway and the endosomal pathway in human primary lung cells. 26 , 27 , 28 We used coronavirus GX_P2V to study the antiviral effect of bLf and MFGM in different human cell lines to which coronaviruses employ distinct pathways for entry. Both bLf and MFGM inhibited 293T‐ACE2 cells, Calu‐3 cells, and Caco‐2 cells. The EC50 of bLf in 293T‐ACE2 cells, Caco‐2 cells, and Calu‐3 cells was 2.10, 0.205, and 0.071 mg/ml, respectively (Figure 2D,F). The EC50 values of MFGM in these cell lines were 0.718, 0.662, and 0.039 mg/ml, respectively (Figure 2D,F). Neither exhibited cytotoxicity in any of the three cell lines in the range of 0–5 mg/ml. These results support the hypothesis that the antiviral effects of bLf and MFGM are independent of the mode of viral entry.

3.3. bLf and MFGM inhibited GX_P2V and SARS‐CoV‐2 pseudovirus at the viral entry stage

To explore the mechanism of bLf and MFGM in preliminary, we first determined whether these components blocked the attachment of the GX_P2V to Vero E6 cells by RT‐qPCR. Both bLf and MFGM at 5 mg/ml impeded virus attachment to cells by 90% and 82%, respectively (Figure 3A,B). When MFGM was incubated with cells before and during viral absorption, inhibition of viral replication was observed, while MFGM added after viral absorption showed negligible inhibition in the viral replication (Figure 3C). It has been reported that Lf binds to heparin sulfate proteoglycans (HSPGs) on the surface of cells and inhibits SARS‐CoV and SARS‐CoV‐2. 29 , 30 , 31 We introduced heparan sulfate (HS) at a series of concentrations and bLf for coincubation with GX_P2V into Vero E6 cells to confirm this finding. HS abolished the antiviral effect of bLf in a dose‐dependent manner (Supporting Information: Figure S2A), which is in line with previous results. The ELISA result confirmed the binding between bLf and syndecan‐2, a core protein of HSPGs (Supporting Information: Figure S2B).

Figure 3.

Figure 3

Open in a new tab

bLf and MFGM inhibit GX_P2V and SARS‐CoV‐2 pseudovirus infection at the viral entry stage, and bLf shows an affinity with the SARS‐CoV‐2 spike protein. (A, B) Attachment assay of lactoferrin (A) and MFGM (B). **p < 0.01. Both bLf and MFGM decrease the viral load on the cell surface. (C) Time of addition assay of MFGM. MFGM (2 mg/ml) was added to Vero E6 cells in three ways. The MOI were 0.01 and 0.002. Full‐time: MFGM was added 1 h before virus infection and incubated throughout the infection period. Entry: MFGM was added 1 h before GX_P2V infection and washed 2 h after viral infection. Post‐entry: MFGM was added 2 h after viral infection. Cells were collected for RT‐qPCR detection at 12 h post‐infection. (D, E) Inhibition effects of MFGM (D) and bLf (E) on SARS‐CoV‐2 spike pseudoviruses. Different colors indicate different strains of pseudotyped SARS‐CoV‐2 in (E). (F) Evaluation of the effect of bLf on blocking the combination between SARS‐CoV‐2 spike protein and hACE2 by ELISA. Different colors indicate different concentrations of lactoferrin. (G) SPR‐binding kinetic analysis of bLf and SARS‐CoV‐2 spike protein (wild‐type). Different colors indicate different concentrations of lactoferrin. bLF, bovine lactoferrin; ELISA, enzyme‐linked immunosorbent assay; hACE2, human angiotensin‐converting enzyme 2; MFGM, milk fat globule membrane; RT‐qPCR, reverse transcription‐quantitative polymerase chain reaction; SARS‐CoV‐2, severe acute respiratory syndrome coronavirus 2; SPR, surface plasmon resonance; trVLP, transcription‐ and replication‐competent virus‐like particle.

In addition, we also performed pseudovirus‐based inhibition assays. bLf at 2.5 mg/ml reduced the entry of pseudotyped WT particles by 93%, pseudotyped beta by 72.2%, delta by 83.4%, and omicron by 73.6% (Figure 3E). MFGM reduced the entry of pseudotyped WT particles by 76.5%, pseudotyped beta by 91.3%, delta by 91.3%, and omicron by 41.3% (Figure 3D). In addition, bLf was able to suppress SARS‐CoV pseudovirus infection with a more favorable effect than that on SARS‐CoV‐2 pseudoviruses (Supporting Information: Figure S5A).

3.4. bLf showed an affinity for SARS‐CoV‐2 spike protein

The binding kinetics between bLf/MFGM and SARS‐CoV‐2 spike proteins were measured by ELISA and SPR assays. The binding of the spike was dose‐dependently abolished by the presence of bLf, while MFGM did not impede the spike‐ACE2 interaction (Figure 3F and Supporting Information: Figure S5D). In addition, bLf showed a favorable affinity for SARS‐CoV‐2 (WT) with a KD value of 0.647 μM (Figure 3G). MFGM did not show affinity with the spike protein (data not shown).

We simulated the binding of bLf to various types of RBD, including the WT and variants, using molecular docking (Supporting Information: Figure S3A–I). bLf bound to both the closed and open conformations of the WT and variants RBD, mainly attributed to the formation of hydrogen bonds and salt bridges. bLf did not show an affinity for hACE2. In our docking model, the interaction between bLf and spike protein RBD occurred at the N‐terminus of bLf and the up‐conformation of the RBD.

3.5. bLf inhibited coronavirus infection at the viral post‐entry stage

To determine the effect of bLf on viral replication, the drug was added to Vero E6 cells 2 h after GX_P2V infection. Remdesivir has been shown to inhibit SARS‐CoV‐2 replication by inhibiting viral RdRp. 32 Chloroquine increases the pH of the endosome (a vesicle structure), inhibits viruses that depend on low pH for endocytosis, and theoretically inhibits the release of viruses through vesicles. 33 During the infection, GX‐P2V RNA copies were maintained at a lower level in bLf‐ and remdesivir‐treated cells and supernatants (~105 copies/ml in cells, ~107 copies/ml in the supernatant), whereas the viral RNA load increased drastically in the control group (~1011 copies/ml in cells, ~1010.5 copies/ml in the supernatant) (Figure 4A,B). Additionally, viral nucleocapsid protein expression in the cell lysate was completely restricted in the presence of 5 mg/ml bLf (Figure 4D). Similar results were observed for bLf on SARS‐CoV‐2 trVLPs (Figure 4E,F). These results showed that bLf and remdesivir potently suppressed the increase in viral copies during infection in both cell lysate and supernatant, while chloroquine only inhibited the viral copies in the supernatant and allowed for viral replication and assembly in cells (high viral copies in cell lysate). These findings support the hypothesis that bLf inhibits GX_P2V and SARS‐CoV‐2 trVLP infection after viral entry by affecting viral replication and assembly.

Figure 4.

Figure 4

Open in a new tab

bLf inhibited coronaviruses at the viral post‐entry stage. (A, B) bLf added 2 h after GX_P2V infection. The viral copies in infected supernatant (A) and cell lysate (B) at different time points post‐viral entry were quantified by RT‐qPCR. Remdesivir and chloroquine treatment were used as controls. (C) Diagram of the time‐of‐addition assay design. (D) Western blot image of time‐of‐addition assay. Vero E6 cells infected with GX_P2V for 48 h are treated with 2.5 mg/ml bLf at different strategies. (E, F) bLf was added 2 h after SARS‐CoV‐2 trVLP infection. The viral copies in infected supernatant (E) and cell lysate (F) at various time points of post‐entry were quantified by RT‐qPCR. Remdesivir and chloroquine treatment were used as controls. bLF, bovine lactoferrin; ELISA, enzyme‐linked immunosorbent assay; hACE2, human angiotensin‐converting enzyme 2; MFGM, milk fat globule membrane; RT‐qPCR, reverse transcription‐quantitative polymerase chain reaction; SARS‐CoV‐2, severe acute respiratory syndrome coronavirus 2; SPR, surface plasmon resonance; trVLP, transcription‐ and replication‐competent virus‐like particle.

3.6. bLf inhibited the RdRp activity of SARS‐CoV‐2 and SARS‐CoV‐1

Based on the inhibitory effect of bLf on viral post‐entry at the cell culture level, we assumed that bLf also exerted its antiviral effect at the viral post‐entry stage by inhibiting viral replication. Lf has been endocytosed by several cell types, including Vero E6, Huh‐7, and Caco‐2 cells. 34 , 35 , 36 The internalization of Lf provides a prerequisite for its antiviral effect in cells. RdRp and Mpro/3CLpro protease play important roles in the replication and assembly of SARS‐CoV‐2, and both serve as ideal targets for developing antiviral drugs. 37 Helicase participates in the virus replication event by unwinding the oligonucleotides, one of the drug targets. Therefore, we verified the inhibitory effects of bLf on RdRp, 3CL protease, and helicase in vitro. The RdRp activity of SARS‐CoV‐2 was measured by RNA primer extension assay. Suramin sodium was introduced as a positive control. 38 The activity of 3CL protease and helicase was detected by FRET assay. The result showed that the 40 nt amplification strand was invisible when the concentration of bLf was higher than 20 nM, which revealed that RdRp activity was dose‐dependently inhibited by bLf, while bLf had no inhibitory effect on 3CL protease or helicase (Figure 5A and Supporting Information: Figure S4A,B). Therefore, we speculate that SARS‐CoV‐2 RdRp is one of the targets of bLf in the post‐entry stage after SARS‐CoV‐2 infection, whereas bLf does not directly interact with Mpro/3Clpro or helicase.

Figure 5.

Figure 5

Open in a new tab

Lactoferrin inhibits the RdRp activity of SARS‐CoV‐2 and SARS‐CoV. (A) bLf dose‐dependently stalls the SARS‐CoV‐2 dsRNA synthesis reaction. Suramin is used as a positive control to inhibit RdRp activity. (B) bLf binds to SARS‐CoV‐2 nsp12 in a dose‐dependent manner. Different symbols indicate different concentrations of lactoferrin. (C) Prediction results of docking interface between bLf and coronaviruses nsp12. (D) Structures of SARS‐CoV‐2 RdRp and SARS‐CoV‐2 nsp12–bLf complex. The structure of SARS‐CoV‐2 nsp12–lactoferrin complex predicted by ZDOCK. Nsp 12: green; Nsp7: magenta; Nsp8: cyan; bLf: yellow. (E) bLf dose‐dependently stalls the SARS‐CoV dsRNA synthesis reaction. (F) Schematic diagram of lactoferrin against SARS‐CoV‐2. bLF, bovine lactoferrin; dsRNA, double‐stranded RNA; nsp, nonstructural protein; RdRp, RNA‐dependent RNA polymerase; SARS‐CoV‐2, severe acute respiratory syndrome coronavirus 2.

Given that bLf has a molecular weight of ~78 kDa, its mechanism of action may not be consistent with that of remdesivir. It may bind to the active site or domain to inhibit RdRp activity. Using ELISA, we detected the binding between bLf and SARS‐CoV‐2 nsp12, the catalytic subunit of RdRp. The result showed that bLf combined with nsp12 dose‐dependently (Figure 5B). The Δi G value of the interface predicted by molecular docking were −6.4 and −10.4 kcal/mol, indicating positive protein affinities (Figure 5C,D). Three potential hydrogen bonds across the interface were predicted: R20, Q295, and P293 from bLf bound to Y420, Q444, and D445 from SARS‐CoV‐2 nsp12.

The RdRp is similar between SARS‐CoV‐2, GX_P2V, and SARS‐CoV, with an amino acid homology of over 96%. bLf showed a dose‐dependent and superior inhibitory effect on SARS‐CoV RdRp than SARS‐CoV‐2 RdRp (Figure 5E).

3.7. bLf might indirectly suppress viral infection by regulating immune mediators

bLf has been reported to regulate immune‐related genes to exert antiviral ability. 39 We performed RNA‐seq analysis to profile the transcriptome‐wide variations in Vero E6 cells in GX_P2V infection before and after bLf treatment. After 48 h of infection, 718 genes changed significantly with |log 2(fold change)| ≥ 1 and q (adjusted p value) < 0.05, including 242 upregulated genes and 476 downregulated genes (Figure 6A and Supporting Information: Table S2). DEGs were visualized using a heat map (Figure 6C). Among these genes, the expression of circadian rhythm proteins Period 2 and matrix metalloproteinase‐10 (MMP‐10) exhibited the most significant upregulation and downregulation, which was confirmed by RT‐qPCR analysis (Figure 6A,C). The MMP‐10 expression pattern is conserved between humans and mouse, 40 and its expression is higher in asymptomatic COVID‐19 patients than in patients with reported symptoms, 41 indicating the role of MMP‐10 in anti‐SARS‐CoV‐2 infection. In the biological processes of Gene Ontology enrichment analysis, the growth‐related processes of cells were the most enriched in DEGs, such as the developmental process, multicellular organizational process, and collections structure development. In addition, metabolic and biosynthetic processes, such as isoprenoid and sterol biosynthetic processes, are involved. In terms of molecular function, DEGs mentioned above mainly involve binding and receptor regulator activity (Figure 6D). Kyoto Encyclopedia of Genes and Genomes path analysis results showed that DEGs are mainly enriched in protein digestion and absorption, and steroid biosynthesis processes (Figure 6E).

Figure 6.

Figure 6

Open in a new tab

Transcriptome analysis of bLf against‐GX_P2V infection in Vero E6 cells. (A) Volcano plot of DEGs between virus‐infected Vero E6 cells and virus‐infected Vero E6 cells with bLf treatment. (B) Differentially expressed genes in the biological process group and molecular function group were enriched by GO analysis. ***p < 0.001; ****p < 0.0001. (D) Enrichment pathways of regulated genes in GX_P2V‐infected cells after bLf treatment. bLF, bovine lactoferrin; DEG, differentially expressed gene; GO, gene ontology.

3.8. bLf constrained the viral infection and alleviated histopathological damages in the hamster model

Given the prominent antiviral effect of bLf in vitro, we evaluated the antiviral effect in the hamster model to ascertain its therapeutic potential (Figure 7A). Hamsters were treated with bLf (15 mg/kg) and remdesivir (15 mg/kg 21 ). The first dose was intraperitoneally administered at 0 dpi, and hamsters were challenged with GX_P2V. During the 4‐day infection period, hamsters were administered bLf or remdesivir at a specified daily dose. At 4 dpi, the viral copies in the lung and trachea in hamsters treated with bLf were suppressed by 0.81–2.53 log10 and 0.32–1.14 log10, respectively, which showed a comparable effect to remdesivir therapy (Figure 7B,C).

Figure 7.

Figure 7

Open in a new tab

In vivo anti‐GX_P2V evaluation of bLf in the hamster model. (A) Schematic diagram of in vivo evaluation of GX_P2V infection in the hamster model. Treated groups: hamsters infected with GX_P2V treated with bLf or remdesivir at 0, 1, 2, and 3 dpi; control group: hamsters infected with GX_P2V are treated with PBS at 0, 1, 2, and 3 dpi; mock: hamsters treated with PBS at 0, 1, 2, and 3 dpi. (B, C) The viral copies in lungs (B) and tracheae (C) at 4 dpi determined by RT‐qPCR, a dot represents a hamster. *p < 0.05; ***p < 0.001. (D) Ex vivo images of lungs. (E) Histopathological detection of lung and trachea tissues by hematoxylin and eosin staining. Blue: granulocytes infiltration; black: the collapses of alveolar cavity; green: lymphocytes infiltrations. bLF, bovine lactoferrin; PBS, phosphate‐buffered saline; dpi, days post‐infection; RT‐qPCR, reverse transcription‐quantitative polymerase chain reaction.

The lungs of hamsters challenged with GX_P2V infection showed noticeable histopathological damage, with moderate to large areas of alveolar wall thickening, resulting in a large number of alveolar cavities being compressed and collapsing. Inflammation induced by viral invasion resulted in a moderate infiltration of granulocytes and lymphocytes (Figure 7E). In contrast, the lungs of hamsters treated with bLf via intraperitoneal administration showed few to mild areas of alveolar wall thickening and milder infiltration of inflammatory cells (Figure 7E).

Collectively, bLf treatment restricted viral replication in the lungs and tracheae, which showed comparable efficacy to remdesivir treatment and reversed the histopathological damage caused by the viral infection in the lungs.

4. DISCUSSION

We explored the key components that play a dominant role in the antiviral effect of milk (both human and bovine) and ascertained the underlying molecular mechanism. We screened the major milk components using pangolin coronavirus GX_P2V, which shows high genomic similarity with SARS‐CoV‐2, shares 92.2% amino acid identity at the Spike with SARS‐CoV‐2, 12 and has been successfully validated as an ideal alternative model for SARS‐CoV‐2 drug screening. 17 Several milk components have been identified to exhibit antiviral activity to different degrees, including bLf, MFGM, α‐lactalbumin, OPN, 3′‐SL, and 6′‐SL. 3′‐SL and 6′‐SL at high concentrations exhibited moderate inhibition of viral infection and attachment of ~50%. 3′‐SL and 6′‐SL carry sialic acid molecules, 42 identified as an attachment, and host factors that restrict SARS‐CoV‐2 infection (Supporting Information: Figure S1B). Among them, bLf and MFGM achieved inhibition rates of over 99% and remained effective in various human cell lines that employed different pathways for entering cells. We then further confirmed their effectiveness in the SARS‐CoV‐2 trVLP model.

Both bLf and MFGM reduced the attachment of GX_P2V to cells and the entry of pseudotyped SARS‐CoV‐2 WT and mutants. MFGM exerts an antiviral effect during the early phase of infection by decreasing the viral attachment to host cells, but it does not interrupt the binding of the spike to the ACE2 receptor. bLf interfered with the binding of SARS‐CoV‐2 spike protein to ACE2.

It has been reported that Lf exerts anti‐SARS‐CoV‐2 efficacy by intervening viral attachment and modulating the expression of immune factors. Hu et al. 29 and Mirabelli et al. 30  showed that Lf targeted cellular HSPGs, thus blocking the SARS‐CoV‐2 attachment to host cells. Salaris et al. 43 reported that Lf inhibited SARS‐CoV‐2 infection in cell culture, and they found that Lf enhanced the expression of immune‐related genes by RT‐qPCR detection, which gave preliminary evidence that Lf plays a role in immunoregulation. Campione et al. 44 conducted an in vivo study and showed that intranasal liposomal bLf‐treated COVID‐19 patients obtained an earlier and significant SARS‐CoV‐2 RNA‐negative conversion compared with the standard of care treated and untreated COVID‐19 patients. Wotring et al. 45 reported that bLf showed potent efficacy on different SARS‐CoV‐2 variants, but the underlying mechanisms were not explored. Ward et al. 46 and Shafqat et al. 47  summarized the role of Lf against SARS‐CoV‐2, including blocking viral attachment between HSPGs and viral particles and modulating the expression of immune‐related genes. Although most studies have demonstrated that Lf inhibits viral infection primarily by interfering with cell entry, few studies have suggested that the post‐infection addition of Lf could also reduce infection. 36 Picard‐Jean et al. 36 revealed that human Lf could be uptaken by hepatocyte and inhibited hepatitis C virus ATPase/helicase NS3 protein, which was the only report to provide direct evidence on the influence of Lf on viral replication so far. Our viral post‐entry assay revealed that bLf potently inhibited viral expression in host cells and infectious particles in the cell supernatant, suggesting that bLf interferes with viral replication. Viral RdRp, 3CL proteases and helicase are conserved coronavirus proteins that participate in viral replication, and RdRp and 3CL protease are considered the primary therapeutic targets for drug development. 48 We constructed the RdRp complex to perform the RNA primer extension experiment to evaluate RdRp activity. Surprisingly, bLf eliminated the SARS‐CoV‐2 and SARS‐CoV RNA primer extension at the nanomolar scale.

Furthermore, ELISA and molecular docking models suggested that the binding event between bLf and viral nsp12 contributed to the RdRp inhibition ability of bLf. SARS‐CoV‐2 RdRp showed high conservation with GX_P2V and SARS‐CoV, sharing the highest amino acid identity with 98% and 96%, respectively (Supporting information: Figure S4D). For the first time, our study reveals the inhibitory effect of bLf on coronaviruses RdRp, which is under low selective pressure during viral mutations. 49 We identified two targets of Lf apart from HSPGs at the cell culture and molecular levels: spike protein and RdRp from the virus, with effective concentration ranges of micromole and nanomole, respectively. bLf was more effective on SARS‐CoV‐2 trVLP inhibition than on pseudotyped SARS‐CoV‐2, and more effective on RdRp inhibition than on the spike, indicating that bLf plays a major role in inhibiting viral replication.

The in vitro digestion experiment indicated that Lf could not resist proteolysis in simulated gastric environments, which was digested into <10 kDa peptides. However, Wotring et al. 45 revealed that lactoferricin, a fragment of peptic digestion from Lf, had antiviral ability against SARS‐CoV‐2, although its ability was not as good as Lf. The in vivo evaluation of bLf was performed on golden hamsters 50 and validated the antiviral efficacy of intraperitoneal bLf against the coronavirus GX_P2V model in preliminary studies, with reduced viral copies in lungs and tracheae and improved pathological changes. Oral and intranasal liposomal bLf played a positive role in the recovery of mild‐to‐moderate COVID‐19 patients, indicating oral and intranasal liposomal administration of bLf has the potential practical significance in inhibiting SARS‐CoV‐2 infection. 44

AUTHOR CONTRIBUTIONS

Shi‐ting He and Huahao Fan drafted and revised the manuscript. Shi‐ting He performed the virus assay and molecular docking. Shi‐ting He and Lin Guan prepared the RdRp complex and performed the RdRp assay. Hongbo Qin and Shi‐ting He performed the western blot analysis, animal experiments, and transcriptome analysis. Bixia Hong, Ke Liu, Fuxing Lou, and Maochen Li prepared the pseudoviruses. Xiaoxu Zhang and Chengzhi He performed the SPR assay. Bixia Hong prepared the SARS‐CoV‐2 trVLPs. Shi‐ting He and Wei Lin performed sequence alignment. Yangzhen Chen performed the anti‐SADS‐CoV evaluation. Huahao Fan developed the concept and provided important experimental insight. Huahao Fan and Yigang Tong provided financial support.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Supporting information

Supplementary information.

Click here for additional data file. (705.3KB, docx)

Supplementary information.

Click here for additional data file. (11.3KB, xlsx)

Supplementary information.

Click here for additional data file. (11.7MB, xlsx)

ACKNOWLEDGMENTS

We thank the H&H Group for supplying milk components. We thank Dr. Qiang Ding from Tsinghua University for kindly providing SARS‐CoV‐2 trVLP. This work was supported by the National Natural Science Foundation of China (Grant No. 82202492), the National Key Research and Development Program of China (Grant No. 2022YFC0867500, BWS21J025, and 20SWAQK22), Key Project of Beijing University of Chemical Technology (Grant Nos. XK1803‐06 and XK2020‐02), Fundamental Research Funds for Central Universities (Grant No. BUCTZY2022), and H&H Global Research and Technology Center (Grant No. H2021028).

He S‐t, Qin H, Guan L, et al. Bovine lactoferrin inhibits SARS‐CoV‐2 and SARS‐CoV‐1 by targeting the RdRp complex and alleviates viral infection in the hamster model. J Med Virol. 2022;95:e28281. 10.1002/jmv.28281

Shi‐ting He, Hongbo Qin, and Lin Guan contributed equally to this study.

Contributor Information

Huahao Fan, Email: fanhuahao@mail.buct.edu.cn.

Yigang Tong, Email: tongyigang@mail.buct.edu.cn.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  • 1. Chambers C, Krogstad P, Bertrand K, et al. Evaluation for SARS‐CoV‐2 in breast milk from 18 infected women. JAMA. 2020;324(13):1347‐1348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Lou F, Qin H, He S, et al. The benefits of breastfeeding still outweigh the risks of COVID‐19 transmission. Front Med. 2021;8:703950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Pang Z, Hu R, Tian L, et al. Overview of breastfeeding under COVID‐19 pandemic. Front Immunol. 2022;13:896068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Fan H, Hong B, Luo Y, et al. The effect of whey protein on viral infection and replication of SARS‐CoV‐2 and pangolin coronavirus in vitro. Signal Transduct Target Ther. 2020;5(1):275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Ren Q, Zhou Y, Zhang W, et al. Longitudinal changes in the bioactive proteins in human milk of the Chinese population: a systematic review. Food Sci Nutr. 2021;9(1):25‐35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Moreno‐Expósito L, Illescas‐Montes R, Melguizo‐Rodríguez L, Ruiz C, Ramos‐Torrecillas J, de Luna‐Bertos E. Multifunctional capacity and therapeutic potential of lactoferrin. Life Sci. 2018;195:61‐64. [DOI] [PubMed] [Google Scholar]
  • 7. Cai X, Duan Y, Li Y, et al. Lactoferrin level in breast milk: a study of 248 samples from eight regions in China. Food Funct. 2018;9(8):4216‐4222. [DOI] [PubMed] [Google Scholar]
  • 8. Wang C, Qiao X, Gao Z, Jiang L, Mu Z. Advancement on milk fat globule membrane: separation, identification, and functional properties. Front Nutr. 2022;8:807284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Fuller KL, Kuhlenschmidt TB, Kuhlenschmidt MS, Jiménez‐Flores R, Donovan SM. Milk fat globule membrane isolated from buttermilk or whey cream and their lipid components inhibit infectivity of rotavirus in vitro. J Dairy Sci. 2013;96(6):3488‐3497. [DOI] [PubMed] [Google Scholar]
  • 10. Li M, Wang H, Tian L, et al. COVID‐19 vaccine development: milestones, lessons and prospects. Signal Transduct Target Ther. 2022;7(1):146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Ziqi W, Kai C, Costabel U, Xiaoju Z. Nanotechnology‐facilitated vaccine development during the coronavirus disease 2019 (COVID‐19) pandemic. Exploration. 2022:20210082. 10.1002/EXP.20210082 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Lam TTY, Jia N, Zhang YW, et al. Identifying SARS‐CoV‐2‐related coronaviruses in Malayan pangolins. Nature. 2020;583(7815):282‐285. [DOI] [PubMed] [Google Scholar]
  • 13. Pei P, Qin H, Chen J, et al. Computational design of ultrashort peptide inhibitors of the receptor‐binding domain of the SARS‐CoV‐2 S protein. Brief Bioinform. 2021;22(6):bbab243. [DOI] [PubMed] [Google Scholar]
  • 14. Qin H, Qiu H, He ST, et al. Efficient disinfection of SARS‐CoV‐2‐like coronavirus, pseudotyped SARS‐CoV‐2 and other coronaviruses using cold plasma induces spike protein damage. J Hazard Mater. 2022;430:128414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Ju X, Zhu Y, Wang Y, et al. A novel cell culture system modeling the SARS‐CoV‐2 life cycle. PLoS Pathog. 2021;17(3):e1009439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Nie J, Li Q, Wu J, et al. Quantification of SARS‐CoV‐2 neutralizing antibody by a pseudotyped virus‐based assay. Nat Protoc. 2020;15(11):3699‐3715. [DOI] [PubMed] [Google Scholar]
  • 17. Fan HH, Wang LQ, Liu WL, et al. Repurposing of clinically approved drugs for treatment of coronavirus disease 2019 in a 2019‐novel coronavirus‐related coronavirus model. Chin Med J. 2020;133(9):1051‐1056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Weston S, Coleman CM, Haupt R, et al. Broad anti‐coronavirus activity of Food and Drug Administration‐approved drugs against SARS‐CoV‐2 in vitro and SARS‐CoV in vivo. J Virol. 2020;94(21):e01218‐20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Kang L, Li C, Yang Q, et al. 64)Cu‐labeled daratumumab F(ab')(2) fragment enables early visualization of CD38‐positive lymphoma. Eur J Nucl Med Mol Imaging. 2022;49(5):1470‐1481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Luo Y, Tan CW, Xie SZ, et al. Identification of ZDHHC17 as a potential drug target for swine acute diarrhea syndrome coronavirus infection. mBio. 2021;12(5):e0234221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Yuan S, Yin X, Meng X, et al. Clofazimine broadly inhibits coronaviruses including SARS‐CoV‐2. Nature. 2021;593(7859):418‐423. [DOI] [PubMed] [Google Scholar]
  • 22. Hillen HS, Kokic G, Farnung L, Dienemann C, Tegunov D, Cramer P. Structure of replicating SARS‐CoV‐2 polymerase. Nature. 2020;584(7819):154‐156. [DOI] [PubMed] [Google Scholar]
  • 23. Bertolin AP, Weissmann F, Zeng J, et al. Identifying SARS‐CoV‐2 antiviral compounds by screening for small molecule inhibitors of nsp12/7/8 RNA‐dependent RNA polymerase. Biochem J. 2021;478(13):2425‐2443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Peng Q, Peng R, Yuan B, et al. Structural and biochemical characterization of the nsp12‐nsp7‐nsp8 core polymerase complex from SARS‐CoV‐2. Cell Rep. 2020;31(11):107774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Pierce BG, Wiehe K, Hwang H, Kim BH, Vreven T, Weng Z. ZDOCK server: interactive docking prediction of protein‐protein complexes and symmetric multimers. Bioinformatics. 2014;30(12):1771‐1773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Tang T, Bidon M, Jaimes JA, Whittaker GR, Daniel S. Coronavirus membrane fusion mechanism offers a potential target for antiviral development. Antiviral Res. 2020;178:104792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Pyrc K, Berkhout B, van der Hoek L. The novel human coronaviruses NL63 and HKU1. J Virol. 2007;81(7):3051‐3057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Nomura R, Kiyota A, Suzaki E, et al. Human coronavirus 229E binds to CD13 in rafts and enters the cell through caveolae. J Virol. 2004;78(16):8701‐8708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Hu Y, Meng X, Zhang F, Xiang Y, Wang J. The in vitro antiviral activity of lactoferrin against common human coronaviruses and SARS‐CoV‐2 is mediated by targeting the heparan sulfate co‐receptor. Emerg Microbes Infect. 2021;10(1):317‐330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Mirabelli C, Wotring JW, Zhang CJ, et al. Morphological cell profiling of SARS‐CoV‐2 infection identifies drug repurposing candidates for COVID‐19. Proc Natl Acad Sci USA. 2021;118(36):e2105815118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Lai X, Yu Y, Xian W, et al. Identified human breast milk compositions effectively inhibit SARS‐CoV‐2 and variants infection and replication. iScience. 2022;25(4):104136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Kokic G, Hillen HS, Tegunov D, et al. Mechanism of SARS‐CoV‐2 polymerase stalling by remdesivir. Nat Commun. 2021;12(1):279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Hoffmann M, Mösbauer K, Hofmann‐Winkler H, et al. Chloroquine does not inhibit infection of human lung cells with SARS‐CoV‐2. Nature. 2020;585(7826):588‐590. [DOI] [PubMed] [Google Scholar]
  • 34. Barros CA, Sanches D, Marques de Carvalho CA, et al. Influence of iron binding in the structural stability and cellular internalization of bovine lactoferrin. Heliyon. 2021;7(9):e08087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Ashida K, Sasaki H, Suzuki YA, Lönnerdal B. Cellular internalization of lactoferrin in intestinal epithelial cells. BioMetals. 2004;17(3):311‐315. [DOI] [PubMed] [Google Scholar]
  • 36. Picard‐Jean F, Bouchard S, Larivée G, Bisaillon M. The intracellular inhibition of HCV replication represents a novel mechanism of action by the innate immune lactoferrin protein. Antiviral Res. 2014;111:13‐22. [DOI] [PubMed] [Google Scholar]
  • 37. Zhu W, Chen CZ, Gorshkov K, Xu M, Lo DC, Zheng W. RNA‐dependent RNA polymerase as a target for COVID‐19 drug discovery. SLAS Discov. 2020;25(10):1141‐1151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Yin W, Luan X, Li Z, et al. Structural basis for inhibition of the SARS‐CoV‐2 RNA polymerase by suramin. Nat Struct Mol Biol. 2021;28(3):319‐325. [DOI] [PubMed] [Google Scholar]
  • 39. Chang R, Ng TB, Sun WZ. Lactoferrin as potential preventative and adjunct treatment for COVID‐19. Int J Antimicrob Agents. 2020;56(3):106118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. McMahan RS, Birkland TP, Smigiel KS, et al. Stromelysin‐2 (MMP10) moderates inflammation by controlling macrophage activation. J Immunol. 2016;197(3):899‐909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Soares‐Schanoski A, Sauerwald N, Goforth CW, et al. Asymptomatic SARS‐CoV‐2 infection is associated with higher levels of serum IL‐17C, matrix metalloproteinase 10 and fibroblast growth factors than mild symptomatic COVID‐19. Front Immunol. 2022;13:821730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Chatterjee M, van Putten JPM, Strijbis K. Defensive properties of mucin glycoproteins during respiratory infections‐relevance for SARS‐CoV‐2. mBio. 2020;11(6):e02374‐20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Salaris C, Scarpa M, Elli M, et al. Protective effects of lactoferrin against SARS‐CoV‐2 infection in vitro. Nutrients. 2021;13(2):328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Campione E, Lanna C, Cosio T, et al. Lactoferrin as antiviral treatment in COVID‐19 management: preliminary evidence. Int J Environ Res Public Health. 2021;18(20):10985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Wotring JW, Fursmidt R, Ward L, Sexton JZ. Evaluating the in vitro efficacy of bovine lactoferrin products against SARS‐CoV‐2 variants of concern. J Dairy Sci. 2022;105(4):2791‐2802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Ward JL, Torres‐Gonzalez M, Ammons MCB. The influence of viral infections on iron homeostasis and the potential for lactoferrin as a therapeutic in the age of the SARS‐CoV‐2 pandemic. Nutrients. 2022;14(15):3090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Shafqat F, Rehman SU, Niaz K. Lactoferrin K can attenuate SARS‐CoV‐2: an analysis of evidential relations. Biomed Res Ther. 2022;9(2):4901‐4919. [Google Scholar]
  • 48. Krumm ZA, Lloyd GM, Francis CP, et al. Precision therapeutic targets for COVID‐19. Virol J. 2021;18(1):66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Mari A, Roloff T, Stange M, et al. Global genomic analysis of SARS‐CoV‐2 RNA dependent RNA polymerase evolution and antiviral drug resistance. Microorganisms. 2021;9(5):1094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Lee CY, Lowen AC. Animal models for SARS‐CoV‐2. Curr Opin Virol. 2021;48:73‐81. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary information.

Click here for additional data file. (705.3KB, docx)

Supplementary information.

Click here for additional data file. (11.3KB, xlsx)

Supplementary information.

Click here for additional data file. (11.7MB, xlsx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Journal of Medical Virology are provided here courtesy of Wiley

RESOURCES