Abstract
Coronavirus disease 2019 (COVID‐19) is a highly infectious disease caused by severe acute respiratory syndrome coronavirus 2 (SARS‐COV‐2). Though many methods have been used for detecting SARS‐COV‐2, development of an ultrafast and highly sensitive detection strategy to screen and/or diagnose suspected cases in the population, especially early‐stage patients with low viral load, is significant for the prevention and treatment of COVID‐19. In this study, a novel restriction endonuclease‐mediated reverse transcription multiple cross displacement amplification (MCDA) combined with real‐time fluorescence analysis (rRT‐MCDA) was successfully established and performed to diagnose COVID‐19 infection (COVID‐19 rRT‐MCDA). Two sets of specific SARS‐COV‐2 rRT‐MCDA primers targeting opening reading frame 1a/b (ORF1ab) and nucleoprotein (NP) genes were designed and modified according to the reaction mechanism. The SARS‐COV‐2 rRT‐MCDA test was optimized and evaluated using various pathogens and clinical samples. The optimal reaction condition of SARS‐COV‐2 rRT‐MCDA assay was 65°C for 36 min. The SARS‐COV‐2 rRT‐MCDA limit of detection (LoD) was 6.8 copies per reaction. Meanwhile, the specificity of SARS‐COV‐2 rRT‐MCDA assay was 100%, and there was no cross‐reaction with nucleic acids of other pathogens. In addition, the whole detection process of SARS‐COV‐2 rRT‐MCDA, containing the RNA template processing (15 min) and real‐time amplification (36 min), can be accomplished within 1 h. The SARS‐COV‐2 rRT‐MCDA test established in the current report is a novel, ultrafast, ultrasensitive, and highly specific detection method, which can be performed as a valuable screening and/or diagnostic tool for COVID‐19 in clinical application.
Keywords: COVID‐19, multiple cross displacement amplification, real‐time fluorescence, restriction endonuclease, SARS‐CoV‐2
1. INTRODUCTION
Coronavirus disease 2019 (COVID‐19) is a highly infectious disease caused by severe acute respiratory syndrome coronavirus 2 (SARS‐COV‐2, an enveloped nonsegmented positive‐sense RNA virus). 1 , 2 To date, the epidemic of COVID‐19 is still ongoing, and these COVID‐19 cases involved all countries and/or regions in the world. 3 Thus, the development of an ultrafast and highly sensitive detection strategy to screen and/or diagnose suspected cases in the population, especially early‐stage asymptomatic patients with low viral load, 4 is significant for the prevention and treatment of COVID‐19.
Real‐time reverse transcription‐polymerase chain reaction (RT‐PCR), a conventional molecular detection method, was widely applied for the diagnosis of COVID‐19. 1 , 5 , 6 , 7 , 8 Although the conventional RT‐PCR method has its outstanding capabilities, the further improvements in sensitivity and reliability to achieve more accurate and flexible detection of SARS‐CoV‐2 are still urgently needed in earlier strategies. Hence, the development of a novel, ultrafast, highly sensitive, and more flexible test for detecting SARS‐CoV‐2 is extremely important for clinical screening and/or diagnosis of COVID‐19 cases. The multiple cross displacement amplification (MCDA) with 10 specially designed primers and spanning 10 distinct regions of target sequence, which is a high specificity and sensitivity detection method, and applied in many pathogens detection fields. 9 , 10 , 11 The MCDA is an isothermal amplification technique, which react through the 10 special primers and Bst DNA polymerase mixture. 9 The approach is more sensitive than the LAMP and CPA assays, and is 10‐ and 100‐fold more sensitive than that of quantitative polymerase chain reaction (qPCR) and PCR techniques individually. 9 , 10 Now, common methods for the validation of MCDA amplicons (i.e., visualization reagents, agarose gel electrophoresis, nanoparticle‐based biosensor, etc.) are difficult to achieve high efficiency or closed‐tube detection. 9 , 10 , 11 Although MCDA test combined with a nanoparticle‐based lateral flow biosensor (MCDA‐LFB) can achieve rapid and specific detection of SARS‐CoV‐2, cross‐contamination is prone to occur due to the open‐tube detection required for LFB biosensors. 10 , 11 , 12 , 13 , 14 Therefore, the verification of SARS‐CoV‐2‐MCDA amplicons needs to utilize an intuitive, effective, and reliable method. In various molecular targets, many methods based on opening reading frame 1a/b (ORF1ab) and nucleoprotein (NP) genes were frequently developed and applied to detect the nucleic acids of SARS‐CoV‐2, as they were successfully proven to be effective for the diagnosis of COVID‐19. 5 , 6 , 8 , 15
In this study, a novel, ultrafast, highly sensitive, and restriction endonuclease‐mediated reverse transcription MCDA assay combined with real‐time fluorescence analysis (rRT‐MCDA) was established and performed to diagnose COVID‐19 infection (COVID‐19 rRT‐MCDA). In the COVID‐19 rRT‐MCDA system, ORF1ab and NP genes were amplified separately in a single MCDA reaction tube, and the results were monitored by a real‐time fluorescence detector. The rRT‐MCDA test developed in this report was evaluated for the diagnosis of COVID‐19 by using ORF1ab‐plasmid, NP‐plasmid, and various clinical samples.
2. MATERIALS AND METHODS
2.1. Primer design
According to the reaction mechanism of MCDA, two sets of specific primers, targeting ORF1ab and NP (GenBank accession no. MN908947, Wuhan‐Hu‐1, https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3/) were designed, respectively, by performing the Primer Explorer V5 (http://primerexplorer.jp/lampv5e/index.html) and PRIMER PREMIER 5.0. Each set of primers included two displacement primers (F1 and F2), two cross‐primers (CP1 and CP2), and six amplification primers (D1, D2, C1, C2, R1, and R2). In addition, FAM (6‐carboxy‐fluorescein) was labeled at the 5′ end of the ORF‐D1 primer, and the BHQ1was used as a dark quencher. Meanwhile, the CY5 (Cyanine 5 fluorescein) was labeled at the 5′ end of the NP‐D1, and the BHQ2 was utilized as another dark quencher. The details, including primer design, sequences, and location of expression sites on the ORF1ab and NP genes, were listed in Table 1 and Figure 1. The primer sequences (HPLC purification grade) were synthesized and purified by Tian‐Yi Biotech.
Table 1.
The details of primers for the ORF1a/b and N genes
| Genes | Primer name | Sequences and modifications | Length |
|---|---|---|---|
| ORF1a/b | ORF‐F1 | 5′‐CCCTGTGGGTTTTACACTT‐3′ | 19 nt |
| ORF‐F2 | 5′‐GAATTTAGCAAAACCAGCTACT‐3′ | 22 nt | |
| ORF‐CP1 | 5′‐GGAGTTGATCACAACTACAGCCATAAAAACACAGTCTGTACCGT ‐3′ | 44 mer | |
| ORF‐CP2 | 5′‐AGTGCAGCCCGTCTTACACCTGTAGATGTCAAAAGCCCTG‐3′ | 40 mer | |
| ORF‐C1 | 5′‐GGAGTTGATCACAACTACAGCCAT‐3′ | 24 nt | |
| ORF‐C2 | 5′‐AGTGCAGCCCGTCTTACACC‐3′ | 20 nt | |
| ORF‐D1* | 5′‐FAM‐TGCAATG‐CCTTT(BHQ1) CCACATACCGCAG‐3′ | 25 nt | |
| ORF‐D2 | 5′‐CACTAGTACTGATGTCGTA‐3′ | 19 nt | |
| ORF‐R1 | 5′‐ACTGAAGCATGGGTTCG‐3′ | 17 nt | |
| ORF‐R2 | 5′‐CAGCTGATGCACAATCGTT‐3′ | 19 nt | |
| NP | N‐F1 | 5′‐CCCCGCATTACGTTTGGTG‐3′ | 19 nt |
| N‐F2 | 5′‐AGCCAATTTGGTCATCTGGA‐3′ | 20 nt | |
| N‐CP1 | 5′‐CGTTGTTTTGATCGCGCCCC‐GACCCTCAGATTCAACTGGC‐3′ | 41 mer | |
| N‐CP2 | 5′‐ACCGCTCTCACTCAACATGGC‐TGGTGTTAATTGGAACGCCT‐3′ | 42 mer | |
| N‐C1 | 5′‐CGTTGTTTTGATCGCGCCCC‐3′ | 20 nt | |
| N‐C2 | 5′‐ACCGCTCTCACTCAACATGGC‐3′ | 21 nt | |
| N‐D1* | 5′‐CY5‐TGCAATG‐TGCGT(BHQ2) TCTCCATTCTGGTTACT‐3′ | 46 nt | |
| N‐D2 | 5′‐AAGGAAGACCTTAAATTCCCTCGA‐3′ | 24 nt | |
| N‐R1 | 5′‐TGGGTAAACCTTGGGGCC‐3′ | 18 nt | |
| N‐R2 | 5′‐ATAATACTGCGTCTTGGTTC‐3′ | 20 nt |
Abbreviations: BHQ1, black hole quencher 1; BHQ2, black hole quencher 2; CY5, cyanine 5 fluorescein; FAM, 6‐carboxy‐fluorescein; ORF1a/b, open reading frame 1a/b; mer, monomeric unit; nt, nucleitide; NP, nucleoprotein gene.
Figure 1.

The sequences and modifications of the ORF1ab and NP genes. All the sequences of the primer sites are marked. Right and left arrows indicate sense and complementary sequences used in the experiments.
2.2. The COVID‐19 rRT‐MCDA reaction
The COVID‐19 rRT‐MCDA reaction mixtures (25 μl) contained 12.5 μl 2× reaction buffer, 1 μl Bst 2.0 DNA polymerase (10 U, New England Biolabs), 1 μl AMV (10 U, Invitrogen), 1 μl Nb. BsrDI (10 U, New England Biolabs), 0.4 μM each of displacement primers (F1 and F2), 0.4 μM each of amplification primers (C1 and C2), 2.4 μM each of cross primers (CP1 and CP2), 1.2 μM each of amplification primers (R1, R2, D1, and D2), RNA templates (2 μl for the standard plasmids and/or 5 µl for clinical samples), and appropriate distilled water (DW). Then, the amplification process was performed at 65℃ for 36 min. Three detection strategies, including real‐time fluorescence detector, real‐time turbidimeter (LA‐500, Eiken chemical Co., Ltd.), and 1.5% agarose gel electrophoresis, were performed for the verification of the COVID‐19 rRT‐MCDA amplification products. The genomic RNA of other pathogen such as the H7N9 were used as negative control, and DW were used as blank control.
2.3. Optimization of reaction temperature for COVID‐19 rRT‐MCDA assay
The optimal reaction temperature for COVID‐19 rRT‐MCDA test was confirmed using the ORF1ab‐ and NP‐plasmid (2.1 × 104 copies per reaction). The reaction temperatures ranging from 61℃ to 68℃ (with 1℃ intervals) were tested, and the amplification productions were monitored by performing real‐time turbidimeter (LA‐500). The threshold (turbidity) was 0.1, and a turbidity >0.1 was regarded as positive amplification. 9
2.4. Detection sensitivity of the COVID‐19 rRT‐MCDA assay
In this study, ORF1ab‐ and NP‐plasmid, as standard plasmids, contained the sequences of ORF1ab and NP, respectively. The plasmids (ORF1ab‐ and NP‐plasmids) were commercially constructed by Tianyi‐Huiyuan Biotech Co., Ltd., and its initial concentrations were 1.1 × 105 copies/µl. Then, ORF1ab‐ and NP‐plasmid were mixed in equal volumes, and a serial dilution was prepared (1.1 × 105 copies/µl, 2.1 × 104 copies/µl, 4.3 × 103 copies/µl, 8.5 × 102 copies/µl, 1.7 × 102 copies/µl, 3.4 × 101 copies/µl, 6.8 copies/µl, and 1.4 copies/µl), after the mixture was serially diluted (5‐fold ratio). The serial dilutions of plasmids (1.1 × 105 to 1.4 copies/µl) were amplified to confirm the limit of detection (LoD) of COVID‐19 rRT‐MCDA assay. The LoD of the COVID‐19 rRT‐MCDA assay was defined as the lowest concentration of serial dilutions of the standard plasmid that could be detected in ≥95% of the tests performed in the study (usually more than 20 tests). 16 , 17
2.5. Detection specificity of the COVID‐19 rRT‐MCDA assay
To confirm the detection specificity of the COVID‐19 rRT‐MCDA assay, genomic templates of various pathogens, including 8 viruses and 12 bacteria species, were tested (Table 1). All examinations were conducted at least three times.
2.6. Evaluation of detection applicability for COVID‐19 rRT‐MCDA to clinical samples
A total of 43 clinical samples, including oropharynx swab, throat swab, stool specimens, and sputum specimens, were collected from COVID‐19 patients (containing acute and convalescent phases). Meanwhile, 77 samples of throat swab were obtained from non‐COVID‐19 patients. Then, virus sample tubes, containing universal virus transport medium (UVIM) (HiDNA; YIMi Biotech), were used for temporary storage of the collected samples, and they were transported to the Guizhou Provincial Center for Disease Control and Prevention. The RNA templates of the clinical samples were prepared by using RNA extraction kits and specified Tianlong NP968‐C nucleic acid extractor. Briefly, 200 μl of UVIM medium was added to the extraction tube, and then the tube was placed in the specified extractor for RNA preparation. Subsequently, the COVID‐19 rRT‐MCDA and RT‐qPCR (7500 fast, Applied Biosystems) assays were performed to detect the RNA templates prepared above (5 µl per reaction), respectively. In this report, RT‐qPCR method was implemented according to the conventional instructions of the real‐time RT‐PCR kit (DaAn Gene Co., Ltd. of Sun Yat‐Sen University, Guangzhou, China), and the reaction mixtures (25 µl) included 17 µl PCR solution A, 3 µl PCR solution B, and 5 µl RNA templates of the clinical sample. All experiments (namely, COVID‐19 rRT‐MCDA and RT‐qPCR tests) were performed at the Infectious Disease Laboratory of the Experimental Center of the Guizhou Provincial Center for Disease Control and Prevention.
2.7. Schematic mechanism of the COVID‐19 rRT‐MCDA assay
In the COVID‐19 rRT‐MCDA system, the RNA strands of SARS‐COV‐2 were converted into cDNA using AMV reverse transcriptase. Then, the cDNA strands as templates were amplified in the follow‐up reaction. When double strands were synthesized, the short sequences (5′‐GCAATGNN‐3′, N = A, G, C, and T) were recognized by the Nb. BsrDI enzyme, and then the specific sequences (5′‐GCAATG‐3′) was cleaved. In addition, to protect the recognition site, an additional base (T) was added at the 5′ end of the D1 primer sequences (namely, 5′‐TGCAATGNN‐3′, N = A, G, C, and T). Thus, the D1* primers played two roles in this report, including one as an amplification primer and the other as a specific probe. Briefly, two core primers (D1) in this study were constructed according to the above‐mentioned principle by adding a specific sequence (5′‐GCAATG‐3′) and an additional base (T) to the 5′ end of the conventional D1 primer. The D1 primers constructed in the previous steps were labeled FAM or CY5 at the 5′ end, and they were designed with the dark quenchers (BHQ1/BHQ2) behind the short sequence (5′‐GCAATGNN‐3′, N = A, G, C, and T). Finally, the ORF‐ and N‐D1* primers in the experiments were successfully obtained according to the improvement strategies. As a result, after the short sequence was recognized and cleaved by Nb. BsrDI enzyme, the fluorescein groups (FAM or CY5) and the dark quenchers (BHQ1 or BHQ2) were separated, and a real‐time fluorescent quantitative PCR detector was implemented to capture the fluorescent signals to realize the detection of SARS‐CoV‐2. The schematic reaction mechanism of COVID‐19 rRT‐MCDA assay was shown in Figure 2.
Figure 2.

The schematic reaction mechanism of rRT‐MCDA assay. Nine steps in this schematic: Steps 1–2, the RNA templates were converted to cDNA by AMV reverse transcriptase. Steps 3–5, the cDNA strands as templates were amplified in the reaction system. Steps 6, the short sequences were recognized and cleaved by the Nb. BsrDI enzyme. Steps 7–9, After the fluorescein groups (FAM/CY5) and the dark quenchers (BHQ1/BHQ2) were separated, this fluorescent signal was collected by a real‐time fluorescence detector. rRT‐MCDA, restriction endonuclease‐mediated reverse transcription multiple cross displacement amplification assay combined with real‐time fluorescence analysis.
3. RESULTS
3.1. Validation of rRT‐MCDA amplifications for ORF1ab and NP
To confirm the feasibility of the COVID‐19 rRT‐MCDA assay, standard plasmids (containing both the ORF1ab‐ and NP‐plasmids) at concentrations of 2.1 × 104 and 4.3 × 103 copies/μl were used as positive controls (PC), and the nucleic acid of H7N9 virus and double distilled water (DW) were tested as negative control (NC) and blank control (BC), respectively. Subsequently, the amplicons of COVID‐19 rRT‐MCDA assay were monitored by real‐time fluorescent quantitative PCR detector (Figure 3, A1 and B1), real‐time turbidimeter (LA‐500) (Figure 3, A2 and B2), and 1.5% agarose gel electrophoresis methods (Figure 3, A3 and B3). The results shown that only the standard plasmids were detected as positive amplifications, the NC and DW were tested as negative amplifications (no amplifications kinetic curves and characteristic amplification bands).
Figure 3.

Confirmation test of rRT‐MCDA amplification for ORF1ab and NP genes. ORF1ab‐plasmid (2.1 × 104 copies/µl) and NP‐plasmid (4.3 × 103 copies/µl) were amplified by ORF1ab‐ and NP‐rRT‐MCDA, respectively, and the amplicons were validated using real‐time fluorescence detector (A1 and B1), real‐time turbidimeter (A2 and B2), and 1.5% agarose gel electrophoresis (A3 and B3). PC1 and PC2 were standard plasmid templates at concentrations of 2.1 × 104 copies and 4.3 × 103 copies, respectively. The RNA template of H7N9 virus was the negative control (NC), and the double distilled water (DW) was the blank control. M: 100 bp DNA Ladder. rRT‐MCDA, restriction endonuclease‐mediated reverse transcription multiple cross displacement amplification assay combined with real‐time fluorescence analysis.
3.2. Optimal reaction temperature of COVID‐19 rRT‐MCDA assay
To obtain the optimal amplification temperature, the standard plasmids (2.1 × 104 copies/μl) were detected by the ORF1ab‐ and NP‐rRT‐MCDA assays at the different reaction temperatures (range from 61 to 68℃, with 1℃ intervals), and the amplification products were monitored using real‐time turbidimeter (LA‐500). The results showed that the optimum amplification temperature of the ORF1ab‐rRT‐MCDA assay was 64℃ in eight kinetic curves (Figure 4A). Meanwhile, the amplification efficiency of NP‐rRT‐MCDA assay was relatively higher at the amplification temperature of 66℃ according to the kinetic curves in the other group (Figure 4B).
Figure 4.

Optimization of reaction temperature for COVID‐19 rRT‐MCDA primers. The COVID‐19 rRT‐MCDA assays were monitored by real‐time turbidimeter, and the corresponding information were marked in the drawings. This threshold value was 0.1, and a turbidity >0.1 was judged as positive amplification. A total of eight kinetic carves (CH1‐CH8) were generated at different temperatures (61°C–68°C, 1°C intervals). The diagrams (A and B) showed that the ORF1ab and NP genes were amplified, respectively. COVID‐19, coronavirus disease 2019; rRT‐MCDA, restriction endonuclease‐mediated reverse transcription multiple cross displacement amplification assay combined with real‐time fluorescence analysis.
3.3. Analytical sensitivity of COVID‐19 rRT‐MCDA assay
The ORF1ab‐ and NP‐plasmid templates were serially diluted (1.1 × 105 copies/µl, 2.1 × 104 copies/µl, 4.3 × 103 copies/µl, 8.5 × 102 copies/µl, 1.7 × 102 copies/µl, 3.4 × 101 copies/µl, 6.8 copies/µl, and 1.4 copies/µl) for the sensitivity analysis of the COVID‐19 rRT‐MCDA, and the reaction condition was 65℃ for 36 min. The limit of detection (LoD) of COVID‐19 rRT‐MCDA test was evaluated by detecting the serial diluents, respectively. The results showed that the LoD of COVID‐19 rRT‐MCDA assay was 6.8 copies/µl (Figure 5, A1 and B1). Furthermore, the linearity relationship between ORF1ab and NP genes was plotted according to the average CT value of positive reactions against serial dilutions of the template, respectively (Figure 5, A2 and B2).
Figure 5.

The analytical sensitivity of COVID‐19 rRT‐MCDA assay. (A1 and B1) The rRT‐MCDA tests were carried out according to the optimal amplification temperature and time, and the serial dilutions (1.1 × 105 copies, 2.1 × 104 copies, 4.3 × 103 copies, 8.5 × 102 copies, 1.7 × 102 copies, 3.4 × 101 copies, 6.8 copies, and 1.4 copies per microliter) of RNA templates were tested. Curves a–h correspond to RNA templates of plasmids from 1.1 × 105 copies/μl to 1.4 copies/μl; Curve i: blank control. (A2 and B2) The CT was plotted against the templates (ORF1ab or NP) concentration of the positive reactions. The ordinate is PCR cycle number at threshold and the abscissa is number of ORF1ab or NP templates(log10). COVID‐19, coronavirus disease 2019; rRT‐MCDA, restriction endonuclease‐mediated reverse transcription multiple cross displacement amplification assay combined with real‐time fluorescence analysis.
3.4. Specificity of the COVID‐19 E‐rRT‐MCDA assay
The specificity of COVID‐19 rRT‐MCDA method was tested by detecting other nucleic acid templates, including 8 non‐COVID‐19 viruses and 12 bacteria (Table 2). The standard plasmid templates (4.3 × 103 copies/µl) and DW were considered as positive control and blank control, respectively. The test results showed that the detection specificity of the COVID‐19 rRT‐MCDA method was 100%, and there was no cross‐reaction with nucleic acids from other non‐COVID‐19 pathogens (Figure 6). Hence, these results confirmed that the COVID‐19 rRT‐MCDA method can accurately detect the nucleic acid of SARS‐CoV‐2 and exclude other pathogens.
Table 2.
The detail of strains for the specificity testing
| Source of genomic templates | Source of strainsa | No. of strains | rRT‐MCDA results |
|---|---|---|---|
| Virus species | |||
| SARS‐CoV‐2 | Standard plasmids | / | P |
| HKU 1 | Isolate strains (GZCDC) | 1 | N |
| HIV | Isolate strains (GZCDC) | 2 | N |
| H9N2 | Isolate strains (GZCDC) | 2 | N |
| H7N9 | Isolate strains (GZCDC) | 2 | N |
| H5N1 | Isolate strains (GZCDC) | 1 | N |
| H3N2 | Isolate strains (GZCDC) | 2 | N |
| H1N1 | Isolate strains (GZCDC) | 1 | N |
| HBV | Isolate strains (GZCDC) | 3 | N |
| Bacteria species | |||
| Sh. dysenteriae | Isolate strains (GZCDC) | 1 | N |
| M. tuberculosis | H37RvATCC27294 | 1 | N |
| Bacillus anthracis | Isolate strains (GZCDC) | 1 | N |
| Nontyphoidal Salmonella | Isolate strains (GZCDC) | 1 | N |
| Klebsiella pneumoniae | Isolate strains (GZCDC) | 1 | N |
| Pseudomonas aeruginosa | Isolate strains (GZCDC) | 1 | N |
| Staphylococcus aureus | Isolate strains (GZCDC) | 1 | N |
| Streptococcus pneumoniae | Isolate strains (GZCDC) | 1 | N |
| Streptococcus suis | Isolate strains (GZCDC) | 1 | N |
| Haemophilus influenzae | Isolate strains (GZCDC) | 1 | N |
| Brucella melitensis | Vaccine strains (GZCDC) | 1 | N |
| Neisseria gonorrhoeae | Isolate strains (GZCDC) | 1 | N |
Abbreviation: rRT‐MCDA, restriction endonuclease‐mediated reverse transcription multiple cross displacement amplification assay combined with real‐time fluorescence analysis.
GZCDC, Guizhou Provincial Center for Disease Control and Prevention.
Figure 6.

The detection specificity of COVID‐19 rRT‐MCDA assay. A1 and A2 were the detection of the ORF1ab gene, and B1 and B2 were the detection of the the NP gene. The PC was a positive control (ORF1ab‐plasmid and NP‐plasmid) at the level of 4.3 × 103 copies/μl. A1 and B1: the virus species including HKU, HIV, H9N2, H7N9, H5N1, H3N2, H1N1, and HBV were detected by COVID‐19 rRT‐MCDA. A2 and B2: the bacteria species, including Sh. dysenteriae, M. tuberculosis, Bacillus anthracis, Nontyphoidal Salmonella, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus suis, Haemophilus influenzae, Brucella melitensis, and Neisseria gonorrhoeae, were detected by COVID‐19 rRT‐MCDA. COVID‐19, coronavirus disease 2019; rRT‐MCDA, restriction endonuclease‐mediated reverse transcription multiple cross displacement amplification assay combined with real‐time fluorescence analysis.
3.5. Evaluation of the COVID‐19 rRT‐MCDA assay
To further evaluate the feasibility of the COVID‐19 rRT‐MCDA, which serves as a useful stool for the detection of SARS‐CoV‐2 in clinical application, a total of 120 clinical samples were collected from different regions in Guizhou Province, including 43 samples (containing oropharynx swab, throat swab, stool specimens, and sputum specimens) from acute phase and recovery period of COVID‐19 patients and 77 pharyngeal samples from non‐COVID‐19 patients (Table S1 and Table S2). Then, all samples were simultaneously tested by using rRT‐qPCR and COVID‐19 rRT‐MCDA assays (Table 3). For 43 specimens collected from COVID‐19 patients, 28 specimens were tested as positive for ORF1ab gene (65.12%, 28/43), and 25 specimens were positive for NP gene (58.14%, 25/43) by conducting the rRT‐qPCR assay; 38 (88.37%, 38/43) were detected as positive for ORF1ab gene and 32 samples (74.42%, 32/43) were positive for NP gene by COVID‐19 rRT‐MCDA assay. Seventy‐seven specimens collected from non‐COVID‐19 patients were tested as negative amplification (100%, 77/77) by rRT‐qPCR and COVID‐19 rRT‐MCDA assays, respectively. As a result, the COVID‐19 rRT‐MCDA test established in this report was more sensitive than the conventional rRT‐qPCR method for detection of SARS‐CoV‐2 in clinical specimens.
Table 3.
The detail of clinical specimens testing
| Clinical samples | ||||||
|---|---|---|---|---|---|---|
| Methodsa | COVID‐19 patients (N = 43) | Non‐COVID‐19 patients (N = 77) | Sensitivity (%) | Specificity (%) | PPVb (%) | NPVc (%) |
| RT‐PCR | ||||||
| ORF1ab‐positive | 28 | 0 | 65.12 | 100 | 100 | 83.70 |
| ORF1ab‐negative | 15 | 77 | ||||
| NP‐positive | 25 | 0 | 58.14 | 100 | 100 | 81.05 |
| NP‐negative | 18 | 77 | ||||
| rRT‐MCDA | ||||||
| ORF1ab‐positive | 38 | 0 | 88.37 | 100 | 100 | 93.90 |
| ORF1ab‐negative | 5 | 77 | ||||
| NP‐positive | 32 | 0 | 74.42 | 100 | 100 | 87.50 |
| NP‐negative | 11 | 77 | ||||
PCR, polymerase chain reaction; MCDA, multiple cross displacement amplification.
PPV, Positive predictive value; PPV = (true positive/true positive + false positive) × 100.
NPV, Negative predictive value; NPV = (true negative/true negative + false negative) × 100.
4. DISCUSSION
So far, COVID‐19, a global public health problem, still continues to spread widely around the world, and it posed a serious challenge to people's health and daily life. Thus, the establishment of an applicable and improved method to detect the SARS‐CoV‐2 is of importance for the prevention and treatment of COVID‐19. In past studies, molecular detection methods like PCR and PCR‐based techniques (including multiplex PCR, real‐time PCR, and rRT‐LAMP assays) were proven to detect various pathogens (e.g., SARS‐CoV‐2 virus and influenza viruses). 1 , 5 , 18 , 19 Undoubtedly, these techniques, including conventional PCR, real‐time PCR, or LAMP assays, own certain analytical capabilities, but they are limited by low sensitivity and/or complicated verification steps of amplicons. 20 , 21 The RPA technique, as a rapid and easy‐to‐perform assay similar to PCR, has been developed for detecting SARS‐CoV‐2 virus, however, it increased the cost of detection and the instability of detection due to its dependence on multiple reaction enzymes (e.g., recombinase, polymerase, and single‐strand DNA binding protein). 22 Up to now, the conventional rRT‐qPCR detection method played a key role in the diagnosis of COVID‐19, especially in the stage of widespread transmission of SARS‐CoV‐2 virus. 1 , 6 Although the rRT‐PCR assay is a standard method for nucleic acid detection, most of the commercial kit with the LoD approximate from 500 copies/ml to 1000 copies/ml. 8 However, these COVID‐19 patients, who are asymptomatic infections or have a low viral load, are usually more challenging to diagnose accurately by rRT‐qPCR test. Hence, the development of an ultrasensitive, ultrafast and highly specific detection method could provide a complementary tool for the examination of SARS‐CoV‐2 in clinical application.
The MCDA technique, an ultrafast, ultrasensitive, and highly reliable nucleic acid detection method, were successfully developed and applied in the detection of many pathogens (e.g., bacteria, viruses, and emerging/re‐emerging infectious agents). 9 , 10 Currently, visualization reagents and agarose gel electrophoresis were the major verification methods for MCDA amplification products, but these methods, including real‐time turbidimeters and emerging LFB biosensors, owned certain shortcomings (including poor specificity and/or open‐tube detection). Presently, the endonuclease restriction (e.g., Nb. BsrDI) mediated methods were applied successfully for the detection of various pathogens, including Salmonella (invA gene), Shigella (ipaH gene), and Listeria monocytogenes (lmo0733 gene). 23 , 24 , 25
To overcome the drawbacks mentioned above, the optimization strategy of MCDA test (combining reverse transcription, Nb. BsrDI enzyme, MCDA technique, and real‐time fluorescence detector) was performed to achieve the rapid closed‐tube examination and improve the detection efficiency. One set of MCDA primers targeting ORF1ab and NP genes (containing F1, F2, C1, C2, CP1, CP2, D1, D2, R1, and R2) were screened from multiple sets of reaction primers designed in this study. Particularly, the core primers (D1*) were constructed in this report by adding a short sequence (5′‐GCAATGNN‐3′, N = A, G, C, and T) and a protective base (T) to the 5′ end of the conventional D1 primer according to the function mechanism of the Nb. BsrDI enzyme, and then the 5′ and 3′ ends of the unique sequence (5′‐TGCAATGNN‐3′, N = A, G, C, and T) were specifically modified by the fluorescent groups (FAM or CY5) and dark quenchers (BHQ1 or BHQ2), respectively. Thus, a novel, ultrafast, ultrasensitive nucleic acid amplification method targeting ORF1ab and NP genes for detection of the SARS‐CoV‐2 virus (COVID‐19 rRT‐MCDA) was developed and performed successfully in clinical applications.
To date, there are many variants of SARS‐CoV‐2 (including Alpha, Beta, Gamma, Delta, Lambda, and Omicron), 26 and the variant strains mutation mainly occurred in the S1 and S2 genes. 27 , 28 However, the open reading frame (ORF) 1ab gene belongs to the nonstructural protein 3 (NSP3) coding region, with a highly conserved. 29 Additionally, the NP gene is regulation of the nucleocapsid (NP) protein expression which shares substantial sequence conservation, and is rarely mutation. 30 , 31 Thus, many diagnostic methods targeting the ORF1ab and NP genes have been successfully established and applied to detect SARS‐CoV‐2 pathogens, like conventional real‐time PCR assay. 8 , 14 , 32
From the results of the reaction condition, we found that the temperatures range from 62°C to 66°C for ORF1ab sequence have high efficiency, and 64°C is the highest (Figure 4A). The NP gene at 65°C–67°C had good efficiency, and 66°C was the highest (Figure 4B). In addition, after 36 min the real‐time turbidity were almost no increasing. Generally, to achieve efficient and simultaneous amplification in experiments, we selected that the optimal reaction condition for ORF1ab and NP genes was 65°C for 36 min. Besides, the analysis results of real‐time fluorescence and real‐time turbidity of rRT‐MCDA products showed that the amplification efficiency of ORF1ab gene was higher than that of NP gene, which may be the reason that the ORF1ab‐test method has higher detection sensitivity for the detection of clinical specimens than NP‐test method. Meanwhile, the conventional rRT‐qPCR detection method (novel coronavirus 2019‐nCoV nucleic acid detection kit) also showed a similar amplification trend in our laboratory diagnosis. Moreover, we also tried to amplify the ORF1ab and NP genes simultaneously in a single rRT‐MCDA reaction, while, this strategy was difficult to achieve, probably due to the competitive amplification of different primer sets. In the single‐tube reaction, the NP gene's fluorescence signal (CY5) was weaker than that of the ORF1ab gene (FAM); thus, we had to perform the single rRT‐MCDA reaction separately (namely, ORF1ab‐ and NP‐rRT‐MCDA).
In this report, the COVID‐19 rRT‐MCDA method demonstrated outstanding analytical sensitivity, with the limit of detection of 6.8 copies per reaction (about 272 copies/ml) for the standard plasmids was more sensitive than conventional rRT‐qPCR assay (about 500–1000 copies/ml). 8 Then, the positive CT values were plotted against the template concentration of the reactions, which provide a reference to the rRT‐MCDA detection (Figure 5, A2 and B2). Moreover, other validation methods, including agarose gel electrophoresis and real‐time turbidity, can also be implemented for the validation of MCDA amplification products, which further confirm the reliability and applicability of real‐time fluorescence analysis (data not shown). In a follow‐up study, we also found that the detection results of the COVID‐19 rRT‐MCDA test were difficult to distinguish between positive and negative amplification by using the MG visual indicator (data not shown), and the phenomenon may be caused by the addition of endonuclease restriction and/or fluorescence groups (FAM and/or CY5) in the reaction system. In this study, the detection specificity of the COVID‐19 rRT‐MCDA was 100%, and it was able to accurately identify standard plasmids (ORF1ab and NP) and exclude other pathogenic nucleic acids (including 8 strains of viruses and 12 strains of bacteria).
The current study, to evaluate the utility of COVID‐19 rRT‐MCDA, various samples were collected from COVID‐19 patients, and non‐COVID‐19 patients were tested by extracting their RNA templates. Thirty‐eight (88.37%) and 32 samples (74.42%) were detected as ORF1ab‐positive and NP‐positive by COVID‐19 rRT‐MCDA, while 28 (65.12%) and 25 samples (58.14%) were tested as ORF1ab‐positive and NP‐positive by rRT‐qPCR assay, respectively. Furthermore, we found that a CT value within 28 was positive reaction for ORF gene, while a CT value within 26 was positive amplification for NP gene (Figure 5, A2 and B2). Almost the positive CT values of the samples, which detected by the rRT‐MCDA were within the linear (Table S1). Moreover, compare with rRT‐qPCR (CT value <40 was the positive), 10 extra positive samples were detected by the rRT‐MCDA (ORF1ab CT value <28, NP CT value <26), which consisted of 8 ORF1ab single positive and 2 double targets positive (Table S1). Besides, the coefficient of variation (C.V) of the both methods was calculated according the standard deviation (SD) and the mean (MN) of the CT value individually. The rRT‐qPCR results indicated that, the C.V of the ORF detection was 12.34% (3.94/31.92), the NP detection was 9.23% (2.90/31.43). While the rRT‐MCDA showed that, the C.V of the ORF detection was 17.98% (4.22/23.47), the NP detection was 14.22% (3.27/22.99). In short, these data indicated that the sensitivity of the COVID‐19 rRT‐MCDA method for the detection of clinical specimens was higher than that of the rRT‐PCR assay, and it is suitable for the detection of SARS‐CoV‐2 in clinical applications.
To further evaluate the practical applicability, the cost of rRT‐MCDA reaction was taken in consideration. Notably, the cost of the single reaction (approximately USD 4.0), including MCDA amplification reagents (approximately 1.5 USD), AMV enzyme (approximately 1.0 USD), and other reagents/materials (approximately 1.5 USD), is lower than that of the MCDA‐LFB assay (approximately USD 6.5). Moreover, the COVID‐19 rRT‐MCDA assay has the capability of closed‐tube detection, which can reduce aerosol contamination in the laboratory compared with similar MCDA‐LFB or CRISPR‐MCDA assays, making it suitable for basic laboratories with real‐time fluorescence readouts. Meanwhile, the whole detection process of COVID‐19 rRT‐MCDA, containing the RNA template processing (15 min) and real‐time amplification (36 min), can be accomplished within 1 h. Compared with rRT‐qPCR tests (usually approximately 1.5 h), COVID‐19 rRT‐MCDA technique greatly shorted the detection time. As a result, the COVID‐19 rRT‐MCDA assay developed in the current study is an ultrafast, ultrasensitive, low‐cost, and easy‐to‐use detection method, which can be used as a valuable detection tool for timely diagnosis of COVID‐19.
5. CONCLUSION
Finally, a novel, ultrafast, ultrasensitive nucleic acid amplification method targeting ORF1ab and NP genes for detection of the SARS‐CoV‐2 virus (COVID‐19 rRT‐MCDA) was developed and performed successfully in clinical applications. As a result, the COVID‐19 rRT‐MCDA exhibited excellent sensitivity and specificity for various pathogens and clinical specimens, and can be used as an effective tool for the detection of SARS‐CoV‐2 in clinical application, especially for the diagnosis of patients with low viral load. Taken together, the COVID‐19 rRT‐MCDA assay developed in the current study is an ultrafast, ultrasensitive, low‐cost, and easy‐to‐use detection method, which can be used as a valuable detection tool for timely diagnosis of COVID‐19.
AUTHOR CONTRIBUTIONS
Junfei Huang and Shijun Li conceived and designed this study. Shijun Li supervised the study. Junfei Huang, Shijun Li, Lijuan Ren, Xinggui Yang, Weijia Jiang, Yan Huang, Ying Liu, Chunting Liu, and Xu Chen conducted the experiments. Junfei Huang, Shijun Li, Lijuan Ren, and Xinggui Yang analyze the data. Shijun Li, Junfei Huang, Ying Liu, Yan Huang, Chunting Liu, and Xu Chen contributed the reagents and analysis tools. Shijun Li, Junfei Huang, Lijuan Ren, Weijia Jiang, and Yan Huang contributed the materials. Junfei Huang performed the software. Junfei Huang drafted the manuscript. Shijun Li revised the manuscript.
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interest.
ETHICS STATEMENT
This project was reviewed and approved by Ethics Committee of the Guizhou Provincial Center for Disease Control and Prevention (No. of certification: S2020‐01).
Supporting information
Supplementary information.
ACKNOWLEDGMENTS
This work was supported by the Department of Science and Technology of Guizhou Province (Grant No. Qian Ke He Support Plan [2020]‐4Y182, Qian Ke He Support Plan [2020] 4Y184, Qian Ke He Platform talent [2018]‐5606, Qian Ke He [2016]‐4021, Qian Ke He Support Plan [2021] General 027) and by the Scientific and Technological in Guiyang City (Grant No. Zhu Ke He (2020)‐10‐5).
Huang J, Yang X, Ren L, et al. A novel, ultrafast, ultrasensitive diagnosis platform for the detection of SARS‐COV‐2 using restriction endonuclease‐mediated reverse transcription multiple cross displacement amplification. J Med Virol. 2023;95:e28444. 10.1002/jmv.28444
Junfei Huang and Xinggui Yang contributed equally to this work.
Contributor Information
Xu Chen, Email: xuchen1220@126.com.
Shijun Li, Email: zjumedjun@163.com.
DATA AVAILABILITY STATEMENT
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors. The raw sequence data reported in this paper came from GenBank, accession no. MN908947, Wuhan‐Hu‐1 (https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3/).
REFERENCES
- 1. Huang C, Wang Y, Li X, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497‐506. 10.1016/S0140-6736(20)30183-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Zhu N, Zhang D, Wang W, et al. A novel coronavirus from patients with pneumonia in China, 2019. N Engl J Med. 2020;382(8):727‐733. 10.1056/NEJMoa2001017 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. World Health Organization . WHO Coronavirus (COVID‐19) Dashboard. https://covid19.who.int/
- 4. Kawasuji H, Takegoshi Y, Kaneda M, et al. Transmissibility of COVID‐19 depends on the viral load around onset in adult and symptomatic patients. PLoS One. 2020;15(12):e0243597. 10.1371/journal.pone.0243597 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Lamb LE, Bartolone SN, Ward E, Chancellor MB. Rapid detection of novel coronavirus/severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) by reverse transcription‐loop‐mediated isothermal amplification. PLoS One. 2020;15(6):e0234682. 10.1371/journal.pone.0234682 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Lu R, Zhao X, Li J, et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020;395(10224):565‐574. 10.1016/S0140-6736(20)30251-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Wu Z, McGoogan JM. Characteristics of and important lessons from the coronavirus disease 2019 (COVID‐19) outbreak in China: summary of a report of 72 314 cases from the Chinese center for disease control and prevention. JAMA. 2020;323(13):1239‐1242. 10.1001/jama.2020.2648 [DOI] [PubMed] [Google Scholar]
- 8. Wang X, Yao H, Xu X, et al. Limits of detection of 6 approved RT‐PCR kits for the novel SARS‐Coronavirus‐2 (SARS‐CoV‐2). Clin Chem. 2020;66(7):977‐979. 10.1093/clinchem/hvaa099 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Wang Y, Wang Y, Ma AJ, et al. Rapid and sensitive isothermal detection of nucleic‐acid sequence by multiple cross displacement amplification. Sci Rep. 2015;5:11902. 10.1038/srep11902 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Wang Y, Wang Y, Zhang L, Xu J, Ye C. Visual and multiplex detection of nucleic acid sequence by multiple cross displacement amplification coupled with gold nanoparticle‐based lateral flow biosensor. Sens Actuators, B. 2017;241:1283‐1293. 10.1016/j.snb.2016.10.001 [DOI] [Google Scholar]
- 11. Wang Y, Li H, Wang Y, et al. Development of multiple cross displacement amplification label‐based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes . Int J Nanomedicine. 2017;12:473‐486. 10.2147/IJN.S123625 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Li S, Liu C, Liu Y, Ma Q, Wang Y, Wang Y. Development of a multiple cross displacement amplification combined with nanoparticles‐based biosensor assay to detect Neisseria meningitidis . Infect Drug Resist. 2019;12:2077‐2087. 10.2147/IDR.S210735 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Li S, Liu Y, Wang Y, Wang M, Liu C, Wang Y. Rapid detection of Brucella spp. and elimination of carryover using multiple cross displacement amplification coupled with nanoparticles‐based lateral flow biosensor. Front Cell Infect Microbiol. 2019;9:78. 10.3389/fcimb.2019.00078 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Li S, Jiang W, Huang J, et al. Highly sensitive and specific diagnosis of COVID‐19 by reverse transcription multiple cross‐displacement amplification‐labelled nanoparticles biosensor. Eur Respir J. 2020;56(6):2002060. 10.1183/13993003.02060-2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Lu R, Wu X, Wan Z, Li Y, Jin X, Zhang C. A novel reverse transcription loop‐mediated isothermal amplification method for rapid detection of SARS‐CoV‐2. Int J Mol Sci. 2020;21(8):2826. 10.3390/ijms21082826 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Schwarz NG, Loderstaedt U, Hahn A, et al. Microbiological laboratory diagnostics of neglected zoonotic diseases (NZDs). Acta Trop. 2017;165:40‐65. 10.1016/j.actatropica.2015.09.003 [DOI] [PubMed] [Google Scholar]
- 17. Yang X, Huang J, Chen X, et al. Rapid and visual differentiation of Mycobacterium tuberculosis from the Mycobacterium tuberculosis complex using multiplex loop‐mediated isothermal amplification coupled with a nanoparticle‐based lateral flow biosensor. Front Microbiol. 2021;12:708658. 10.3389/fmicb.2021.708658 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Broor S, Chahar HS, Kaushik S. Diagnosis of influenza viruses with special reference to novel H1N1 2009 influenza virus. Indian J Microbiol. 2009;49(4):301‐307. 10.1007/s12088-009-0054-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Sharma V, Chaudhry D, Kaushik S. Evaluation of clinical applicability of reverse transcription‐loop‐mediated isothermal amplification assay for detection and subtyping of Influenza A viruses. J Virol Methods. 2018;253:18‐25. 10.1016/j.jviromet.2017.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Dhakad S, Mali P, Kaushik S, Lal A, Broor S. Comparison of multiplex RT‐PCR with virus isolation for detection, typing and sub‐typing of influenza virus from influenza‐like illness cases. Indian J Med Microbiol. 2015;33(1):73‐77. 10.4103/0255-0857.148383 [DOI] [PubMed] [Google Scholar]
- 21. Kumar R, Nagpal S, Kaushik S, Mendiratta S. COVID‐19 diagnostic approaches: different roads to the same destination. Virusdisease. 2020;31(2):97‐105. 10.1007/s13337-020-00599-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Kim Y, Yaseen AB, Kishi JY, et al. Single‐strand RPA for rapid and sensitive detection of SARS‐CoV‐2 RNA. Preprint. medRxiv. 2020. 10.1101/2020.08.17.20177006 [DOI]
- 23. Wang Y, Wang Y, Lan R, et al. Multiple endonuclease restriction real‐time loop‐mediated isothermal amplification: a novel analytically rapid, sensitive, multiplex loop‐mediated isothermal amplification detection technique.J Mol Diagn. 2015;17(4):392‐401. 10.1016/j.jmoldx.2015.03.002 [DOI] [PubMed] [Google Scholar]
- 24. Wang Y, Wang Y, Zhang L, et al. Multiplex, rapid, and sensitive isothermal detection of nucleic‐acid sequence by endonuclease restriction‐mediated real‐time multiple cross displacement amplification. Front Microbiol. 2016;7:753. 10.3389/fmicb.2016.00753 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Wang Y, Wang Y, Zhang L, et al. Endonuclease restriction‐mediated real‐time polymerase chain reaction: a novel technique for rapid, snsitive and quantitative detection of nucleic‐acid sequence. Front Microbiol. 2016;7:1104. 10.3389/fmicb.2016.01104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Centers for Disease Control and Prevention SARS‐CoV‐2 variant classifications and definitions. https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-classifications.html
- 27. He X, Hong W, Pan X, Lu G, Wei X. SARS‐CoV‐2 omicron variant: characteristics and prevention. MedComm (2020). 2021;2(4):838‐845. 10.1002/mco2.110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Lino A, Cardoso MA, Martins‐Lopes P, Gonçalves HMR. Omicron ‐ The new SARS‐CoV‐2 challenge?. Rev Med Virol. 2022;32(4):e2358. 10.1002/rmv.2358 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Robson B. The use of knowledge management tools in viroinformatics. Example study of a highly conserved sequence motif in Nsp3 of SARS‐CoV‐2 as a therapeutic target. Comput Biol Med. 2020;125:103963. 10.1016/j.compbiomed.2020.103963 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Cubuk J, Alston JJ, Incicco JJ, et al. The SARS‐CoV‐2 nucleocapsid protein is dynamic, disordered, and phase separates with RNA. Nat Commun. 2021;12(1):1936. 10.1038/s41467-021-21953-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Lesbon JCC, Poleti MD, de Mattos Oliveira EC, et al. Nucleocapsid (N) gene mutations of SARS‐CoV‐2 can affect real‐tTime RT‐PCR diagnostic and impact false‐negative results. Viruses. 2021;13(12):2474. 10.3390/v13122474 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Wang Y, Wang X, Chen H, et al. A novel real‐time reverse transcription loop‐mediated isothermal amplification detection platform: application to diagnosis of COVID‐19. Front Bioeng Biotechnol. 2021;9:748746. 10.3389/fbioe.2021.748746. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary information.
Data Availability Statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors. The raw sequence data reported in this paper came from GenBank, accession no. MN908947, Wuhan‐Hu‐1 (https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3/).
