Skip to main content
Veterinary World logoLink to Veterinary World
. 2022 Dec 8;15(12):2800–2809. doi: 10.14202/vetworld.2022.2800-2809

Phylogenetic analysis and antibiotic resistance of Escherichia coli isolated from wild and domestic animals at an agricultural land interface area of Salaphra wildlife sanctuary, Thailand

Taksaon Duangurai 1, Amporn Rungruengkitkul 2, Thida Kong-Ngoen 2, Witawat Tunyong 2, Nathamon Kosoltanapiwat 2, Poom Adisakwattana 3, Muthita Vanaporn 2, Nitaya Indrawattana 2, Pornpan Pumirat 2,
PMCID: PMC9880845  PMID: 36718336

Abstract

Background and Aim:

Domestic and wild animals are important reservoirs for antibiotic-resistant bacteria. This study aimed to isolate Escherichia coli from feces of domestic and wild animals at an agricultural land interface area of Salaphra Wildlife Sanctuary, Thailand, and study the phylogenic characteristics and antibiotic resistance in these isolates.

Materials and Methods:

In this cross-sectional, descriptive study, we randomly collected ground feces from free-ranging wild animals (deer and elephants) and domestic animals (cattle and goats). All fecal samples were inoculated onto MacConkey agar plates, and lactose-fermenting colonies were identified as E. coli. Antibiotic susceptibility of the E. coli isolates was determined using the disc diffusion method. Polymerase chain reaction assays were used to detect antibiotic resistance and virulence genes.

Results:

We obtained 362 E. coli isolates from the collected fecal samples. The E. coli isolates were categorized into four phylogenetic groups according to the virulence genes (chuA, vjaA, and TspE4C2). Phylogenetic Group D was predominant in the deer (41.67%) and elephants (63.29%), whereas phylogenetic Group B1 was predominant in the cattle (62.31%), and phylogenetic Groups A (36.36%) and B2 (33.33%) were predominant in the goats. Antibiotic susceptibility testing revealed that most antibiotic-resistant E. coli were isolated from domestic goats (96.96%). Among the 362 E. coli isolates, 38 (10.5%) were resistant to at least one antibiotic, 21 (5.8%) were resistant to two antibiotics, and 6 (1.66%) were resistant to three or more antibiotics. Ampicillin (AMP) was the most common antibiotic (48.48%) to which the E. coli were resistant, followed by tetracycline (TET) (45.45%) and trimethoprim-sulfamethoxazole (3.03%). One isolate from an elephant was resistant to five antibiotics: AMP, amoxicillin, sulfisoxazole, TET, and ciprofloxacin. Determination of antibiotic resistance genes confirmed that E. coli isolates carried antibiotic resistance genes associated with phenotypic resistance to antibiotics. Most antibiotic-resistant E. coli belonged to phylogenic Groups A and B1, and most non-resistant E. coli belonged to phylogenic Groups B2 and D.

Conclusion:

Monitoring E. coli isolates from wild and domestic animals showed that all four phylogenic groups of E. coli have developed antibiotic resistance and are potential sources of multidrug resistance. High levels of antibiotic resistance have been linked to domestic animals. Our results support strengthening surveillance to monitor the emergence and effects of antibiotic-resistant microorganisms in animals.

Keywords: antibiotic resistance, domestic animal, Escherichia coli, phylogenic groups, phylogeny, wild animal

Introduction

Issues continue to emerge regarding antibiotic-resistant bacteria [14]. Infections with antibiotic-resistant bacteria significantly affect public health worldwide and present a global health problem [5, 6]. Escherichia coli is an important reservoir of antibiotic resistance [79].

E. coli is a part of the normal intestinal flora that colonizes mammalian gastrointestinal tracts [10] and is divided into eight phylogenetic groups (i.e., A, B1, B2, C, D, E, F, and clade I) based on the presence or absence of virulence genes [11, 12]. Commensal E. coli strains typically belong to groups A or B1. Most pathogenic strains responsible for intestinal infections belong to Groups A, B1, and D, whereas extraintestinal E. coli belong to groups B2 or D [13, 14]. These phylogenetic groups differ in terms of antibiotic resistance patterns, virulence genes, use of sugars, and environmental characteristics [15]. Although the role of E. coli in providing a reservoir for antibiotic resistance has been acknowledged [16, 17], the link between antibiotic resistance and phylogenetic characteristics of this bacterium remain uncertain. Moreover, limited data exist regarding E. coli in wild and domestic animals in Thailand.

Therefore, we aimed to examine E. coli from fecal samples of domestic goats and cattle fed on farmland surrounding the Salakpra Wildlife Sanctuary, Kanchanaburi Province, in Western Thailand, and from wild elephants and deer that live in this sanctuary to determine the phylogenetic groups and antibiotic resistance.

Materials and Methods

Ethical approval

The studied animals underwent no direct interventions associated with pain, suffering, or damage during the experiment. Fecal samples were collected from the ground for bacterial cultures. Therefore, these examinations required no announcement or permission with regard to the animal protection law because no experimental measures inflicted pain, suffering, or damage to these animals.

Study period and location

The study was conducted from January to November 2013 at Salakpra Wildlife Sanctuary, Kanchanaburi Province, Thailand. Salakpra Wildlife Sanctuary is Thailand’s first wildlife sanctuary, located in the Western Forest Complex in Kanchanaburi Province. The area comprises mixed deciduous, dry dipterocarp, and dry evergreen forest and is home to Asian elephants (Elephas maximus), gaur (Bos gaurus), and sambar deer (Rusa unicolor).

Sample collection

In this cross-sectional, descriptive study, we collected 178 fecal samples from free-ranging wild and domestic animals around the Salakpra Wildlife Sanctuary. The 178 fecal samples were randomly collected from wild deer (n = 45), wild elephants (n = 55), domestic cattle (n = 62), and domestic goats (n = 16). Only fresh (moist) fecal samples were collected from the ground. A veterinary specialist identified the animal species by observing the fecal appearance and characteristics. The fecal material was sampled using sterile swabs, which were dipped in sterile Cary-Blair media (CM0519, Oxoid, Basingstoke, UK), kept in a cool box (0°C–4°C) and transferred to the laboratory at the Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand, within 24 h for E. coli identification.

Escherichia coli isolation and identification

The fecal samples were inoculated onto MacConkey agar plates and incubated at 37°C for 24 h. Suspected E. coli colonies were examined through Gram staining and observed microscopically for bacterial morphology. Suspected E. coli colonies were identified by biochemical tests, including triple sugar iron agar, lysine decarboxylase, ornithine decarboxylase/deaminase, urea hydrolysis, indole production, and motility [18].

Antibiotic susceptibility testing

Escherichia coli isolates were examined for resistance to the following 17 antibiotics using the Kirby-Bauer disk diffusion method according to Clinical Laboratory Standards Institute guidelines [19]: amoxicillin/clavulanic acid (AMC, 20 μg/10 μg), ampicillin (AMP, 10 μg), cephalexin (30 μg), cefoxitin (CEF, 30 μg), ceftiofur (30 μg), aztreonam (30 μg), imipenem (10 μg), meropenem (10 μg), ciprofloxacin (CIP, 5 μg), norfloxacin (10 μg), nalidixic acid (30 μg), chloramphenicol (CHL, 30 μg), trimethoprim-sulfamethoxazole (SXT, 1.25 μg/23.75 μg), gentamicin (GEN, 10 μg), tobramycin (TOB, 30 μg), amikacin (AMK, 30 μg), and tetracycline (TET, 15 μg) (Oxoid). Escherichia coli isolates resistant to at least one antibiotic in three or more classes were considered multidrug-resistant [20].

DNA extraction and detection of antibiotic resistance genes

Total bacterial DNA was extracted from the E. coli isolates using a DNA extraction kit (Qiagen, Hilden, Germany) per the manufacturer’s instructions. Genomic DNA from the E. coli isolates was used as the DNA template to amplify the antibiotic resistance genes using polymerase chain reaction (PCR) with primers specific for individual genes (Table-1) [11, 12, 18]. The reaction was performed in a 25 µL mixture containing 2.5 µL 1X Taq buffer, 1 mM MgCl2, 0.2 mM dNTP, 1 µM each of the forward and reverse primers, and 2 units of Taq DNA polymerase (Thermo Fisher Scientific, USA). PCR was performed under the following conditions: denaturation for 5 min at 94°C; 30 cycles of 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C; and a final extension step of 7 min at 72°C. Polymerase chain reaction amplicons were subjected to 1.5% agarose gel electrophoresis, stained with ethidium bromide, and visualized with an ultraviolet transilluminator.

Table-1.

Polymerase chain reaction primers used in this study with expected product sizes for amplifying the Escherichia coli target genes.

Target genes Primer sequence (5’- 3’) Product size (bp) Reference
Phylogenetic group
chuA GACGAACCAACGGTCAGGAT 279 [11]
TGCCGCCAGTACCAAAGACA
yjaA CAAACGTGAAGTGTCAGGAG 211 [12]
AATGCGTTCCTCAACCTGTG
TspE4.C2 CACTATTCGTAAGGTCATCC 152 [12]
AGTTTATCGCTGCGGGTCGC
arpA AACGCTATTCGCCAGCTTGC 400 [12]
TCTCCCCATACCGTACGCTA
Beta-lactams
bla TEM TTAACTGGCGAACTACTTAC 247 [18]
GTCTATTTCGTTCATCCATA
bla SHV AGGATTGACTGCCTTTTTG 393 [18]
ATTTGCTGATTTCGCTCG
bla CMY-2 GACAGCCTCTTTCTCCACA 1,000 [18]
TGGACACGAAGGCTACGTA
Sulfonamide
sul1 CGACACAGAAATCGAGCGTA 60 [18]
GTCTTGCACCGAATGCATAA
sul2 GGCAGATGTGATCGACCTCG 65 [18]
ATGCCGGGATCAAGGACAAG
sul3 GAGCAAGATTTTTGGAATCG 60 [18]
AACTAACCTAGGGCTTTGGA
Trimethoprim
dhfr1 AAGAATGGAGTTATCGGGAATG 391 [18]
GGGTAAAAACTGGCCTAAAATTG
dhfr5 CTGCAAAAGCGAAAAACGG 432 [18]
AGCAATAGTTAATGTTTGAGCTAAAG
dhfr7 GGTAATGGCCCTGATATCCC 265 [18]
TGTAGATTTGACCGCCACC
Quinolone
qnrA AGAGGATTTCTCACGCCAGG 580 [18]
TGCCAGGCACAGATCTTGAC
qnrB GGCATTGAAATTCGCCACTG 264 [18]
TTTGCTGCTCGCCAGTCGAA
qnrS GCAAGTTCATTGAACAGGGT 428 [18]
TCTAAACCGTCGAGTTCGGCG
Aminoglycosides
aac (3)-IIa (aaaC2) CGGAAGGCAATAACGGAG 740 [18]
TCGAACAGGTAGCACTGAG
aac (3)-IV GTGTGCTGCTGGTCCACAGC 627 [18]
AGTTGACCCAGGGCTGTCGC
aad B GAGGAGTTGGACTATGGATT 208 [18]
CTTCATCGGCATAGTAAAAG
Tetracycline
tetA ATGATGGGTGCCTGTTTTCG 350 [18]
CACCGACCATTACGCCA
tetB CGCCCAGTGCTGTTGTTGTC 173 [18]
CGCGTTGAGAAGCTGAGGTG
tetC GCTGTAGGCATAGGCTTGGT 888 [18]
GCCGGAAGCGAGAAGAATCA

Phylogenetic analysis

Phylogenetic determination was performed by amplifying the chuA, vjaA, arpA, and TspE4.C2 genes [11, 12]. Multiplex PCR was performed using the recommended primers (Table-1). Each reaction was carried out and modified using a 20 µL mixture containing 10 µL 2X Green go Taq buffer enzymes, 20 pmoL of each primer, and 200 ng genomic DNA. Polymerase chain reaction was performed under the following conditions: denaturation for 5 min at 94°C; 30 cycles of 30 s at 94°C, 30 s at 55°C, and 30 s at 72°C; and a final extension step of 7 min at 72°C. The PCR products were resolved with 2% agarose gel electrophoresis, stained with ethidium bromide, and visualized with an ultraviolet transilluminator.

Statistical analysis

All data were calculated using GraphPad Prism version 8 (La Jolla, CA, USA). The prevalence of phylogenetic group, antibiotic resistance phenotype, and genotype among E. coli isolates from feces of domestic and wild animals was presented as percentages.

Results

Escherichia coli isolation and identification

We collected 178 fecal samples from the ground from wild deer (n = 45), wild elephants (n = 55), domestic cattle (n = 62), and domestic goats (n = 16). of these samples, 136 were positive for E. coli and yielded 362 E. coli isolates. Of these 362 E. coli isolates,120, 79, 130, and 33 were isolated from 34 deer (75.56%; 34/45), 42 elephants (76.36%; 42/55), 48 cattle (77.42%; 48/62), and 12 domestic goats (75%; 12/16), respectively. Some samples yielded multiple isolates.

Phylogenetic diversity

The prevalence of the phylogenetic groups was determined based on chuA, vjaA, arpA, and TspE4.C2 genes (Figure-1). Phylogeny detection revealed that phylogroup D was the predominant phylogenetic group from deer (41.67%) and elephants (63.29%), whereas phylogroup B1 was predominant in cattle (62.31%). The E. coli isolated from domestic goats were mainly from phylogroups A and B2 (36.36% and 33.33%, respectively).

Figure-1.

Figure-1

Prevalence of phylogenetic groups of Escherichia coli isolated from ground feces of wild and domestic animals.

Antibiotic-resistant phenotypes

Figure-2 shows the antibiotic resistance test results. Of the E. coli isolates, 362 were resistant to 10 of 17 antibiotics. Escherichia coli isolated from deer showed only AMP resistance (18.33%). Escherichia coli isolates from elephants showed resistance to AMP (7.59%), amoxicillin/clavulanate (1.27%), TET (3.8%), CIP (11.39%), and SXT (5.06%). Escherichia coli isolates from cattle showed resistance to AMP (32.31%), amoxicillin/clavulanate (1.54%), CEF (0.77%), GEN (3.85%), TOB (0.77%), AMK (1.54%), CHL (1.54%), TET (2.31%), and SXT (2.31%). Escherichia coli isolates from domestic goats showed resistance to AMP (48.48%), TET (45.45%), and SXT (3.03%). All animal species tested contained AMP-resistant E. coli in their feces. The E. coli isolates from cattle showed resistance to most antibiotics (Figure-2). Conversely, the E. coli isolates from deer showed resistance to only one antibiotic (Figure-2).

Figure-2.

Figure-2

Percentage (%) of antibiotic resistant Escherichia coli isolated from ground feces of wild and domestic animals. AMP=Ampicillin, AMC=Amoxicillin/clavulanic acid, CEF=Cefoxitin, GEN=Gentamicin, TOB=Tobramycin, AMK=Amikacin, CHL=Chloramphenicol, TET=Tetracycline, CIP=Ciprofloxacin, SXT=Trimethoprim-sulfamethoxazole.

Three animal species in our study contained multidrug-resistant E. coli: cattle, domestic goats, and elephants. Of the E. coli isolates from elephants, 1.27%, 3.8%, 1.27%, and 1.27% showed multidrug-resistant phenotypes to two, three, four, and five antibiotics, respectively. Of the E. coli isolates from cattle, 1.5%, 2.31%, and 0.77% were resistant to two, three, and four antibiotics, respectively. Of the E. coli isolates from domestic goats, 6.06%, 33.33%, and 3.03% were multidrug-resistant to two, three, and four antibiotics, respectively. Twenty multidrug-resistance patterns were identified from all fecal isolates (Table-2).

Table-2.

Antibiotic resistance patterns in Escherichia coli isolated from feces of deer, elephants, cattle, and domestic goats.

Antibiotic-resistant patterns Number of isolates Source of feces
AMP 25 Deer, goats
AMP + SXT 3 Elephants, cattle
AMP + AMK 1 Cattle
AMK 1 Cattle
AMP + TET 12 Goats
AMP + TET + CIP 1 Elephants
AMP + SXT + TET + GEN 1 Cattle
AMP + AMC + SXT + TET+ CIP 1 Elephants
AMP + SXT + TET 1 Goats
AMP + AMC + TET 1 Goats
TET 2 Cattle, goats
AMC 2 Cattle
AMP + CIP 2 Elephants
CIP + TET 1 Elephants
CIP 4 Elephants
SXT 1 Elephants
GEN 3 Cattle
GEN + CHL 1 Cattle
SXT + TET 1 Cattle
CEF + TOB + CHL 1 Cattle

AMP=Ampicillin, AMC=Amoxicillin/clavulanic acid, CEF=Cefoxitin, GEN=Gentamicin, TOB=Tobramycin, AMK=Amikacin, CHL=Chloramphenicol, TET=Tetracycline, CIP=Ciprofloxacin, SXT=Trimethoprim-sulfamethoxazole

Each phylogenetic group of E. coli showed different resistances to the tested antibiotics (Table-3). Escherichia coli phylogenetic Group A exhibited resistance to AMP, AMC, GEN, TET, CIP, and SXT. Group B1 showed resistance to AMP, CEF, GEN, AMK, CHL, TET, CIP, and SXT. Group B2 showed resistance to AMP, AMC, TET, CIP, and SXT. Group D exhibited resistance to AMP, AMC, GEN, TET, CIP, and SXT.

Table-3.

Phylogenetic Escherichia coli groups among animal species resistant to antibiotics.

Antibiotic resistance pattern Phylogenetic Group

A B1 B2 D
Ampicillin-resistant isolates
 Deer 5 35 12 23
 Elephants 1 1 0 2
 Cattle 3 1 0 0
 Domestic goats 10 2 2 0
Amoxicillin clavulanate-resistance isolates
 Deer 0 0 0 0
 Elephants 1 0 0 0
 Cattle 0 0 1 1
 Domestic goats 0 0 0 0
Cefoxitin-resistance isolates
 Deer 0 0 0 0
 Elephants 0 0 0 0
 Cattle 0 1 0 0
 Domestic goats 0 0 0 0
Gentamicin-resistance isolates
 Deer 0 0 0 0
 Elephants 0 0 0 0
 Cattle 1 2 0 2
 Domestic goats 0 0 0 0
Tobramycin-resistance isolates
 Deer 0 0 0 0
 Elephants 0 0 0 0
 Cattle 0 1 0 0
 Domestic goats 0 0 0 0
Amikacin-resistance isolates
 Deer 0 0 0 0
 Elephants 0 0 0 0
 Cattle 0 2 0 0
 Domestic goats 0 0 0 0
Chloramphenicol-resistance isolates
 Deer 0 0 0 0
 Elephants 0 0 0 0
 Cattle 0 2 0 0
 Domestic goats 0 0 0 0
Tetracycline-resistance isolates
 Deer 0 0 0 0
 Elephants 1 0 1 1
 Cattle 2 1 0 0
 Domestic goats 8 3 3 0
Ciprofloxacin-resistance isolates
 Deer 0 0 0 0
 Elephants 1 1 1 5
 Cattle 0 0 0 0
 Domestic goats 0 0 0 0
Trimethoprim-sulfamethoxazole - resistance isolates
 Deer 0 0 0 0
 Elephants 1 0 1 2
 Cattle 3 0 0 0
 Domestic goats 0 1 0 0

We also compared the E. coli phylogenetic groups among animal species (Table-3). Most E. coli isolates were resistant to AMP (66.44%, 97/146; Table-3); this AMP resistance occurred in all phylogenetic groups and all animal species studied. Ampicillin-resistant E. coli from deer were mostly in Group B1 (46.67%, 35/75), whereas those from domestic goats were mainly in Group A (71.43%, 10/14). Group B1 showed the highest prevalence of antibiotic resistance (36.3% and 53/146). Table-3 shows the low prevalence of resistance to other antibiotics and the determined phylogenetic groups.

Prevalence of antibiotic resistance genes

blaTEM, blaSHV, blaCMY-2, aaaC2, aac(3)-IV, aadB, tetA, tetB, tetC, qnrA, qnrB, qnrS, sul1, sul2, sul3, dfra1, dfra5, and dfra7 were identified from the 362 E. coli isolates in our study (Table-4). The total resistance-gene frequencies were blaTEM: 24.24%; blaSHV: 21.21%; blaCMY-2: 31.31%; sul1: 0%; sul2: 0%; sul3: 2.02%; DfrA1: 1.01%; DfrA5: 1.01%; DfrA7: 2.02%; qnrA: 1.01%; qnrB: 0%; qnrS: 0%; aac(3)-IIa: 0%; aac(3)-IV: 2.02%; aadA: 2.02%; aadB: 0%; tetA: 5.05%; tetB: 3.03%; and tetC: 0%. Fascinatingly, blaTEM, blaSHV, and blaCMY-2 were identified in E. coli isolates from all animal species and were phenotypically resistant to AMP. aac(3)IV and aadA were identified in E. coli isolates from cattle, which were phenotypically resistant to GEN. tetA and tetB were identified in E. coli isolates from elephants, cattle, and domestic goats. These results are consistent with our results that E. coli isolates from elephants, cattle, and domestic goats were resistant to TET. qnrA was identified in E. coli isolates from elephants. The data showed that only E. coli isolates from elephants were resistant to CIP. Escherichia coli isolates from elephants, cattle, and domestic goats that contained sul3, dfra1, dfra5, and dfra7 were resistant to SXT. sul3 is associated with sulfonamide resistance in E. coli. In addition, the presence of dfra is linked to trimethoprim resistance in E. coli.

Table-4.

Occurrence of antibiotic resistance genes among antibiotic-resistant Escherichia coli isolates among animal species.

Antibiotic resistance genes Gene occurrence (%)

Deer Elephants Cattle Domestic goats
β-lactams
blaTEM 25.33 (19/75) 80 (4/5) 20 (1/5) -
blaSHV 25.33 (19/75) 1.27 (1/5) 20 (1/5) -
blaCMY-2 26.67 (20/75) - 40 (2/5) 64.29 (9/14)
 Total 77.33 (58/75) 100 (5/5) 80 (4/5) 64.29 (9/14)
Aminoglycosides
aac (3) IIa - - - -
aac (3) IV - - 25 (2/8) -
aadA - - 25 (2/8) -
aadB - - - -
 Total - - 50 (4/8) -
Tetracycline
tetA - 66.67 (2/3) 66.67 (2/3) 7.14 (1/14)
tetB - - 33.33 (1/3) 14.29 (2/14)
tetC - - - -
 Total - 66.67 (2/3) 100 (3/3) 21.43 (3/14)
Fluoroquinolone
qnrA - 12.5 (1/8) - -
qnrB - - - -
qnrS - - - -
 Total - 12.5 (1/8) - -
Trimethoprim-sulfamethoxazole
sul1 - - - -
sul2 - - - -
sul3 - 25 (1/4) 33.33 (1/3) -
dfra1 - - 33.33 (1/3) -
dfra5 - 25 (1/4) - -
dfra7 - - 33.33 (1/3) 100 (1/1)
 Total - 50 (2/4) 100 (3/3) 100 (1/1)

Discussion

In this study, we aimed to examine the antibiotic sensitivity pattern and phylogenetic variation of E. coli isolates from various wild and domestic animals in forests, residences, and agricultural interfaces in Thailand. Antibiotics are used to treat and prevent bacterial infections in people and animals [21]. However, antibiotic resistance has become highly prevalent among bacterial isolates worldwide [14]. It renders a serious problem for antibiotic therapy [5, 6]. Therefore, surveillance of antibiotic-resistant bacteria is necessary to control antibiotic use. Escherichia coli is an important reservoir for tracking bacterial antibiotic resistance because E. coli has the ability to transfer genetic material to and from other bacterial species and can harbor several resistance determinants [17]. Consequently, antibiotic resistance surveillance programs often use E. coli as an indicator [79]. The prevalence of antibiotic-resistant E. coli is increasing in many animals, such as poultry [22, 23], swine [2426], cattle [18, 27, 28], and wild animals [2932]. At present, limited data exist on antibiotic-resistant E. coli and their phylogenetic groups in wild and domestic animals in Thailand.

In Thailand, antibiotics are used on livestock farms to treat sick animals and support healthy animals during stressful periods to prevent bacterial infections. However, these bacteria can develop resistance to antibiotics. In addition, antibiotic-resistant bacteria can be transferred to other bacterial species in animals that might never be treated with antibiotics. Nowadays, one of the biggest obstacles to controlling and treating infectious diseases in these animals is the resistance of pathogenic bacteria to antibiotics. Thus, monitoring antibiotic-resistant E. coli in domestic and wild animals highlights the problem of antibiotic resistance among animals in Thailand. Here, we studied fecal samples from wild animals at Salakpra Wildlife Sanctuary in Kanchanaburi Province, the first wildlife sanctuary in Thailand. The diversity of wildlife in Salakpra is vast, with 352 animal species, including wild elephants and deer. Small-scale livestock farms also harbor domestic animals on the boundary of Salakpra. Domestic animal feces in this study were derived from cattle and goats.

We analyzed 362 E. coli isolates from 178 fecal samples from free-ranging herbivores, including wild elephants and deer and domestic cattle and goats. Phylogenetic analysis of the virulence genes chuA, vjaA, arpA, and TspE4.C2 yielded four E. coli phylogenetic groups: A, B1, B2, and D. In deer and elephants, most E. coli were in phylogroup D. For domestic goats, most E. coli isolates were phylogenetic Groups A and B2. In E. coli from cattle, Group B1 was the predominant phylogenetic group. Consistent with the previous finding, Groups B2 and A were found mostly in E. coli isolated from domestic goats [33, 34]. Escherichia coli isolated from herbivorous wildlife in another study (auroch, buffalo, and waterbuck) were mostly in group B1 [35], which is consistent with our findings for cattle. Conversely, a previous study reported that E. coli strains from wild elephants belonged mostly to phylogenetic group B1 [36]. One study reported that group D E. coli are more likely to be pathogenic and are associated with pigs and humans [15]. However, group D E. coli isolated in our study did not adhere to or invade Caco2 cells (data not shown), suggesting that they are commensal and do not cause disease. In addition, most E. coli phylogenetic groups in the environment tend to belong to Group B1 [37]. The E. coli isolates in our study were clustered into different phylogenetic groups, indicating minimal contamination from the ground environment.

We analyzed the diversity of the E. coli phylogenetic groups and antibiotic resistance among wild and domestic animals. Phylogenetic Group B1 was the largest E. coli group with antibiotic resistance in wild and domestic animals. This is similar to a previous study on calves and chicken carcasses, which showed that E. coli Group B1 had the highest antibiotic resistance [38]. Conversely, one study found that E. coli Groups B2 and D commonly resist many antibiotics in domestic animals [39]. We found that different E. coli phylogenetic groups from different animals were resistant to the same antibiotics. Ampicillin-resistant E. coli from deer belonged mostly to phylogenetic Group B1, whereas AMP-resistant E. coli from domestic goats belonged mostly to phylogenetic group A. Thus, distributions of E. coli phylogenetic groups may influence the antibiotic resistance profiles. Additional research is required to explore the shared attributes in phylogenies that allow antibiotic resistance.

The E. coli isolated from wild and domestic animals in the area around the Salakphra Wildlife Sanctuary were resistant to ten antibiotics. Antibiotic resistance in commensal E. coli has been reported in various wild mammals worldwide, including birds [4043], rodents [41], ungulates [44], primates [45, 46], boars [47], foxes [48], rabbits [48, 49], and deer [48, 50]. We found that E. coli isolates from deer were resistant to AMP. Other researchers have found that E. coli isolates from deer are resistant to other antibiotics. Tamamura-Andoh et al. [50] reported that E. coli isolates from deer were resistant to TET. Smith et al. [43] found that E. coli isolates from deer were resistant to oxacillin, penicillin, TET, and rifampin. Alonso et al. [51] found that E. coli isolates from deer were resistant to TET and quinolones. Li et al. [52] reported that E. coli isolates from deer were resistant to sulfonamides, streptomycin, and TET. Sarker et al. [53] found antibiotic resistance to AMP and sulfamethoxazole, TET, nalidixic acid, erythromycin, and CHL in E. coli isolates from deer in safari parks in Bangladesh. Conversely, Wasyl et al. [54] found no antibiotic resistance in E. coli isolates from wild deer in Poland.

In our study, E. coli isolates from wild elephants were resistant to five antibiotics: AMP, amoxicillin/clavulanate, TET, CIP, and SXT. This finding is similar to a report by Jayasekara et al. [55], who found that E. coli isolates from wild elephants were resistant to AMP, amoxicillin/clavulanate, TET, nitrofurantoin, and cefuroxime. However, CIP-resistant E. coli were isolated only from wild elephants in our study. Further investigation is needed to determine the environmental source of the antibiotic-resistant E. coli that spread to these wild elephants.

We found that E. coli isolates from cattle were resistant to several antibiotics, including AMP, amoxicillin/clavulanate, CEF, GEN, TOB, CHL, TET, and SXT. This is consistent with previous studies that found that E. coli from beef cattle were resistant to CEF and SXT [56]. These antibiotics are commonly used in cattle for routine treatments. Moreover, another report demonstrated that E. coli isolates from cattle exhibited resistance to AMP, ceftiofur, CHL, florfenicol, spectinomycin, and TET [57]. One study reported that E. coli isolated from cattle were resistant to aminoglycosides and TET [58]. Escherichia coli isolated from cattle can also resist TET [27]. These findings suggest a problematic increase in antibiotic-resistant E. coli in domestic cattle.

Both cattle and domestic goats are popular among livestock smallholders in Thai rural areas. Our study highlights that antibiotic resistance problems in domestic goats in Thailand should be addressed. Escherichia coli isolates from domestic goats were resistant to three antibiotics: AMP, TET, and SXT. In domestic goats, AMP showed the highest percentage of antibiotic resistance. Consistent with a previous report from Bangladesh, high levels of resistant E. coli isolates from goats were found against AMP and AMC, followed by SXT, TET, streptomycin, and GEN [59]. In Kenya, E. coli isolates from goats showed more frequent resistance to AMP, AMC, TET, ceftriaxone, and CHL [60]. In Switzerland, most isolates from goats were resistant to TET, streptomycin, and AMP [61]. In Michigan, USA, E. coli isolates from wild and domestic animals were most frequently resistant to TET, cephalothin, sulfisoxazole, and streptomycin [62]. These findings highlight the problem of antibiotic resistance among livestock in Thailand and other countries.

Our results showed multidrug resistance among E. coli isolates from elephants, cattle, and domestic goats, indicating the emergence of multidrug resistance among E. coli in wild and domestic animals in Thailand. One possible reason for the multidrug-resistant bacteria in wild animals is increased cohabitation between wild and domestic animals because deforestation causes wild animals to migrate into agricultural landscapes to survive. This allows the transmission of bacterial antibiotic resistance between wild and domestic animals [63]. Occurrences of multidrug-resistant E. coli have been reported in wildlife and domestic mammals elsewhere [64], for example, among sympatric wildlife, humans, livestock, and their shared environment in Kenya [65].

Antibiotic resistance among E. coli isolates in this study was confirmed by determining their antibiotic resistance genes, including blaTEM, blaSHV, blaCMY-2, aacC2, aac(3)IV, aadB, tetA, tetB, tetC, qnrA, qnrB, qnrS, sul1, sul2, sul3, dfra1, dfra5, and dfra7. Our E. coli isolates carried antibiotic resistance genes associated with phenotypic resistance to antibiotics. Most of these isolates from both wild and domestic animals contained antibiotic resistance genes to b-lactams. Thus, E. coli may transfer antibiotic resistance genes to other bacteria in these animals under certain conditions.

Although E. coli isolates in this study were diverse in terms of phylogenetic groups and antibiotic resistance, E. coli from both wild and domestic animals showed resistance to AMP. Escherichia coli isolates from elephants were resistant to TET and SXT, which was similar to the E. coli isolates from cattle and domestic goats, indicating that transfer of antibiotic-resistant E. coli may occur between wild and domestic animals. One possible explanation is that bacterial resistance may have spread in the study area through the dissemination of antibiotic resistance among bacterial populations in domestic and wild animals. In addition, Guenther et al. [64] suggested that antibiotic resistance may develop in the gut flora of wild mammals when the animals consume antibiotics in feed and water from nearby farms and indirectly after exposure to farm waste.

Conclusion

The emergence and spread of antibiotic-resistant bacteria in natural environments are a major concern with serious implications for human and animal health. In this study, the examination of E. coli isolates from the ground feces of domestic and wild animals highlights the problem of antibiotic resistance. The prevalence of antibiotic-resistant E. coli may be due to the overuse of antibiotics in veterinary medicine or non-methodical use in feeding domestic animals. Furthermore, domestic animals may be reservoirs for spreading resistant E. coli to wild animals. Our findings intended to support the awareness of responsible use of antibiotics in animals. However, our investigation is restricted to speculation on the potential role of E. coli as a reservoir for antibiotic resistance in domestic and wild animals. More investigations are warranted. Probably, antibiotic resistance of a panel of gut microbiota is more rational and worthwhile. In addition, molecular insight of antibiotic-resistant mechanisms of bacteria is needed to clarify future development in the prevention and control of antibiotic resistance, as well as the treatment of the diseases.

Authors’ Contributions

TD, NI, and PP: Conceived and designed the study. TD, AR, TK, WT, NK, PA, MV, NI, and PP: Performed the experiments and analyzed the data. TD and PP: Performed literature search and drafted the manuscript. NI and PP: Reviewed and edited the manuscript. TD and PP: Performed final manuscript revision. All authors have read and approved the final manuscript.

Acknowledgments

This study was supported by the research grant from the Faculty of Tropical Medicine, Mahidol University, and the National Research Council of Thailand (Grant number NRCT5-RSA63015-14). Many thanks to the staff of the Salakpra Wildlife Sanctuary, Thailand for their assistance during the sample collection.

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.

References

  • 1.Larsson D.G, Flach C.F. Antibiotic resistance in the environment. Nat. Rev. Microbiol. 2022;20(5):257–269. doi: 10.1038/s41579-021-00649-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Huemer M, Shambat S.M, Brugger S.D, Zinkernagel A.S. Antibiotic resistance and persistence-implications for human health and treatment perspectives. EMBO Rep. 2020;21(12):e51034. doi: 10.15252/embr.202051034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hiltunen T, Virta M, Laine A.L. Antibiotic resistance in the wild:An eco-evolutionary perspective. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 2017;372(1712):20160039. doi: 10.1098/rstb.2016.0039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Versporten A, Zarb P, Caniaux I, Gros M.F, Drapier N, Miller M, Jarlier V, Nathwani D, Goossens H. Antimicrobial consumption and resistance in adult hospital inpatients in 53 countries:Results of an internet-based global point prevalence survey. Lancet. Glob. Health. 2018;6(6):e619–e629. doi: 10.1016/S2214-109X(18)30186-4. [DOI] [PubMed] [Google Scholar]
  • 5.Hernando-Amado S, Coque T.M, Baquero F, Martínez J.L. Defining and combating antibiotic resistance from One Health and Global Health perspectives. Nat. Microbiol. 2019;4(9):1432–1442. doi: 10.1038/s41564-019-0503-9. [DOI] [PubMed] [Google Scholar]
  • 6.Morehead M.S, Scarbrough C. Emergence of global antibiotic resistance. Prim. Care. 2018;45(3):467–484. doi: 10.1016/j.pop.2018.05.006. [DOI] [PubMed] [Google Scholar]
  • 7.Gruel G, Sellin A, Riveiro H, Pot M, Breurec S, Guyomard-Rabenirina S, Talarmin A, Ferdinand S. Antimicrobial use and resistance in Escherichia coli from healthy food-producing animals in Guadeloupe. BMC Vet. Res. 2021;17(1):116. doi: 10.1186/s12917-021-02810-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nji E, Kazibwe J, Hambridge T, Joko C.A, Larbi A.A, Damptey L.A, Nkansa-Gyamfi N.A, Lundborg C.S, Lien T.Q. High prevalence of antibiotic resistance in commensal Escherichia coli from healthy human sources in community settings. Sci. Rep. 2021;11(1):3372. doi: 10.1038/s41598-021-82693-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hesp A, Braak C.T, van der Goot J, Veldman K, van Schaik G, Mevius D. Antimicrobial resistance clusters in commensal Escherichia coli from livestock. Zoonoses Public Health. 2021;68(3):194–202. doi: 10.1111/zph.12805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zhou B, Yuan Y, Zhang S, Guo C, Li X, Li G, Xiong W, Zeng Z. Intestinal flora and disease mutually shape the regional immune system in the intestinal tract. Front. Immunol. 2020;11:575. doi: 10.3389/fimmu.2020.00575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000;66(10):4555–4558. doi: 10.1128/aem.66.10.4555-4558.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Clermont O, Christenson J.K, Denamur E, Gordon D.M. The Clermont Escherichia coli phylo-typing method revisited:Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013;5(1):58–65. doi: 10.1111/1758-2229.12019. [DOI] [PubMed] [Google Scholar]
  • 13.Krawczyk B, Śledzińska A, Szemiako K, Samet A, Nowicki B, Kur J. Characterisation of Escherichia coli isolates from the blood of haematological adult patients with bacteraemia:Translocation from gut to blood requires the cooperation of multiple virulence factors. Eur. J. Clin. Microbiol. Infect. Dis. 2015;34(6):1135–1143. doi: 10.1007/s10096-015-2331-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yair Y, Gophna U. Pandemic bacteremic Escherichia coli strains:Evolution and emergence of drug-resistant pathogens. Curr. Top. Microbiol. Immunol. 2018;416:163–180. doi: 10.1007/82_2018_109. [DOI] [PubMed] [Google Scholar]
  • 15.Carlos C, Pires M.M, Stoppe N.C, Hachich E.M, Sato M.I, Gomes T.A, Amaral L.A, Ottoboni L.M. Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC Microbiol. 2010;10:161. doi: 10.1186/1471-2180-10-161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Washington M.A, Taitt C.R, Blythe J, Hering K, Barnhill J. Escherichia coli as a potential reservoir of antimicrobial resistance genes on the Island of O'ahu. Hawaii J. Health Soc. Welf. 2021;80(1):9–14. [PMC free article] [PubMed] [Google Scholar]
  • 17.Paitan Y. Current trends in antimicrobial resistance of Escherichia coli. Curr. Top. Microbiol. Immunol. 2018;416:181–211. doi: 10.1007/82_2018_110. [DOI] [PubMed] [Google Scholar]
  • 18.Hinthong W, Pumipuntu N, Santajit S, Kulpeanprasit S, Buranasinsup S, Sookrung N, Chaicumpa W, Aiumurai P, Indrawattana N. Detection and drug resistance profile of Escherichia coli from subclinical mastitis cows and water supply in dairy farms in Saraburi Province, Thailand. PeerJ. 2017;5:e3431. doi: 10.7717/peerj.3431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Clinical and Laboratory Standards Institute. CLSI Document M100S. 26th ed. Wayne: Clinical and Laboratory Standards Institute; 2016. Performance standards for antimicrobial susceptibility testing. [Google Scholar]
  • 20.Exner M, Bhattacharya S, Christiansen B, Gebel J, Goroncy-Bermes P, Hartemann P, Heeg P, Ilschner C, Kramer A, Larson E, Merkens W, Mielke M, Oltmanns P, Ross B, Rotter M, Schmithausen R. M, Sonntag H.G, Trautmann M. Antibiotic resistance:What is so special about multidrug-resistant Gram-negative bacteria? GMS Hygiene Infect. Control. 2017;12:Doc05. doi: 10.3205/dgkh000290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Burch D. Use of antibiotics in animals and people. Vet. Rec. 2016;178(6):146. doi: 10.1136/vr.i696. [DOI] [PubMed] [Google Scholar]
  • 22.Eltai N.O, Yassine H.M, El-Obeid T, Al-Hadidi S.H, Al Thani A.A, Alali W.Q. Prevalence of antibiotic-resistant Escherichia coli isolates from local and imported retail chicken carcasses. J. Food Prot. 2020;83(12):2200–2208. doi: 10.4315/JFP-20-113. [DOI] [PubMed] [Google Scholar]
  • 23.Davis G.S, Waits K, Nordstrom L, Grande H, Weaver B, Papp K, Horwinski J, Koch B, Hungate B.A, Liu C.M, Price L.B. Antibiotic-resistant Escherichia coli from retail poultry meat with different antibiotic use claims. BMC Microbiol. 2018;18(1):174. doi: 10.1186/s12866-018-1322-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hu Z, Peng Z, Zhang X, Li Z, Jia C, Li X, Lv Y, Tan C, Chen H, Wang X. Prevalence and molecular characterization of antimicrobial-resistant Escherichia coli in pig farms, slaughterhouses, and terminal markets in Henan province of China. Foodborne Pathog. Dis. 2021;18(10):733–743. doi: 10.1089/fpd.2021.0011. [DOI] [PubMed] [Google Scholar]
  • 25.Dimitrova L, Kaleva M, Zaharieva M.M, Stoykova C, Tsvetkova I, Angelovska M, Ilieva Y, Kussovski V, Naydenska S, Najdenski H. Prevalence of antibiotic-resistant Escherichia coli isolated from swine faeces and lagoons in Bulgaria. Antibiotics (Basel) 2021;10(8):940. doi: 10.3390/antibiotics10080940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ikwap K, Gertzell E, Hansson I, Dahlin L, Selling K, Magnusson U, Dione M, Jacobson M. The presence of antibiotic-resistant Staphylococcus spp. and Escherichia coli in smallholder pig farms in Uganda. BMC Vet. Res. 2021;17(1):31. doi: 10.1186/s12917-020-02727-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Manishimwe R, Moncada P.M, Bugarel M, Scott H.M, Loneragan G.H. Antibiotic resistance among Escherichia coli and Salmonella isolated from dairy cattle feces in Texas. PLoS One. 2021;16(5):e0242390. doi: 10.1371/journal.pone.0242390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fayemi O.E, Akanni G.B, Elegbeleye J.A, Aboaba O.O, Njage P.M. Prevalence, characterization and antibiotic resistance of Shiga toxigenic Escherichia coli serogroups isolated from fresh beef and locally processed ready-to-eat meat products in Lagos, Nigeria. Int. J. Food Microbiol. 2021;347:109191. doi: 10.1016/j.ijfoodmicro.2021.109191. [DOI] [PubMed] [Google Scholar]
  • 29.Murphy R, Palm M, Mustonen V, Warringer J, Farewell A, Parts L, Moradigaravand D. Genomic epidemiology and evolution of Escherichia coli in wild animals in Mexico. mSphere. 2021;6(1):e00738–20. doi: 10.1128/mSphere.00738-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Plaza-Rodríguez C, Alt K, Grobbel M, Hammerl J.A, Irrgang A, Szabo I, Stingl K, Schuh E, Wiehle L, Pfefferkorn B, Naumann S, Kaesbohrer A, Tenhagen B.A. Wildlife as sentinels of antimicrobial resistance in Germany? Front. Vet. Sci. 2020;7:627821. doi: 10.3389/fvets.2020.627821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yuan Y, Liang B, Jiang B.W, Zhu L.W, Wang T.C, Li Y.G, Liu J, Guo X.J, Ji X, Sun Y. Migratory wild birds carrying multidrug-resistant Escherichia coli as potential transmitters of antimicrobial resistance in China. PLoS One. 2021;16(12):e0261444. doi: 10.1371/journal.pone.0261444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Formenti N, Calò S, Parisio G, Guarneri F, Birbes L, Pitozzi A, Scali F, Tonni M, Guadagno F, Giovannini S, Salogni C, Ianieri A, Bellini S, Pasquali P, Alborali G.L. ESBL/AmpC-producing Escherichia coli in wild boar:Epidemiology and risk factors. Animals (Basel) 2021;11(7):1855. doi: 10.3390/ani11071855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Coura F.M, Diniz Sde A, Silva M.X, Mussi J.M, Barbosa S.M, Lage A.P, Heinemann M.B. Phylogenetic group determination of Escherichia coli isolated from animals samples. ScientificWorldJournal. 2015;2015:258424. doi: 10.1155/2015/258424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Derakhshandeh A, Firouzi R, Naziri Z. Phylogenetic group determination of faecal Escherichia coli and comparative analysis among different hosts. Iran. J. Vet. Res. 2014;15(1):13–17. [Google Scholar]
  • 35.Baldy-Chudzik K, Mackiewicz P, Stosik M. Phylogenetic background, virulence gene profiles, and genomic diversity in commensal Escherichia coli isolated from ten mammal species living in one zoo. Vet. Microbiol. 2008;131(1–2):173–184. doi: 10.1016/j.vetmic.2008.02.019. [DOI] [PubMed] [Google Scholar]
  • 36.Chiyo P.I, Grieneisen L.E, Wittemyer G, Moss C.J, Lee P.C, Douglas-Hamilton I, Archie E.A. The influence of social structure, habitat, and host traits on the transmission of Escherichia coli in wild elephants. PLoS One. 2014;9(4):e93408. doi: 10.1371/journal.pone.0093408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Gordon D.M, Clermont O, Tolley H, Denamur E. Assigning Escherichia coli strains to phylogenetic groups:Multi-locus sequence typing versus the PCR triplex method. Environ. Microbiol. 2008;10(10):2484–2496. doi: 10.1111/j.1462-2920.2008.01669.x. [DOI] [PubMed] [Google Scholar]
  • 38.Staji H, Tonelli A, Salehi T.Z, Mahdavi A, Shahroozian E, Bejestani M.R, Mood S.M, Keywanloo M, Hamedani M.A, Chashmi H.E, Tamai I.A, Tabar E.A. Distribution of antibiotic resistance genes among the phylogroups of Escherichia coli in diarrheic calves and chickens affected by colibacillosis in Tehran, Iran. Arch. Razi. Inst. 2018;73(2):131–137. doi: 10.22092/ari.2018.116502. [DOI] [PubMed] [Google Scholar]
  • 39.Osugui L, de Castro A.F, Iovine R, Irino K, Carvalho V.M. Virulence genotypes, antibiotic resistance and the phylogenetic background of extra intestinal pathogenic Escherichia coli isolated from urinary tract infections of dogs and cats in Brazil. Vet. Microbiol. 2014;171(1–2):242–247. doi: 10.1016/j.vetmic.2014.03.027. [DOI] [PubMed] [Google Scholar]
  • 40.Yapicier O.S, Kandir E.H, Öztürk D. Antimicrobial resistance of E. coli and Salmonella isolated from wild birds in a Rehabilitation Center in Turkey. Arch. Razi. Inst. 2022;77(1):257–267. doi: 10.22092/ARI.2021.356322.1823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ong K.H, Khor W.C, Quek J.Y, Low Z.X, Arivalan S, Humaidi M, Chua C, Seow K.L, Guo S, Tay M.Y, Schlundt J, Ng L.C, Aung K.T. Occurrence and antimicrobial resistance traits of Escherichia coli from wild birds and rodents in Singapore. Int. J. Environ. Res. Public Health. 2020;17(15):5606. doi: 10.3390/ijerph17155606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Suenaga Y, Obi T, Ijiri M, Chuma T, Fujimoto Y. Surveillance of antibiotic resistance in Escherichia coli isolated from wild cranes on the Izumi plain in Kagoshima prefecture, Japan. J. Vet. Med. Sci. 2019;81(9):1291–1293. doi: 10.1292/jvms.19-0305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Smith S, Wang J, Fanning S, McMahon B. J. Antimicrobial resistant bacteria in wild mammals and birds:A coincidence or cause for concern? Ir. Vet. J. 2014;67(1):8. doi: 10.1186/2046-0481-67-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Torres R.T, Cunha M.V, Araujo D, Ferreira H, Fonseca C, Palmeira J.D. Emergence of colistin resistance genes (mcr-1) in Escherichia coli among widely distributed wild ungulates. Environ. Pollut. 2021;291:118136. doi: 10.1016/j.envpol.2021.118136. [DOI] [PubMed] [Google Scholar]
  • 45.Rolland R.M, Hausfater G, Marshall B, Levy S.B. Antibiotic-resistant bacteria in wild primates:Increased prevalence in baboons feeding on human refuse. Appl. Environ. Microbiol. 1985;49(4):791–794. doi: 10.1128/aem.49.4.791-794.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Swiecicka I, Buczek J, Iwaniuk A. Analysis of genetic relationships and antimicrobial susceptibility of Escherichia coli isolated from Clethrionomys glareolus. J. Gen. Appl. Microbiol. 2003;49(6):315–320. doi: 10.2323/jgam.49.315. [DOI] [PubMed] [Google Scholar]
  • 47.Literak I, Dolejska M, Radimersky T, Klimes J, Friedman M, Aarestrup F.M, Hasman H, Cizek A. Antimicrobial-resistant faecal Escherichia coli in wild mammals in central Europe:Multiresistant Escherichia coli producing extended-spectrum beta-lactamases in wild boars. J. Appl. Microbiol. 2010;108(5):1702–1711. doi: 10.1111/j.1365-2672.2009.04572.x. [DOI] [PubMed] [Google Scholar]
  • 48.Costa D, Poeta P, Saenz Y, Vinue L, Rojo-Bezares B, Jouini A, Zarazaga M, Rodrigues J, Torres C. Detection of Escherichia coli harbouring extended-spectrum beta-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal. J. Antimicrob. Chemother. 2006;58(6):1311–1312. doi: 10.1093/jac/dkl415. [DOI] [PubMed] [Google Scholar]
  • 49.Said L.B, Jouini A, Fliss I, Torres C, Klibi N. Antimicrobial resistance genes and virulence gene encoding intimin in Escherichia coli and Enterococcus isolated from wild rabbits (Oryctolagus cuniculus) in Tunisia. Acta. Vet. Hung. 2019;67(4):477–488. doi: 10.1556/004.2019.047. [DOI] [PubMed] [Google Scholar]
  • 50.Tamamura-Andoh Y, Tanaka N, Sato K, Mizuno Y, Arai N, Watanabe-Yanai A, Akiba M, Kusumoto M. A survey of antimicrobial resistance in Escherichia coli isolated from wild sika deer (Cervus nippon) in Japan. J. Vet. Med. Sci. 2021;83(5):754–758. doi: 10.1292/jvms.21-0005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Alonso C.A, Gonzalez-Barrio D, Tenorio C, Ruiz-Fons F, Torres C. Antimicrobial resistance in faecal Escherichia coli isolates from farmed red deer and wild small mammals. Detection of a multiresistant E. coli producing extended-spectrum beta-lactamase. Comp. Immunol. Microbiol. Infect. Dis. 2016;45:34–39. doi: 10.1016/j.cimid.2016.02.003. [DOI] [PubMed] [Google Scholar]
  • 52.Li R, He L, Hao L, Wang Q, Zhou Y, Jiang H. Genotypic and phenotypic characterization of antimicrobial-resistant Escherichia coli from farm-raised diarrheic sika deer in Northeastern China. PLoS One. 2013;8(9):e73342. doi: 10.1371/journal.pone.0073342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Sarker M.S, Ahad A, Ghosh S.K, Mannan M.S, Sen A, Islam S, Bayzid M.,, Bupasha Z.B. Antibiotic-resistant Escherichia coli in deer and nearby water sources at Safari parks in Bangladesh. Vet. World. 2019;12(10):1578–1583. doi: 10.14202/vetworld.2019.1578-1583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wasyl D, Zajac M, Lalak A, Skarzynska M, Samcik I, Kwit R, Jablonski A, Bocian L, Wozniakowski G, Hoszowski A, Szulowski K. Antimicrobial resistance in Escherichia coli isolated from wild animals in Poland. Microb. Drug. Resist. 2018;24(6):807–815. doi: 10.1089/mdr.2017.0148. [DOI] [PubMed] [Google Scholar]
  • 55.Jayasekara J.A, Abeysinghe K.G, Dissanayake D.M, Vandercone R, Bamunuarachchige T. Prevalence of antibiotic resistant bacteria in fecal matter of wild elephants (Elephas maximus) Proc. Int. Forest. Environ. Sympos. 2017;22:25. [Google Scholar]
  • 56.Schmidt J.W, Agga G.E, Bosilevac J.M, Brichta-Harhay D.M, Shackelford S.D, Wang R, Wheeler T.L, Arthur T.M. Occurrence of antimicrobial-resistant Escherichia coli and Salmonella enterica in the beef cattle production and processing continuum. Appl. Environ. Microbiol. 2015;81(2):713–725. doi: 10.1128/AEM.03079-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Sawant A.A, Hegde N.V, Straley B.A, Donaldson S.C, Love B.C, Knabel S.J, Jayarao B.M. Antimicrobial-resistant enteric bacteria from dairy cattle. Appl. Environ. Microbiol. 2007;73(1):156–163. doi: 10.1128/AEM.01551-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Aasmae B, Hakkinen L, Kaart T, Kalmus P. Antimicrobial resistance of Escherichia coli and Enterococcus spp. isolated from Estonian cattle and swine from 2010 to 2015. Acta. Vet. Scand. 2019;61(1):5. doi: 10.1186/s13028-019-0441-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Islam K.M, Ahad A, Barua M, Islam A, Chakma S, Dorji C, Uddin M.A, Islam S, Ahasan A.S. Isolation and epidemiology of multidrug resistant Escherichia coli from goats in Co˜s Bazar, Bangladesh. J. Adv. Vet. Anim. Res. 2016;3(2):166–172. [Google Scholar]
  • 60.Njoroge S, Muigai A.W, Njiruh P.N, Kariuki S. Molecular characterisation and antimicrobial resistance patterns of Escherichia coli isolates from goats slaughtered in parts of Kenya. East. Afr. Med. J. 2013;90(3):72–83. [PubMed] [Google Scholar]
  • 61.Ndegwa E, Almehmadi H, Kim C, Kaseloo P, Ako A.A. Longitudinal shedding patterns and characterization of antibiotic resistant E. coli in pastured goats using a cohort study. Antibiotics (Basel) 2019;8(3):136. doi: 10.3390/antibiotics8030136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Sayah R.S, Kaneene J.B, Johnson Y, Miller R. Patterns of antimicrobial resistance observed in Escherichia coli isolates obtained from domestic-and wild-animal fecal samples, human septage, and surface water. Appl. Environ. Microbiol. 2005;71(3):1394–1404. doi: 10.1128/AEM.71.3.1394-1404.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Arnold K.E, Williams N.J, Bennett M. 'Disperse abroad in the land':The role of wildlife in the dissemination of antimicrobial resistance. Biol. Lett. 2016;12(8):20160137. doi: 10.1098/rsbl.2016.0137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Guenther S, Ewers C, Wieler L.H. Extended-spectrum beta-lactamases producing E. coli in wildlife, yet another form of environmental pollution? Front. Microbiol. 2011;2:246. doi: 10.3389/fmicb.2011.00246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Hassell J.M, Ward M.J, Muloi D, Bettridge J.M, Robinson T.P, Kariuki S, Ogendo A, Kiiru J, Imboma T, Kang'ethe E.K, Oghren E.M, Williams N.J, Begon M, Woolhouse M.E, Fevre E.M. Clinically relevant antimicrobial resistance at the wildlife-livestock-human interface in Nairobi:An epidemiological study. Lancet. Planet. Health. 2019;3(6):e259–e269. doi: 10.1016/S2542-5196(19)30083-X. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES