Skip to main content
Cardiovascular Research logoLink to Cardiovascular Research
. 2021 Sep 3;118(12):2718–2731. doi: 10.1093/cvr/cvab289

PLX3397, a CSF1 receptor inhibitor, limits allotransplantation-induced vascular remodelling 

Vanessa M Almonte 1,2, Unimunkh Uriyanghai 3,4, Lander Egaña-Gorroño 5,6,✉, Dippal Parikh 7,8, Gustavo H Oliveira-Paula 9,10, Jinghang Zhang 11, Smitha Jayakumar 12,13, Dario F Riascos-Bernal 14,15, Nicholas E S Sibinga 16,17,✉
PMCID: PMC9890458  PMID: 34478521

Abstract

Aims

Graft vascular disease (GVD), a clinically important and highly complex vascular occlusive disease, arises from the interplay of multiple cellular and molecular pathways. While occlusive intimal lesions are composed predominantly of smooth-muscle-like cells (SMLCs), the origin of these cells and the stimuli leading to their accumulation in GVD are uncertain. Macrophages have recently been identified as both potential drivers of intimal hyperplasia and precursors that undergo transdifferentiation to become SMLCs in non-transplant settings. Colony-stimulating factor-1 (CSF1) is a well-known regulator of macrophage development and differentiation, and prior preclinical studies have shown that lack of CSF1 limits GVD. We sought to identify the origins of SMLCs and of cells expressing the CSF1 receptor (CSF1R) in GVD, and to test the hypothesis that pharmacologic inhibition of CSF1 signalling would curtail both macrophage and SMLC activities and decrease vascular occlusion.

Methods and results

We used genetically modified mice and a vascular transplant model with minor antigen mismatch to assess cell origins. We found that neointimal SMLCs derive from both donor and recipient, and that transdifferentiation of macrophages to SMLC phenotype is minimal in this model. Cells expressing CSF1R in grafts were identified as recipient-derived myeloid cells of Cx3cr1 lineage, and these cells rarely expressed smooth muscle marker proteins. Blockade of CSF1R activity using the tyrosine kinase inhibitor PLX3397 limited the expression of genes associated with innate immunity and decreased levels of circulating monocytes and intimal macrophages. Importantly, PLX3397 attenuated the development of GVD in arterial allografts.

Conclusion

These studies provide proof of concept for pharmacologic inhibition of the CSF1/CSF1R signalling pathway as a therapeutic strategy in GVD. Further preclinical testing of this pathway in GVD is warranted.

Keywords: Graft vascular disease, CSF1R, Macrophages, Transplantation

Graphical Abstract

Graphical Abstract.

Graphical Abstract

1. Introduction

Advances in immunosuppressive therapy have extended the short-term survival of solid organ transplants, making solid organ transplantation a common and effective treatment for patients with end-stage organ failure.1,2 Despite the success of these immunosuppressive regimens, one of the most important factors that limit long-term allograft survival is the development of graft vascular disease (GVD).3,4 The term GVD refers to the diffuse occlusive lesions that develop within the intimal space throughout the vasculature of the transplanted organ. These lesions are predominantly composed of cells that are often referred to as smooth-muscle-like cells (SMLCs) because they express some smooth muscle contractile genes.5 These lesions limit blood flow within the transplanted organ, often causing ischaemia and fibrosis and ultimately leading to graft failure.6 These neointimal lesions are characterized by a complex microenvironment, in which endothelial cells, SMLCs, immune cells, and extracellular matrix interact to drive intimal hyperplasia. GVD develops at an accelerated rate—typically within years—in contrast to atherosclerotic lesions, which are lipid-laden plaques that develop over multiple decades.7

The origin of neointimal cells has been controversial. To address neointimal cell origins in human transplant recipients, tissues from male recipients transplanted with female organs have been examined for Y-chromosome positive cells using in situ hybridization. Clinical studies of heart transplant recipients report a predominant donor-derived origin of neointimal SMLCs8 and chimerism in two studies,9,10 while analysis of GVD in clinical renal transplant samples shows both donor and recipient origins.11 Established preclinical models using aggressively rejected vascular grafts show a predominant recipient bone-marrow-derived neointimal cell origin,12 and in a preclinical cardiac allograft model, 86% of neointimal SMLCs were recipient-derived.13 However, the relatively severe immune responses of these models destroy donor vascular medial cells, potentially removing the pool of cells that contribute to intimal hyperplasia, whereas clinical GVD (with pharmacologic immunosuppression) shows minimal medial thinning.14 To address this discrepancy, a GVD model based on minor H-Y antigen mismatch has been described.15 In this model, minor antigens encoded by the Y-chromosome of male donor tissue elicit a relatively mild immune response in otherwise syngeneic female recipients, allowing preservation of the donor medial layer; however, the relative contribution of donor vs. recipient cells to neointima formation in this model has not been reported.15,16

Current immunosuppressive regimens target adaptive immune responses, with minor effects on innate immune cells such as macrophages, dendritic cells, and neutrophils.1,17 Emerging evidence supports a role for macrophages in GVD.18,19 Mice homozygous for the osteopetrotic (op) mutation (Csf1op/op) are deficient in colony stimulating factor-1 (CSF1), a critical regulator of monocyte/macrophage biology, and are characterized by monocytopenia and a reduction in a subset of tissue macrophages;20,21 vascular grafts placed in op/op mice develop minimal neointimal lesions.22 In addition, Hiroyasu et al., using a major histocompatibility complex (MHC) mismatch model of GVD and a series of genetically modified mice, reported that vascular grafts from Csf1op/op donors placed in wild-type (WT) mice also develop small neointimas and showed further that the cell surface isoform of CSF1 in donor and recipient tissues is sufficient to drive neointimal growth, altogether suggesting that CSF1 works locally within the allograft.23 Furthermore, CSF1 treatment of cultured neointimal cells induced their proliferation and migration.23 Cellular targets of CSF1 in neointimal lesions have not been thoroughly explored. It has been reported that cultured vascular smooth muscle cells (SMCs) can respond to treatment with CSF1 by increasing DNA synthesis and can also increase expression of Csf1r when stimulated with a combination of growth factors.24 In an experimental rabbit model of GVD, neointimal cells isolated from allografts responded to CSF1 by increasing proliferation.25 These in vitro studies suggest that aside from macrophages, neointimal SMLCs might also express the CSF1R and respond to CSF1. A thorough evaluation of CSF1R expression in vascular grafts in vivo has not been performed, and direct assessment of the importance of CSF1R-mediated signalling in GVD is lacking.

In this study, we have used a series of genetically modified mice and vascular transplant models of GVD to assess the origin of neointimal cells, the cellular expression of CSF1R in the neointima, and the effect of an inhibitor of CSF1R signalling on this process. Through lineage tracing studies, we find that neointimal cells originate from both donor and recipient and that CSF1R-expressing cells in the graft arise from cells in the recipient that have also expressed CX3C chemokine receptor 1 (Cx3cr1). Importantly, we also find that pharmacologic inhibition of CSF1R signalling reduces neointimal formation in vascular allografts. Inhibitors of CSF1R have been developed and are currently in clinical trials,26 so these preclinical findings suggest that a strategy for targeting key signalling pathways in the monocyte/macrophage lineage may be beneficial in extending allograft survival.

2. Methods

2.1 Mice

Male and female mice between 8 and 12 weeks old were used. A list of mouse strains can be found in Table 1 and mating strategy in Table 2. Methods for genotyping the mice were performed according to protocols established in the Jackson laboratory. Procedures followed the rules and regulations of the AAALAC and conform to the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes or the NIH Guide for the Care and Use of Laboratory Animals, and were approved by the Institutional Animal Care and Use Committee (IACUC) of the Albert Einstein College of Medicine. All animals were cared for in pathogen-free facilities at the Albert Einstein College of Medicine.

Table 1.

Animals (in vivo studies)

Species Vendor or source Strain namea Sex Persistent ID
Mouse The Jackson Laboratory C57BL/6J Male, Female Jax Stock # 000664
Mouse The Jackson Laboratory BALB/cJ Male Jax Stock # 000651
Mouse The Jackson Laboratory B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J Male Jax Stock # 007909
Mouse The Jackson Laboratory B6.Cg-Gt(ROSA)26Sortm3(CAG-EYFP)Hze/J Female Jax Stock # 007903
Mouse The Jackson Laboratory B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J Female Jax Stock # 025524
Mouse The Jackson Laboratory B6.Cg-Tg(Csf1r-EGFP)1Hume/J Male, Female Jax Stock # 018549
Mouse The Jackson Laboratory B6.FVB-Tg(EIIa-cre)C5379Lmgd/J Female Jax Stock # 003724
a

All strains were either C57BL/6J or backcrossed to C57BL/6J at Jackson Labs (with the exception of BALB/cJ mice).

Table 2.

Animal breeding

Species Vendor or source Strain namea Other information
Parent—Male Mouse The Jackson Laboratory B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J
Parent—Female Mouse The Jackson Laboratory B6.FVB-Tg(EIIa-cre)C5379Lmgd/J To generate Ella-Cre; Rosa26tdTomato mice
Parent—Male Mouse The Jackson Laboratory B6.Cg-Gt(ROSA)26Sortm3(CAG-EYFP)Hze/J
Parent—Female Mouse The Jackson Laboratory B6.FVB-Tg(EIIa-cre)C5379Lmgd/J To generate Ella-Cre; Rosa26YFP mice
Parent—Male Mouse The Jackson Laboratory B6.Cg-Gt(ROSA)26Sortm3(CAG-EYFP)Hze/J
Parent—Female Mouse The Jackson Laboratory B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J To generate Cx3cr1Cre/+; Rosa26YFP mice
Parent—Male Mouse The Jackson Laboratory B6.Cg-Tg(Csf1r-EGFP)1Hume/J
Parent—Female Mouse The Jackson Laboratory C57BL/6J
a

All strains were either C57BL/6J or backcrossed to C57BL/6J at Jackson Labs.

2.2 Carotid artery transplantation

In preparation for surgery, mice were anaesthetized with isoflurane through a nose cone (induction vaporizer at 4%, maintained at 1–2%). Orthotopic carotid artery transplantation with end-to-end anastomoses was performed according to our previously described technique.23 Transplant recipient mice received a subcutaneous injection of buprenorphine (0.01–0.05 mg/kg) perioperatively and once on post-operative day 1. Mice that did not show signs of acute graft thrombosis on post-operative day 1 were randomly assigned to receive control chow or chow formulated with PLX3397 (Plexxikon, Inc. with formulation per research diets, at 300 mg/kg) ad libitum, starting 1 day after surgery. For detailed surgical methods, see Supplementary material online, Methods.

2.3 Histological techniques

At 30 or 45 days after surgery, mice were euthanized by ketamine/xylazine intraperitoneal injection (75 and 5 mg/kg, respectively) and exsanguination and perfused systemically with phosphate buffer solution (PBS) for 1 min followed by 4 min perfusion with 10% neutral buffered formalin (NBF) under physiological pressure. Tissues were collected for analysis, with further fixation overnight in 10% NBF at 4° C followed by incubation in 70% ethanol. At each end of the graft sample, 1-mm sections were removed before embedding grafts in paraffin blocks so that only the central region of the graft—away from the sites of anastomosis—was analysed.

2.4 Morphometric analysis

Digital micrographs of haematoxylin & eosin-stained sections were obtained using a Leica DMi8 inverted microscope. Using the NIH Fiji program, the areas inside the external elastic lamina (EEL), internal elastic lamina (IEL), and luminal area (LA) were measured. The formula (IEL—LA)/(EEL—IEL) was used to calculate intima/media ratio and the formula (EEL—IEL) to calculate medial area.

2.5 Immunofluorescence of carotid arteries

Sections (5 µm) of paraffin-embedded arteries were subject to deparaffinization and rehydration followed by antigen retrieval by boiling tissue in sodium citrate solution (Vector Labs H-3300). Tissues were blocked in 0.3% triton-X100 and 5% normal horse serum in PBS for 1 h at room temperature. Tissues were incubated overnight at 4° C with primary antibodies. Fluorescence emission was visualized with a Leica DMi8 inverted microscope. Quantification of fluorescent signal was achieved by using the NIH Fiji program. Specificity of the observed epi-fluorescent signals was ensured by staining with non-specific, isotype-matched control primary antibodies and by omission of the primary antibodies. A detailed description of immunostaining can be found in Supplementary material online.

2.6 Flow cytometry

Mice fed with control chow or chow formulated with PLX3397 (300 mg/kg) for 30 days were anesthetized with isofluorane through a nose cone (vaporizer at 4%). A lancet was used to puncture the facial vein as previously described,27 and blood was collected into an EDTA-coated microtainer tube. After red blood cell lysis, leucocytes were stained with a LIVE/DEAD fixable blue dead cell stain kit (Invitrogen™, Cat No. L34961) followed by cell surface marker staining that included the following monoclonal antibodies: anti-CD3-PerCP Cy5.5, anti-B220-BV510, anti-CD11b-APC Cy7, anti-CSF1R-PE Cy7, anti-Ly6C-FITC, and anti-Ly6G-PE. Stained cells were analysed with a Becton Dickinson LSR II flow cytometer, and data were analysed using FlowJoTM software (BD Biosciences). Please see the expanded protocol in Supplementary material online.

2.7 RNA isolation

Whole carotid artery allografts from mice fed with control chow or PLX3397 formulated chow were harvested 30 days post-transplantation after exsanguination and systemic perfusion with PBS for 1 min. Samples were stored in RNAlater (Qiagen, Cat No. 76104). For RNA-seq, two allografts were pooled, snap-frozen in liquid nitrogen, and disrupted in mortar and pestle followed by phenol-chloroform extraction and ethanol precipitation of RNA. For real-time quantitative PCR (qPCR), RNA from individual allografts was reverse-transcribed to cDNA using Superscript III first strand synthesis system (Invitrogen 18080-051); cDNA was quantified using an SYBR Green qPCR kit (Applied Biosystems, Cat No. 4309155) and ViiA7 Real-time PCR system (Applied Biosystems). mRNA levels were normalized to β-actin and expressed as relative values in comparison with the specific control group using the comparative ΔΔCt method.

The following primers were used:

Myh11 (F 5′- catggacccgctaaatgaca -3′, R 5′- caatgcggtccacatccttc -3′);

C1qa (F 5′- ctcagggatggctggtggcc -3′, R 5′- cctttgagacccggcctcccc -3′);

Ccl8 (F 5′- cgcagtgcttctttgcctg -3′, R 5′- tctggcccagtcagcttctc -3′);

Acta2 (F 5′- aacgccttccgctgccc -3′, R 5′- cgatgcccgctgactcc -3′);

Csf1r (F 5′- tgctaaagtccacggctcat-3′, R 5′- cgtgagtacaggctcccaag-3′);

Tnfrs11a (F 5′- ctgcctctgggaacgtgactgg -3′, R 5′- ggctgacatacaccacgatg -3′);

Beta-actin (F 5′- ctaaggccaaccgtgaaaag-3′, R 5′- accagaggcatacagggaca-3′);

Igj (Bio-Rad, Cat No. qMmuCID0023260);

Ighg2c (Bio-Rad, Cat No. qMmuCID0040557).

2.8 Standard RNA-Seq library preparation with rRNA depletion and HiSeq sequencing

Sample quality control (QC), library preparations, and sequencing reactions were conducted at GENEWIZ, LLC. (South Plainfield, NJ, USA). An expanded protocol for Standard RNA-Seq Library Preparation with rRNA depletion and HiSeq Sequencing and standard RNA-Seq Data analysis can be found in Supplementary material online.

2.9 Statistical analysis

Statistical analysis was performed using GraphPad Prism version 8 software. For comparison of two groups with data that follow a normal distribution based on D'Agostino–Pearson normality test, one-tailed or two-tailed unpaired t-test was used when appropriate. For comparison of three groups determined to have normal distribution by the Kolmogorov–Smirnov test, analysis of variance (ANOVA) with Tukey’s post-hoc tests was used. Significance was accepted when P < 0.05. A power analysis was used to estimate the number of mice used in the in vivo inhibitor studies. Each n represents an independent animal. For in vitro studies, each n represents a biological replicate.

3. Results

3.1 Neointimal lesions in vascular grafts can arise from both donor- and recipient-derived cells

We adapted a mouse orthotopic aortic graft model of GVD based on H-Y antigenicity of male tissues placed in female recipients of the same strain—this mismatch elicits a mild immune response against the graft while preserving donor medial cells.16 We performed orthotopic carotid artery grafts as previously described,23 placing male arteries in female recipients. To assess the relative contributions of donor- and recipient-derived cells to neointimal lesions in vascular allografts, we generated donors and recipients that ubiquitously express distinct fluorescent proteins by crossing Ella-Cre mice, in which Cre recombinase is expressed at the zygotic stage,28 with Rosa26tdTomato (B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J) or Rosa26YFP (B6.Cg-Gt(ROSA)26Sortm3(CAG-EYFP)Hze/J) mice.29 Cre-mediated recombination in these mouse lines excises a loxP-flanked stop cassette to activate expression of red and yellow fluorescent proteins (tdTomato or RFP, and YFP), respectively. The specificity of epi-fluorescent signals generated with primary antibodies was assessed using isotype-matched, non-specific antibody controls (Supplementary material online, Figure S1A–H) and by omission of primary antibodies (not shown). We confirmed the expression of fluorescent marker proteins in carotid arteries of 8-week-old mice (Supplementary material online, Figure S2). Ella-cre; Rosa26tdTomato male mice were used as arterial graft donors, and Ella-Cre; Rosa26YFP female mice were used as graft recipients (Supplementary material online, Figure S3A). To identify donor- and recipient-derived cells at day 30 post-transplantation, we stained mid-graft sections with antibodies that recognize tdTomato (donor cells) and YFP (recipient cells). Interrupted lines were drawn over the elastic lamina, which was visible due to autofluorescence, to identify neointimal area. Although most grafts showed that donor and recipient contributions to neointimal cellularity were fairly similar in magnitude, we also observed samples in which nearly all neointimal cells arose from the recipient (Supplementary material online, Figure S3B and C). To determine the origins of labelled neointimal SMLCs, we co-stained for tdTomato, YFP, and ACTA2, and found that 55% and 45% of neointimal SMLCs derived from the donor and recipient, respectively (Supplementary material online, Figure S3D and E); in a transplanted artery with very high recipient-derived neointima, nearly all SMLCs were likewise of recipient origin. Interestingly, we observed that luminal RFP+ cells express the endothelial cell marker CD31 in most allografts. In the allograft that showed a predominant recipient-derived origin of SMLCs, we observed a prominent recipient-derived origin of CD31+ cells (Supplementary material online, Figure 3F and G). Our results indicate although allograft medial cellularity is generally preserved in this minor histocompatibility antigen mismatch model of GVD, there is substantial variability in the extent of donor- vs. recipient-derived contributions to neointima formation, and that luminal CD31+ cells and neointimal ACTA2+ SMLCs can arise from either donor or recipient.

Figure 3.

Figure 3

PLX3397 alters the expression of genes associated with innate immune response. RNA sequencing of whole allografts from control chow or chow formulated with PLX3397 fed mice at day 30 post-transplantation. (A) Principle component analysis showing the variance between groups. Each dot represents a pool of two vascular grafts. (B) Volcano plot. Red dots indicate significantly up-regulated genes, blue dots represent down-regulated genes in PLX3397-treated allografts compared to chow controls. False discovery rate (FDR) adjusted P < 0.05. (C) Validation of indicated genes by qPCR. Data represent the mean ± SEM, control n = 6, PLX3397 n = 5 (C). Statistics were performed using unpaired one-tailed t-test (C). C1qa P = 0.005, Ccl8 P = 0.021, Csf1r P = 0.037, Acta P = 0.190, Myh11 P = 0.253, Tnfrs11a P = 0.041, Igj P = 0.316, Ighgc2 P = 0.137 (C). (D) Gene ontology of the top 10 statistically significant set of genes. n = 4 per group A–C. Statistics were performed using the Wald test to generate P-values and log2 fold changes. Genes with adjusted P-values < 0.05 and absolute log2 fold changes > 1 were called as differentially expressed genes.

3.2 CSF1R in allografts is expressed in recipient cells of myeloid lineage

Our previous studies suggested a role for localized CSF1 activity within the allograft.23 To understand cellular participants in this signalling network, we sought to identify the pattern of expression of CSF1R, which is the only known target for the CSF1 ligand. In studies of non-transplanted adult carotid arteries (contralateral to the transplant site), we were unable to detect CSF1R+ cells staining with an antibody that recognizes the CSF1R C-terminus (Supplementary material online, Figure S4A). To evaluate CSF1R expression in transplanted arteries, isografts and allografts were collected 30 days after surgery and characterized by immunofluorescence (Figure 1A). We observed an accumulation of CSF1R+ cells in the neointima of allografts, while isografts lacked both neointima and CSF1R signal (Figure 1B, C).

Figure 1.

Figure 1

CSF1R in allografts is expressed in recipient cells of myeloid lineage. (A) Schematic of transplantation pairs. (B) Immunostaining for CSF1R, a macrophage marker, MYH11, a smooth muscle marker, and DAPI in carotid artery transplants 30 days post-transplantation. Arrowhead marks CSF1R+ cells. (C) Quantification of neointimal CSF1R+ cells. Data represent the mean ± SEM, n = 3 per group. (D) Schematic of transplantation pairs. Unlabelled vascular grafts were transplanted into MacGreen recipient mice, which expressed enhanced green fluorescent protein (EGFP) under the Csf1r promoter. (E) Immunostaining for EGFP, MYH11, and DAPI in allografts 30 days post-transplantation. (F) Quantification of medial and neointimal EGFP+ area. Data represent the mean ± SEM (n = 5). (G) Schematic of transplantation pairs. Carotid arteries from MacGreen mice were transplanted into unlabelled recipient mice. (H) Immunostaining for EGFP and MYH11 in vascular grafts 30 days post-transplantation. (I) Quantification of medial and neointimal EGFP+ area. Data represent the mean ± SEM (n = 4). (J) Schematic of transplantation pairs. Unlabelled grafts transplanted into Cx3cr1-Cre; Rosa26YFP recipient mice. (K) Immunostaining for YFP, CSF1R, and α smooth muscle actin (ACTA2), a smooth muscle marker, in allografts 30 days post-transplantation. (L) Quantification of neointimal cells of Cx3cr1-lineage (YFP+) in terms of CSF1R expression (CSF1R+, CSF1R−) or double positive for CSF1R and ACTA2. Data represent the mean ± SEM (n = 3). (M) Immunostaining for YFP, allograft inflammatory factor 1 (AIF1), a macrophage marker, and ACTA2 in allografts 30 days post-transplantation. (N) Quantification of neointimal cells of Cx3cr1-lineage (YFP+) in terms of AIF1 expression (AIF1+, AIF1−) or double positive for AIF1 and ACTA2. Data represent the mean ± SEM (n = 3). Dotted lines mark the internal elastic lamina. NI, neointima, M, media. Scale bar 20 µm. Statistics were performed using unpaired two-tailed t-test (C, F, I) or one-way ANOVA with Tukey’s multiple comparisons test (L, N).

To determine donor or recipient origin of CSF1R+ cells, vascular grafts from WT male mice were transplanted into B6.Cg-Tg(Csf1r-EGFP)1Hume/J (MacGreen)30 transgenic female recipients in which EGFP expression serves as a marker of cells with active Csf1r promoter30 (Figure 1D). In allografts, approximately less than 9% of medial area and 30% of neointimal area stained positive for EGFP at day 30 post-transplantation (Figure 1E, F). Furthermore, EGFP+ cells did not express MYH11, a marker of differentiated smooth muscle cells, although these cells were found in close proximity (Figure 1E). We then wanted to know if donor-derived cells activated the Csf1r promoter under the in vivo inflammatory conditions observed in GVD, so we transplanted grafts from MacGreen transgenic male mice into WT C57BL/6 female recipients (Figure 1G), analysed grafts 30 days post-transplantation, and assessed EGFP expression by immunofluorescence. Interestingly, we could not detect EGFP+ cells in vascular allografts (Figure 1H, I), while untransplanted carotid arteries from MacGreen mice showed few EGFP+ cells in the adventitia and perivascular space (Supplementary material online, Figure S4B). These observations are consistent with the idea that CSF1R is induced in the arterial media and neointima upon GVD, and is mainly expressed in cells from the recipient that are not MYH11+.

To test further whether vascular smooth muscle cells could express CSF1R, we studied early passage mouse aortic smooth muscle cells (MASMCs) in culture and assessed CSF1R expression in response to mitogens such as platelet-derived growth factor BB (PDGF) and epidermal growth factor (EGF) or interferon gamma (IFN-γ), as previously reported.15,31 Treatment with PDGF or EGF significantly increased extracellular signal-regulated kinase (ERK) phosphorylation, indicating the integrity of the expected downstream signalling pathway (Supplementary material online, Figure S5A and B); however, PDGF and EGF treatment failed to induce any detectable levels of CSF1R in MASMCs as assessed by Western blotting (Supplementary material online, Figure S5C). Because IFN-γ has been shown to play a critical role in the development of GVD in mice,32 we also treated MASMCs with IFN-γ. This induced phosphorylation of signal transducer and activator of transcription 3 (STAT3) after 15 min of exposure, confirming activation of the downstream signalling pathway, but we were nevertheless unable to detect CSF1R by Western blotting after 48 h of IFN-γ treatment (Supplementary material online, Figure S5D–F). These studies further support the idea that vascular smooth muscle cells are an unlikely source of CSF1R-expressing cells.

CSF1R expression has been reported in cells of the mononuclear phagocyte system.33 To evaluate whether CSF1R+ cells observed within the allografts are of the myeloid lineage, we generated Cx3cr1Cre/+; Rosa26YFP mice to label cells of Cx3cr1-lineage.34 We transplanted vascular grafts from unlabelled WT male mice into Cx3cr1Cre/+; Rosa26YFP female recipients (Figure 1J). In allografts harvested at day 30 and assessed for expression of YFP, CSF1R, and ACTA2, we found that approximately 85% of cells of Cx3cr1-lineage (YFP+) co-expressed CSF1R, 12% were CSF1R negative, and 3% co-expressed CSF1R and ACTA2 (Figure 1K, L). Similarly, the great majority of YFP+ cells co-expressed another macrophage marker, AIF1, and rarely co-expressed AIF1 and ACTA2 (Figure 1M, N). This suggests that CSF1R-expressing cells within vascular grafts are of myeloid origin and recruited to the graft, wherein they contribute to neointimal cell population, but rarely become neointimal SMLCs.

3.3 PLX3397, an inhibitor of CSF1R signalling, depletes circulating monocytes in mice

Based on previous studies of CSF1 in GVD22,23 and our identification of cells that express CSF1R in the neointima and media of vascular grafts (Figure 1), we sought to further characterize the role of CSF1R signalling in GVD. We pursued a pharmacologic approach using PLX3397, an orally administered small molecule that blocks CSF1R signalling with high specificity, but is well tolerated and does not affect body weight in mice.26,35 In initial studies, we fed WT C57BL/6J mice with normal chow or chow formulated with PLX3397 (300 mg/kg) for 30 days and performed flow cytometric analyses of peripheral blood samples. Control and PLX3397-treated mice showed no differences in B cells (B220+), T cells (CD3+), or neutrophils (Ly6G+) (Supplementary material online, Figure S6A–D). Lymphocyte antigen 6C (Ly6C) expression can identify two monocyte populations in mice34; we also noted a population with intermediate levels of Ly6C expression (Figure 2A). We observed reductions in the Ly6C− and Ly6Cint monocyte subsets within the CD11b+; CSF1R+ population, but no change in the Ly6C+ subset in PLX3397-treated mice (Figure 2A–D). This is consistent with previous findings using neutralizing monoclonal antibody to CSF1R at steady state,36 and suggests that CSF1R activity is particularly important for maturation of Ly6C+ to Ly6C− monocytes.

Figure 2.

Figure 2

PLX3397, an inhibitor of CSF1R signalling, depletes circulating monocytes in mice. Leucocytes were isolated from blood of C57BL/6 mice following 30 days of feeding with chow or chow formulated with PLX3397; monocytes were monitored by flow cytometry. (A) Flow cytometry plots of Ly6C+ CSF1R+ monocytes within CD11b+ Ly6G− populations. (B) Quantification of the percentage of Ly6C+ CSF1R+ population. (C) Quantification of the percentage of Ly6Cint CSF1R + populations. (D) Quantification of the percentage of Ly6C− CSF1R + populations. Int, intermediate. Data represent the mean ± SEM, n = 5 per group. Statistics were performed using unpaired one-tailed t-test (B–D).

3.4 RNA sequencing of PLX3397-treated allografts shows significant changes in pathways associated with innate immune response

We wanted to know how the inhibitor of CSF1R signalling affected vascular allografts, in addition to the changes in circulating monocytes that we described above. In view of the recipient-derived CSF1R+ neointimal composition noted above, for these and subsequent studies that did not require lineage tracing, we used a standard allograft combination with BALB/c donor and C57BL/6 recipient mice, which results in a predominant recipient-derived neointimal cell origin, to explore the effect of CSF1R inhibition on GVD.37 We pooled two vascular grafts for a total of four grafts from control or PLX3397-treated mice and performed RNA-seq analysis. The transcriptomes of PLX3397-treated grafts appeared distinct from those of the control, as shown by principal component analysis (Figure 3A). The global transcriptional change across the groups uncovered 475 differentially expressed genes. Most of the sequences that increased with PLX3397 treatment were related to immunoglobulins—for example, we found increases in 9 Igkv, 11 Ighv genes, 5 Igkj, 4 Ighj genes, and 3 Ighg genes, as well as in Igkc, Ighg2c, and IgJ. For reasons that remain uncertain, increases in immunoglobulin transcripts were generally not validated by qPCR methods (Figure 3C). A larger number of genes, 355, were down-regulated in PLX3397-treated allografts (Figure 3B). The top 25 down-regulated genes are listed in Table 3; notably, most of these are known to be expressed in macrophages. In qPCR validation studies, we confirmed down-regulation of C1qa, Ccl8, Csf1r and Tnfrs11a, while Acta2 and Myh11 followed a trend but did not achieve statistical significance (Figure 3C). To gain insight into the biological processes underlying the observed global transcriptional change in allografts treated with PLX3397, a gene ontology (GO) analysis of differentially expressed genes was performed. The top ontology groups identified in this analysis included innate immune response, immune system process, and inflammatory response (Figure 3D, Supplementary material online, Tables S1–S5).38 These results are consistent with the idea that PLX3397 reduces the accumulation or recruitment of monocyte-derived macrophages in vascular grafts.

Table 3.

Top 25 down-regulated genes in allografts from PLX3397-treated vs. control mice

Gene log2 fold change Adjusted P-value
C1qa −2.18 0
C1qb −2.13 0
C1qc −2.28 0
Card9 −1.16 0.02
Cd14 −1.26 0.01
Cd40 −1.4 0.01
Cfp −1.18 0.03
Clec4a2 −1.37 0
Csf1r −1.46 0
Cybb −1.15 0.03
Fcna −1.78 0
Havcr2 −1.32 0.02
Hck −1.25 0.04
Il27 −1.48 0.03
Irf5 −1.2 0.02
Lyn −1.26 0.02
Ly86 −1.99 0
Nlrc4 −1.23 0.02
Nrros −1.23 0.02
Ticam2 −1.15 0.04
Tlr1 −1.21 0.03
Tlr11 −1.58 0
Tlr7 −1.61 0
Tlr8 −1.33 0.01

3.5 PLX3397 reduces expression of macrophage and smooth muscle cell markers in the neointima

Because lineage tracing studies showed that CSF1R+ cells within allografts are recipient-derived myeloid cells (Figure 1) and transcriptomic analysis of PLX3397-treated grafts showed a reduction of genes typically expressed in macrophages (Table 3), we then asked if a major effect of PLX3397 was the reduction of macrophage populations in neointimal lesions. Carotid artery grafts were placed in recipients that were subsequently assigned to control or PLX3397 chow (Figure 4A). After 30 days, we assessed expression of CSF1R protein in neointimas and found a significant reduction. We confirmed this result by testing two other macrophage-related proteins, Mac2 and AIF1, and found significantly lower levels of these proteins in the PLX3397 group (Figure 4B– G). Interestingly, PLX3397 also reduced ACTA2 levels within the neointima of allografts, but we observed no differences in the expression of MYH11 by immunofluorescence (Figure 4H– K); the drop in ACTA2 levels could result in part from PLX3397 acting on the relatively small population of CSF1R+, ACTA2+ cells (Figure 1), whereas the stable MYH11 signal stems from SMCs that do not express CSF1R and are not susceptible to the inhibitor. As T cells are known to be important drivers in GVD, we also assessed T cell infiltration by staining with CD3 antibody and found no differences in the percentage of CD3-positive cells in the adventitia or neointima between chow and PLX3397-treated allografts (Supplementary material online, Figure S7A–C).

Figure 4.

Figure 4

PLX3397 reduces expression of macrophage and smooth muscle cell markers in the neointima. (A) Schematic of transplantation pairs. BALB/c vascular grafts were transplanted into WT C57BL/6 recipient mice and randomly assigned to chow or chow formulated with PLX3397. (B) Immunostaining for CSF1R, a macrophage marker. (C) Quantification of CSF1R in neointimal lesions. Data represent the mean ± SEM, control n = 7, PLX3397 n = 11. (D) Immunostaining for AIF1, a macrophage marker. (E) Quantification of AIF1 in neointimal lesions. Data represent the mean ± SEM, control n = 7, PLX3397 n = 10. (F) Immunostaining for Mac2, a macrophage marker. (G) Quantification of Mac2 in neointimal lesions. Data represent the mean ± SEM, control n = 8, PLX3397 n = 10. (H) Immunostaining for α smooth muscle actin (ACTA2), a smooth muscle cell marker. (I) Quantification of ACTA2 in neointimal lesions. Data represent the mean ± SEM, control n = 10, PLX3397 n = 11. (J) Immunostaining for Myosin heavy chain 11 (MYH11), a smooth muscle cell marker. (K) Quantification of MYH11 in neointimal lesions. Data represent the mean ± SEM, control n = 15, PLX3397 n = 15. Dotted line marks the internal elastic lamina. MFI, mean fluorescence intensity. r.u., relative units. Scale bar 20 µm. Statistics were performed using unpaired one-tailed t-test (C, E, G, I, and K).

As noted above (Supplementary material online, Figure S5), we could not detect CSF1R expression in MASMCs. Because CSF1R expression below the detection limits of western blot analysis might still be functionally relevant, we tested whether PLX3397 could affect growth or migration of SMCs. MASMCs treated with PLX3397 showed no change in growth at concentrations less than 200 uM, a response that argues against CSF1R-specific signalling in these cells (Supplementary material online, Figure S8B). Similarly, MASMCs treated with PLX3397 showed no change in migration in an in vitro scratch wound healing assay (Supplementary material online, Figure S9). For reference, Bac1.2F cells (a CSF1-dependent murine macrophage cell line)39 treated with PLX3397 showed reduced growth at concentrations as low as 0.2 pM (Supplementary material online, Figure S8A).

Collectively, our results show that PLX3397, an inhibitor of CSF1R signalling, reduces both macrophage and ACTA2+ cells within neointimal lesions in a mouse model of GVD, and suggest that the primary effect of this inhibitor is on cells of monocyte–macrophage lineage.

3.6 PLX3397 limits neointima formation in vascular allografts

Given the negative effect of PLX3397 on macrophage and ACTA2+ cells in neointimal lesions of vascular grafts (Table 3, Figure 4), we wanted to know whether PLX3397 inhibits neointimal growth in the mouse model of GVD described in Figure 4A. We performed graft morphometry at 30 days post-transplantation, a timepoint close to the peak of expression of Csf1r transcripts,23 analysing H&E photomicrographs to quantify intimal and medial areas (Figure 5). Importantly, we found a 42% reduction in intimal area in grafts from PLX3397-treated mice compared to controls, and no significant difference in medial area (Figure 5B, C). Moreover, PLX3397 reduced the intima/media ratio by 54% (Figure 5D).

Figure 5.

Figure 5

PLX3397, an inhibitor of CSF1R signalling, limits neointima in vascular allografts. (A) Representative haematoxylin and eosin (H&E) staining of arterial grafts 30 days post-transplantation collected from mice that received chow or chow formulated with PLX3397. (B) Quantification of intimal area. (C) Quantification of medial area. (D) Neointimal growth calculated by intima/media ratio. Data represent the mean ± SEM, control n = 13, PLX3397 n = 15. (E) Representative H&E staining of arterial grafts 45 days post-transplantation collected from mice that received chow or chow formulated with PLX3397. (F) Quantification of intimal area. (G) Quantification of medial area. (H) neointimal blockage calculated by intima/media ratio. Data represent the mean ± SEM, control n = 16, PLX3397 n = 16. White dotted lines mark the internal elastic lamina. Scale bar 20 µm. Statistics were performed using unpaired one-tailed t-test (B–D, F–H).

In previous work, we found that levels of Csf1 and Csf1r transcripts, as well as those of inflammatory Tnf-α and Ifn-γ transcripts, decreased in allografts between 28 and 42 days after transplantation.23 In the present study, we found no PLX3397-mediated difference in perivascular inflammation (assessed by quantifying perivascular nuclei) at day 30, but a decrease in perivascular cellularity at day 45 in PLX3397-treated mice (Supplementary material online, Figure 10). In view of our prior findings that showed neointimal formation despite reduced graft inflammation with expression of the cell surface, but not secreted isoform of CSF1,23 we also assessed allograft morphometry at day 45 post-transplantation. This analysis showed a trend towards reduction in intimal area and a 36% reduction in intima/media ratio (Figure 5F, H). These results indicate that treatment with PLX3397, an inhibitor of CSF1R signalling, decreases perivascular cellularity and limits neointimal lesion formation in allogeneic arterial grafts.

4. Discussion

GVD occurs despite the use of immunosuppressive drugs, and specific treatment options are very limited. Several studies have suggested a role for the monocyte/macrophage lineage in allograft rejection.17,19 Previous studies identified a functional role for CSF1 in GVD.22,23 There is a lack of understanding, however, of the cellular targets of CSF1/CSF1R signalling in GVD. The studies we report now are the first to identify the pattern of expression of CSF1R+ cells in a preclinical model of GVD and to characterize the role of CSF1R signalling in the progression of intimal obstruction. Our lineage tracing studies indicate that neointimal SMLCs, which constitute a major part of the obstructive lesion, are of both donor and recipient origin and that intimal CSF1R-expressing cells are recruited from the recipient. We show that treatment with the CSF1R inhibitor PLX3397 reduced (i) circulating Ly6C− CSF1R+ monocytes, (ii) expression of macrophage-related genes in graft transcriptomes, and (iii) expression of three macrophage marker proteins in allografts. Importantly, we found that treatment with PLX3397 reduced the extent of neointimal lesions and luminal compromise.

The origin of neointimal SMLCs in preclinical models has been controversial. As noted above, models with MHC mismatch result in neointimas comprised largely of recipient bone-marrow-derived SMLCs,12,13 but this pattern may differ from that seen in clinical GVD, in which pharmacologic immunosuppression protects the vascular media and maintains its potential as a source of neointimal cells. As an alternative, the minor histocompatibility antigen mismatch model of GVD may improve upon these models due to the milder immune response and the associated preservation of medial cells.15 We employed this model to identify the origins of neointimal cells, and through global labelling of cells, we found that neointimal SMLCs originate from both donor and recipient. Our findings provide evidence that the minor histocompatibility antigen model of GVD develops neointimal lesions that may more closely represent what is observed in clinical heart transplants, where neointimal SMLCs are of both donor and recipient origins.9 While we believe the minor histocompatibility mismatch model generally represents a methodologic advance, we still observed some variability, including loss of medial cells and skewing of neointimal populations towards a recipient origin. Although all mouse strains used in our lineage tracing studies are on a C57BL/6 background, small differences in the genetic background may contribute to the variation in origin of neointimal cells. Additional non-genetic factors could include minor differences in surgical anastomosis, blood flow patterns, and medial preservation, together indicating that the model is still subject to variation.

Possible sources of neointimal SMLCs from the donor may derive from medial smooth muscle cells40 while host bone marrow, non-bone-marrow-derived c-kit+ cells and circulating progenitor cells are possible sources of neointimal SMLCs from the recipient.12,41,42 Neointimal SMLCs might also arise via trans-differentiation, which can occur between cells of macrophage and smooth muscle lineages and has been reported in other models of vascular disease, including atherosclerosis.43 To explore the possibility of such trans-differentiation in the setting of allotransplantation-induced vascular remodelling, we used MacGreen mice, which express EGFP in cells with active Csf1r promoter, as either graft donor or graft recipient. We found that neointimal cells with an active Csf1r promoter were strictly of recipient origin, and these cells did not express the most specific SMC marker, MYH11. These results indicate that CSF1R-expressing cells in the graft are of recipient but not donor origin, and that trans-differentiation of these cells is not a major source of SMLCs in GVD lesions.

To evaluate these findings further, we generated mice that express YFP in cells of Cx3cr1-lineage to label monocytes/macrophages in the recipient. We found that cells of Cx3cr1-lineage expressed two macrophage markers, CSF1R and AIF1, but rarely expressed the SMC marker ACTA2. Interestingly, early reports suggest that SMCs in culture could express Csf1r upon growth factor stimulation.31 In our studies, however, IFN-γ or combinatorial treatment of PDGF-BB and EGF treatment of isolated MASMCs did not result in detectable levels of CSF1R. Furthermore, we investigated whether SMCs could express the CSF1R in an inflammatory milieu such as allotransplantation and found that SMLCs are an unlikely source of CSF1R compared to myeloid cells of Cx3cr1-lineage, in which CSF1R expression was easily detected. Collectively, these experiments suggest that macrophages are recruited to vascular grafts but rarely contribute to the population of neointimal SMLCs.

We next investigated whether blockade of CSF1R signalling would reduce neointima formation. Our rationale for testing PLX3397 in the development of GVD is based on the following: 1) the observation that the cell surface isoform of CSF1 is sufficient to drive GVD23; 2) PLX3397, an orally available tyrosine kinase inhibitor that selectively targets CSF1R, has been shown to reduce tissue macrophages and is currently in phase 3 clinical trial in the treatment of tenosynovial giant cell tumour;44,45 and 3) we found cells with an active Csf1r promoter or expressing CSF1R protein in the neointima and media of vascular grafts. CSF1R, a tyrosine kinase transmembrane receptor, is a well-known regulator of mononuclear cell survival and differentiation.33 Our findings show for the first time that the CSF1R inhibitor PLX3397 reduces expression of macrophage-related genes in graft transcriptomes, plus the expression of three different macrophage proteins in vascular grafts, as well as ACTA2, a traditional smooth muscle marker that can be expressed in some macrophage-derived cell populations.43 These findings suggest that PLX3397 limits the macrophage population in allografts, and this in turn may directly or indirectly restrict accumulation of neointimal SMLCs. Importantly, the net effect of this inhibitor is to reduce neointima formation in a mouse model of GVD. Together these results support a role for CSF1R signalling in macrophages as an important driver of GVD.

Although arterial graft transplantation to study GVD is a useful tool to gain insight into mechanisms that affect disease progression, there are some limitations. We found a reduction in the Ly6C− CSF1R+ monocyte population consistent with studies showing that Ly6C+ monocytes are precursors for the mature Ly6C− monocytes34 and that administration of anti-CSF-1R monoclonal antibody specifically lowered the Ly6C− monocyte population.36 Although little is known about the specific function of Ly6C− monocytes in GVD, this cell population may contribute to the generation of wound healing macrophages46 and cardiac tissue remodelling,47 and in the expression of macrophage-related genes within allografts in the PLX3397-treated group. These observations suggest that this inhibitor decreases the macrophage population in vascular grafts. As macrophages may express genes involved in wound healing and blood vessel remodelling such as platelet-derived growth factor (PDGF), transforming growth factor b1 (TGF-b1), insulin-like growth factor 1 (IGF-1), vascular endothelial growth factor a (VEGF-a), and matrix metalloproteinases (MMPs),48 it is possible that PLX3397 modulates pathways involved in the recruitment of ACTA2+ neointimal cells in GVD. More detailed analysis of cellular populations within arterial grafts in the presence or absence of PLX3397 was not possible due to insufficient material to perform fluorescence-activated cell sorting (FACS). In other systems, CSF1R activity has been associated with polarization of macrophages towards an M2-like repair or trophic phenotype,49 with inhibition yielding opposite effects.50 While such an effect might also contribute to decreased neointimal volume, our RNA-seq analysis did not reveal systematic effects on a panel of M1 vs. M2 macrophage polarization markers. An additional possibility is that PLX3397 might have an effect on the recruitment of recipient-derived c-Kit+ neointimal SMLCs.42 A complementary approach that might permit further analysis of the effects of PLX3397 on allograft cell populations is the use of a solid organ transplantation model, such as heterotopic heart transplantation.

In summary, our study provides evidence that the minor antigen histocompatibility mismatch model of GVD is suitable for further investigation of cell lineages that contribute to neointimal lesion formation, as we show that cells derived from both donor and recipient are well-represented in the neointimas that form in this model. We have also provided evidence that CSF1R expression is induced in vascular allografts and restricted to recipient cells of Cx3cr1-expressing lineage. In addition, we show that pharmacologic inhibition of CSF1R signalling with PLX3397 reduces the population of circulating monocytes and allograft-associated macrophage marker expression, and limits neointima formation in a mouse model of GVD. Collectively, our study suggests that targeting the monocyte/macrophage lineage may be useful as a means to extend allograft survival.

Supplementary Material

cvab289_Supplementary_Data

Acknowledgements

The authors would like to acknowledge the contributions of L. Tesfa from the Einstein Flow Cytometry Core Facility and of R. Basu from the Einstein Histology & Comparative Pathology Core. We would like to acknowledge Plexxikon, Inc. for providing PLX3397 under a Materials Transfer Agreement.

Funding

This work was supported by a National Institute of Health Predoctoral Individual National Research Service Award [NIH F31HL144041 to V.M.A.], the Training Program in Cellular and Molecular Biology and Genetics [T32 GM007491 to V.M.A.], Career Development Award from the American Heart Association [19CDA34660217 to D.F.R.B.], and National Institute of Health Research Project Grant Program Awards [R01128066 and R01HL133861 to N.E.S.S.].

Contributor Information

Vanessa M Almonte, Department of Medicine (Cardiology Division), Wilf Family Cardiovascular Research Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA; Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Unimunkh Uriyanghai, Department of Medicine (Cardiology Division), Wilf Family Cardiovascular Research Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA; Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Lander Egaña-Gorroño, Department of Medicine (Cardiology Division), Wilf Family Cardiovascular Research Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA; Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Dippal Parikh, Department of Medicine (Cardiology Division), Wilf Family Cardiovascular Research Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA; Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Gustavo H Oliveira-Paula, Department of Medicine (Cardiology Division), Wilf Family Cardiovascular Research Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA; Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Jinghang Zhang, Department of Microbiology & Immunology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Smitha Jayakumar, Department of Medicine (Cardiology Division), Wilf Family Cardiovascular Research Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA; Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Dario F Riascos-Bernal, Department of Medicine (Cardiology Division), Wilf Family Cardiovascular Research Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA; Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Nicholas E S Sibinga, Department of Medicine (Cardiology Division), Wilf Family Cardiovascular Research Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA; Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA.

Data Availability

The data underlying this article will be shared on reasonable request to the corresponding author. The RNA-seq data are available in figshare, at https://dx.doi.org/10.6084/m9.figshare.14998113.

Translational perspective

GVD is a major limitation to the long-term success of clinical solid organ transplantation. Currently, there are no effective treatment options to prevent the development of neointimal lesions that obstruct blood flow to the graft. In this study, we found that PLX3397, a selective inhibitor of CSF1R signalling, reduced the accumulation of macrophages and ACTA2+ cells within neointimal lesions in a preclinical model of GVD. Our study highlights a promising role for the pharmacologic targeting of CSF1R signalling to further study the molecular mechanisms that regulate allotransplantation-induced vascular remodelling.

References

  • 1. Enderby  C, Keller  CA.  An overview of immunosuppression in solid organ transplantation. Am J Manag Care  2015;21:s12–s23. [PubMed] [Google Scholar]
  • 2. Yusen  RD, Edwards  LB, Kucheryavaya  AY, Benden  C, Dipchand  AI, Goldfarb  SB, Levvey  BJ, Lund  LH, Meiser  B, Rossano  JW, Stehlik  J.  The Registry of the International Society for Heart and Lung Transplantation: thirty-second official adult lung and heart-lung transplantation report–2015; focus theme: early graft failure. J Heart Lung Transplant  2015;34:1264–1277. [DOI] [PubMed] [Google Scholar]
  • 3. Lee  MS, Tadwalkar  RV, Fearon  WF, Kirtane  AJ, Patel  AJ, Patel  CB, Ali  Z, Rao  SV.  Cardiac allograft vasculopathy: a review. Catheter Cardiovasc Interv  2018;92:E527–E536. [DOI] [PubMed] [Google Scholar]
  • 4. Bagnasco  SM, Kraus  ES.  Intimal arteritis in renal allografts: new takes on an old lesion. Curr Opin Organ Transplant  2015;20:343–347. [DOI] [PubMed] [Google Scholar]
  • 5. Mitchell  RN.  Graft vascular disease: immune response meets the vessel wall. Annu Rev Pathol  2009;4:19–47. [DOI] [PubMed] [Google Scholar]
  • 6. Angelini  A, Castellani  C, Fedrigo  M, de Boer  OJ, Meijer-Jorna  LB, Li  X, Valente  M, Thiene  G, van der Wal  AC.  Coronary cardiac allograft vasculopathy versus native atherosclerosis: difficulties in classification. Virchows Arch  2014;464:627–635. [DOI] [PubMed] [Google Scholar]
  • 7. Rahmani  M, Cruz  RP, Granville  DJ, McManus  BM.  Allograft vasculopathy versus atherosclerosis. Circ Res  2006;99:801–815. [DOI] [PubMed] [Google Scholar]
  • 8. Atkinson  C, Horsley  J, Rhind-Tutt  S, Charman  S, Phillpotts  CJ, Wallwork  J, Goddard  MJ.  Neointimal smooth muscle cells in human cardiac allograft coronary artery vasculopathy are of donor origin. J Heart Lung Transplant  2004;23:427–435. [DOI] [PubMed] [Google Scholar]
  • 9. Quaini  F, Urbanek  K, Beltrami  AP, Finato  N, Beltrami  CA, Nadal-Ginard  B, Kajstura  J, Leri  A, Anversa  P.  Chimerism of the transplanted heart. N Engl J Med  2002;346:5–15. [DOI] [PubMed] [Google Scholar]
  • 10. Glaser  R, Lu  MM, Narula  N, Epstein  JA.  Smooth muscle cells, but not myocytes, of host origin in transplanted human hearts. Circulation  2002;106:17–19. [DOI] [PubMed] [Google Scholar]
  • 11. Boersema  M, Rienstra  H, van den Heuvel  M, van Goor  H, van Luyn  MJ, Navis  GJ, Popa  ER, Hillebrands  JL.  Donor and recipient contribution to transplant vasculopathy in chronic renal transplant dysfunction. Transplantation  2009;88:1386–1392. [DOI] [PubMed] [Google Scholar]
  • 12. Shimizu  K, Sugiyama  S, Aikawa  M, Fukumoto  Y, Rabkin  E, Libby  P, Mitchell  RN.  Host bone-marrow cells are a source of donor intimal smooth- muscle-like cells in murine aortic transplant arteriopathy. Nat Med  2001;7:738–741. [DOI] [PubMed] [Google Scholar]
  • 13. Hillebrands  J, van den Hurk  BM, Klatter  FA, Popa  ER, Nieuwenhuis  P, Rozing  J.  Recipient origin of neointimal vascular smooth muscle cells in cardiac allografts with transplant arteriosclerosis. J Heart Lung Transplant  2000;19:1183–1192. [DOI] [PubMed] [Google Scholar]
  • 14. Liu  G, Butany  J.  Morphology of graft arteriosclerosis in cardiac transplant recipients. Hum Pathol  1992;23:768–773. [DOI] [PubMed] [Google Scholar]
  • 15. Yu  L, Qin  L, Zhang  H, He  Y, Chen  H, Pober  JS, Tellides  G, Min  W.  AIP1 prevents graft arteriosclerosis by inhibiting interferon-gamma-dependent smooth muscle cell proliferation and intimal expansion. Circ Res  2011;109:418–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Qin  L, Yu  L, Min  W. Mouse models for graft arteriosclerosis. J Vis Exp  2013;e50290. doi: 10.3791/50290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. van den Bosch  TP, Kannegieter  NM, Hesselink  DA, Baan  CC, Rowshani  AT.  Targeting the monocyte-macrophage lineage in solid organ transplantation. Front Immunol  2017;8:153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Wyburn  KR, Jose  MD, Wu  H, Atkins  RC, Chadban  SJ.  The role of macrophages in allograft rejection. Transplantation  2005;80:1641–1647. [DOI] [PubMed] [Google Scholar]
  • 19. van den Bosch  TPP, Caliskan  K, Kraaij  MD, Constantinescu  AA, Manintveld  OC, Leenen  PJM, von der Thüsen  JH, Clahsen-van Groningen  MC, Baan  CC, Rowshani  AT.  CD16+ monocytes and skewed macrophage polarization toward M2 type hallmark heart transplant acute cellular rejection. Front Immunol  2017;8:346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Marks  SCJr, Wojtowicz  A, Szperl  M, Urbanowska  E, MacKay  CA, Wiktor-Jedrzejczak  W, Stanley  ER, Aukerman  SL.  Administration of colony stimulating factor-1 corrects some macrophage, dental, and skeletal defects in an osteopetrotic mutation (toothless, tl) in the rat. Bone  1992;13:89–93. [DOI] [PubMed] [Google Scholar]
  • 21. Witmer-Pack  MD, Hughes  DA, Schuler  G, Lawson  L, McWilliam  A, Inaba  K, Steinman  RM, Gordon  S.  Identification of macrophages and dendritic cells in the osteopetrotic (op/op) mouse. J Cell Sci  1993;104(Pt 4):1021–1029. [DOI] [PubMed] [Google Scholar]
  • 22. Shi  C, Lee  WS, He  Q, Zhang  D, Fletcher  DLJr, Newell  JB, Haber  E.  Immunologic basis of transplant-associated arteriosclerosis. Proc Natl Acad Sci USA  1996;93:4051–4056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Hiroyasu  S, Chinnasamy  P, Hou  R, Hotchkiss  K, Casimiro  I, Dai  XM, Stanley  ER, Sibinga  NE.  Donor and recipient cell surface colony stimulating factor-1 promote neointimal formation in transplant-associated arteriosclerosis. Arterioscler Thromb Vasc Biol  2013;33:87–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Herembert  T, Gogusev  J, Zhu  DL, Drueke  TB, Marche  P.  Control of vascular smooth-muscle cell growth by macrophage-colony-stimulating factor. Biochem J  1997;325(Pt 1):123–128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Inaba  T, Yamada  N, Gotoda  T, Shimano  H, Shimada  M, Momomura  K, Kadowaki  T, Motoyoshi  K, Tsukada  T, Morisaki  N. and Expression of M-CSF receptor encoded by c-fms on smooth muscle cells derived from arteriosclerotic lesion. J Biol Chem  1992;267:5693–5699. [PubMed] [Google Scholar]
  • 26. Tap  WD, Wainberg  ZA, Anthony  SP, Ibrahim  PN, Zhang  C, Healey  JH, Chmielowski  B, Staddon  AP, Cohn  AL, Shapiro  GI, Keedy  VL, Singh  AS, Puzanov  I, Kwak  EL, Wagner  AJ, Hoff  V, Weiss  DD, Ramanathan  GJ, Zhang  RK, Habets Zhang  JG, Burton  Y, Visor  EA, Sanftner  G, Severson  L, Nguyen  P, Kim  H, Marimuthu  MJ, Tsang  A, Shellooe  G, Gee  R, West  C, Hirth  BL, Nolop  P, van de Rijn  K, Hsu  M, Peterfy  HH, Lin  C, Tong-Starksen  PS, Bollag  SG.  Structure-guided blockade of CSF1R kinase in tenosynovial giant-cell tumor. N Engl J Med  2015;373:428–437. [DOI] [PubMed] [Google Scholar]
  • 27. Golde  WT, Gollobin  P, Rodriguez  LL.  A rapid, simple, and humane method for submandibular bleeding of mice using a lancet. Lab Anim (NY)  2005;34:39–43. [DOI] [PubMed] [Google Scholar]
  • 28. Lakso  M, Pichel  JG, Gorman  JR, Sauer  B, Okamoto  Y, Lee  E, Alt  FW, Westphal  H.  Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc Natl Acad Sci USA  1996;93:5860–5865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Madisen  L, Zwingman  TA, Sunkin  SM, Oh  SW, Zariwala  HA, Gu  H, Ng  LL, Palmiter  RD, Hawrylycz  MJ, Jones  AR, Lein  ES, Zeng  HA.  Robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci  2010;13:133–140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Sasmono  RT, Oceandy  D, Pollard  JW, Tong  W, Pavli  P, Wainwright  BJ, Ostrowski  MC, Himes  SR, Hume  DA.  A macrophage colony-stimulating factor receptor-green fluorescent protein transgene is expressed throughout the mononuclear phagocyte system of the mouse. Blood  2003;101:1155–1163. [DOI] [PubMed] [Google Scholar]
  • 31. Inaba  T, Gotoda  T, Harada  K, Shimada  M, Ohsuga  J, Ishibashi  S, Yazaki  Y, Yamada  N.  Induction of sustained expression of proto-oncogene c-fms by platelet-derived growth factor, epidermal growth factor, and basic fibroblast growth factor, and its suppression by interferon-gamma and macrophage colony-stimulating factor in human aortic medial smooth muscle cells. J Clin Invest  1995;95:1133–1139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Tellides  G, Tereb  DA, Kirkiles-Smith  NC, Kim  RW, Wilson  JH, Schechner  JS, Lorber  MI, Pober  JS.  Interferon-gamma elicits arteriosclerosis in the absence of leukocytes. Nature  2000;403:207–211. [DOI] [PubMed] [Google Scholar]
  • 33. Stanley  ER, Chitu  V.  CSF-1 receptor signaling in myeloid cells. Cold Spring Harb Perspect Biol  2014;6: 10.1101/cshperspect.a021857 24890514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Yona  S, Kim  K-W, Wolf  Y, Mildner  A, Varol  D, Breker  M, Strauss-Ayali  D, Viukov  S, Guilliams  M, Misharin  A, Hume  DA, Perlman  H, Malissen  B, Zelzer  E, Jung  SS.  Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis. Immunity  2013;38:79–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Djogo  T, Robins  SC, Schneider  S, Kryzskaya  D, Liu  X, Mingay  A, Gillon  CJ, Kim  JH, Storch  KF, Boehm  U, Bourque  CW, Stroh  T, Dimou  L, Kokoeva  MV.  Adult NG2-glia are required for median eminence-mediated leptin sensing and body weight control. Cell Metab  2016;23:797–810. [DOI] [PubMed] [Google Scholar]
  • 36. Lenzo  JC, Turner  AL, Cook  AD, Vlahos  R, Anderson  GP, Reynolds  EC, Hamilton  JA.  Control of macrophage lineage populations by CSF-1 receptor and GM-CSF in homeostasis and inflammation. Immunol Cell Biol  2012;90:429–440. [DOI] [PubMed] [Google Scholar]
  • 37. Li  J, Han  X, Jiang  J, Zhong  R, Williams  GM, Pickering  JG, Chow  LH.  Vascular smooth muscle cells of recipient origin mediate intimal expansion after aortic allotransplantation in mice. Am J Pathol  2001;158:1943–1947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Mi  H, Ebert  D, Muruganujan  A, Mills  C, Albou  L-P, Mushayamaha  T, Thomas  PD.  PANTHER version 16: a revised family classification, tree-based classification tool, enhancer regions and extensive API. Nucleic Acids Res  2021;49:D394–D403. 10.1093/nar/gkaa110633290554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Morgan  C, Pollard  JW, Stanley  ER.  Isolation and characterization of a cloned growth factor dependent macrophage cell line, BAC1.2F5. J Cell Physiol  1987;130:420–427. [DOI] [PubMed] [Google Scholar]
  • 40. Herring  BP, Hoggatt  AM, Burlak  C, Offermanns  S.  Previously differentiated medial vascular smooth muscle cells contribute to neointima formation following vascular injury. Vasc Cell  2014;6:21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Simper  D, Stalboerger  PG, Panetta  CJ, Wang  S, Caplice  NM.  Smooth muscle progenitor cells in human blood. Circulation  2002;106:1199–1204. [DOI] [PubMed] [Google Scholar]
  • 42. Ni  Z, Deng  J, Potter  CMF, Nowak  WN, Gu  W, Zhang  Z, Chen  T, Chen  Q, Hu  Y, Zhou  B, Xu  Q, Zhang  L.  Recipient c-kit lineage cells repopulate smooth muscle cells of transplant arteriosclerosis in mouse models. Circ Res  2019;125:223–241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Shankman  LS, Gomez  D, Cherepanova  OA, Salmon  M, Alencar  GF, Haskins  RM, Swiatlowska  P, Newman  AAC, Greene  ES, Straub  AC, Isakson  B, Randolph  GJ, Owens  GK.  KLF4-dependent phenotypic modulation of smooth muscle cells has a key role in atherosclerotic plaque pathogenesis. Nat Med  2015;21:628–637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Tap  WD, Gelderblom  H, Palmerini  E, Desai  J, Bauer  S, Blay  JY, Alcindor  T, Ganjoo  K, Martin-Broto  J, Ryan  CW, Thomas  DM, Peterfy  C, Healey  JH, van de Sande  M, Gelhorn  HL, Shuster  DE, Wang  Q, Yver  A, Hsu  HH, Lin  PS, Tong-Starksen  S, Stacchiotti  S, Wagner  AJ, ENLIVEN Investigators . Pexidartinib versus placebo for advanced tenosynovial giant cell tumour (ENLIVEN): a randomised phase 3 trial. Lancet  2019;394:478–487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Merry  TL, Brooks  AES, Masson  SW, Adams  SE, Jaiswal  JK, Jamieson  SMF, Shepherd  PR.  The CSF1 receptor inhibitor pexidartinib (PLX3397) reduces tissue macrophage levels without affecting glucose homeostasis in mice. Int J Obes (Lond)  2020;44:245–253. [DOI] [PubMed] [Google Scholar]
  • 46. Olingy  CE, San Emeterio  CL, Ogle  ME, Krieger  JR, Bruce  AC, Pfau  DD, Jordan  BT, Peirce  SM, Botchwey  EA.  Non-classical monocytes are biased progenitors of wound healing macrophages during soft tissue injury. Sci Rep  2017;7:447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Nahrendorf  M, Swirski  FK, Aikawa  E, Stangenberg  L, Wurdinger  T, Figueiredo  JL, Libby  P, Weissleder  R, Pittet  MJ.  The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions. J Exp Med  2007;204:3037–3047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Wynn  TA, Vannella  KM.  Macrophages in tissue repair, regeneration, and fibrosis. Immunity  2016;44:450–462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Caescu  CI, Guo  X, Tesfa  L, Bhagat  TD, Verma  A, Zheng  D, Stanley  ER.  Colony stimulating factor-1 receptor signaling networks inhibit mouse macrophage inflammatory responses by induction of microRNA-21. Blood  2015;125:e1–e13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Pyonteck  SM, Akkari  L, Schuhmacher  AJ, Bowman  RL, Sevenich  L, Quail  DF, Olson  OC, Quick  ML, Huse  JT, Teijeiro  V, Setty  M, Leslie  CS, Oei  Y, Pedraza  A, Zhang  J, Brennan  CW, Sutton  JC, Holland  EC, Daniel  D, Joyce  JA.  CSF-1R inhibition alters macrophage polarization and blocks glioma progression. Nat Med  2013;19:1264–1272. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

cvab289_Supplementary_Data

Data Availability Statement

The data underlying this article will be shared on reasonable request to the corresponding author. The RNA-seq data are available in figshare, at https://dx.doi.org/10.6084/m9.figshare.14998113.

Translational perspective

GVD is a major limitation to the long-term success of clinical solid organ transplantation. Currently, there are no effective treatment options to prevent the development of neointimal lesions that obstruct blood flow to the graft. In this study, we found that PLX3397, a selective inhibitor of CSF1R signalling, reduced the accumulation of macrophages and ACTA2+ cells within neointimal lesions in a preclinical model of GVD. Our study highlights a promising role for the pharmacologic targeting of CSF1R signalling to further study the molecular mechanisms that regulate allotransplantation-induced vascular remodelling.


Articles from Cardiovascular Research are provided here courtesy of Oxford University Press

RESOURCES