Abstract
The aim of the present study was to determine the cytotoxic, anticancerous and antiproliferative activity of CGA on oral squamous cell carcinoma (OSCC) cell line (KB) and to evaluate expression level of p21 and p53 in these CGA treated OSCC cell line. Different concentrations of CGA varying from 500 to 2500 µM were tested on OSCC cell line. Trypan blue and MTT assay were performed to establish IC50. DNA fragmentation and expression level of p21 and p53 were evaluated with the help of RT-PCR. CGA exerted antiproliferative and cytotoxic effect on OSCC (KB) cell line. Statistically significant results were found regarding effect of different CGA concentrations on KB cell line with IC50 at 1800 µM. No DNA fragmentation was observed. p21 and p53 expression were down regulated after CGA treatment. CGA revealed neither apoptosis nor damage to the nucleus after DNA fragmentation. Antiproliferative role of CGA was hinted by down regulation of p53 and p21 probably through cell cycle arrest at G1-S phase. It was reaffirmed that CGA a natural chemo preventive agent could enhance the treatment modalities with minimal side effects.
Keywords: In vitro/cell culture, Chlorogenic acid, Cancer prevention, Antioxidant, Flavonoids
Introduction
Oral squamous cell carcinoma (OSCC) is the eleventh most common cancer in the world comprising approximately 3% of all the malignancies and 92–95% of all oral cancers [1, 2]. Smoking and alcohol consumption have been identified as major risk factors [3]. Several other etiological agents include viral, bacterial and fungal infections, phenols, electro-galvanic reactions, radiation and genetics. Immunosuppression, expression of oncogenes and deactivation of tumor suppressor genes play a vital role in the process of carcinogenesis [4–7]. OSCC exhibits significantly high mortality and morbidity rates in spite of vast amount of research and advancement in the field of oncology and surgery [8]. In cancer chemoprevention, application of natural, dietary or synthetic agents rich in fruits, vegetables, legumes and whole cereals could reverse, suppress or prevent carcinogenic progression. Plant tissues comprise of hundreds of polyphenols like flavonoids, phenylpropanoids, isoprenoids, alkaloids and phenolic acids [9].
Chlorogenic acid (CGA), a dietary polyphenol first isolated from coffee beans has been used in traditional Chinese medicine since time immemorial. CGA exists in various forms such as 5-O-caffeoylquinic acid (5-CQA) (IUPAC numbering) or 3-CQA (pre-IUPAC numbering); among which 5-CQA is the most abundant form [10].
Scientific literature shows its diverse biological activities, including anti-HIV, anti-inflammatory, anti-oxidant, anti-carcinogenic, modulating activity of cytochrome P450-linked enzyme and anti-allergic activity. CGA displays stronger anti-oxidant activity indicating that it can effectively scavenge reactive oxygen radicals and also has selective cytotoxicity against tumor cell lines such as colon cancer, brain cancer, breast tumors, lung cancer, chronic myelogenous leukemia, salivary gland tumor and human oral squamous cell carcinoma (HSC-2) by virtue of its oxidation potential [11–16].
Conventional chemotherapeutic agents that aim to target tumor cells may also damage normal cells resulting in severe side-effects. This motivates the search for factors with superior prognostic relevance in order to better tailor the individual management of OSCC patients [8].
Therefore, newer strategies to prevent and inhibit OSCC growth and invasion are highly desirable and contemporary therapeutic approaches have been attempted to explore natural compounds [1].
Tumor ensued cell lines form a useful amenity and serve to be a true model of original tumors. They may assist as an effective tool to reveal the regulatory pathways in oral carcinogenesis and to evaluate the effects of various known and innovative drug formulations aimed at improving future treatment therapeutics [17].
There are numerous OSCC cell lines such as SCC-9, SCC-25, HSC-3, HSC-4, CA9-22, HO-1-U-1, HO-1N-1 and KB and thorough literature search revealed only a single study to observe the effect of CGA on OSCC cell line (HSC-2) [18].
Keeping the paucity of literature on anti-tumoral activities of CGA in mind, the present study was designed to evaluate the cytotoxic role of CGA on OSCC (KB) cell line and to establish its anticancerous and antiproliferative effect by DNA fragmentation. The expression levels of tumor suppressor genes p53 and p21 after RNA isolation from CGA treated OSCC (KB) cell line were also assessed.
Materials and Method
The present observational study was conducted in the Dept. of Oral and Maxillofacial Pathology and Microbiology, PGIDS, Rohtak in collaboration with Centre for Medical Biotechnology, Maharishi Dayanand University, Rohtak over a period of 1 year (February 2018–April 2019) after prior approval from the institutional ethics committee (PGIDS/IEC/2018/20).
Study Groups
The study sample was divided into the following groups: Group-I OSCC cell line (KB) not treated with Chlorogenic Acid (CGA) and Group-II OSCC cell line (KB) treated with Chlorogenic Acid (CGA).
Study Design
Cell Line and Cell Culture
OSCC cell line KB (oral mucosa squamous cell carcinoma) was used. Cell line was procured from the National Centre for Cell Sciences (NCCS), Pune. It was maintained in DMEM media (Sigma Aldrich, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Sigma Aldrich, USA), 100 µg/ml streptomycin and 100 µg/ml penicillin and antimycotic (amphotericin B) in plastic culture flasks under standard conditions (37 °C, 5% CO2, humidified atmosphere). To transfer or passage the cell lines, confluent flask was treated with 0.05% trypsin (Hi Media, India).
Reagents
Chlorogenic acid (Hi Media, India) having solubility 33.3 mg per ml, was dissolved in ethanol (as per manufacturer’s instructions) to give a final concentration of 93.985 mM. The above stock solution was filtered and stored at 4 °C. Various concentrations of compound were obtained by corresponding dilutions with DMEM medium. RNA isolation kit (Genetix) and PCR master mix (Qiagen) were used for RT-PCR.
Procedure
The KB cell line was cultured as monolayers in DMEM (Sigma Aldrich, USA) supplemented with 10% heat-inactivated FBS, 100 μg/ml penicillin, 100 μg/ml streptomycin and maintained in an incubator with a humidified atmosphere of 95% air and 5% CO2 at 37 °C and desired concentrations of CGA dissolved in media (500–2500 µM respectively) were drawn from time to time to check the effect of drug. After 24 and 48 h of treatment with CGA, cells were harvested and an aliquot was taken from cell suspension. 10 μl of the aliquot was pipetted onto haemocytometer and covered with cover-slip. The prepared slides were viewed under low power magnification. Cells was counted in hemocytometer as per the formulae: Total cells/ml = 1/4 Total cells counted × dilution factor × 104.
Cell Viability by Trypan Blue Exclusion Test
Trypan blue is a colorimetric dye that only stains dead cells with ruptured plasma membranes and excludes live cells that have intact plasma membranes. The cytotoxic effects of CGA were determined using the Trypan blue dye exclusion assay. Briefly, 1 × 105 cells from cell line (untreated) were seeded in triplicates into each well of 12 well culture plates under standard culture conditions and kept overnight in an incubator at 37 °C. Next day, the cells were treated with CGA (500–2500 µM final concentration) and kept for 48 h. At the stipulated time point, the cells were harvested after brief trypsinization. Dead cells (blue) were easily distinguished from live cells (colorless) using a standard bright field microscope and were counted manually with a hemocytometer (Rohem Silverlite, India). Simultaneously morphological observations were made with inverted microscope (Zeiss axiovert. A1, Germany) to observe the effect of CGA on cell line.
MTT Assay for Cytotoxic Activity
Cytotoxic effect of CGA on OSCC cell line (KB) was observed in two groups by MTT assay (Hi Media, India). The cells were seeded in 96 well plate at concentration of 1 × 105 cells/well and then treated in triplicates with CGA atvarious doses.0.5 mg/ml 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (Hi Media, India) was added to each of the 96 well plate. After cells were incubated at 37 °C in 5% CO2 for 4 h, the medium was removed and 100 µl of DMSO (Sigma, USA) was added. The absorbance at 595–610 nm was measured using a spectrophotometer (Biotek, USA).
DNA Fragmentation Analysis
The cells were pelleted, lysed and digested with RNase A and proteinase K. DNA was extracted from CGA treated cell line and assayed for DNA fragmentation by 1.5% agarose gel electrophoresis with the help of PCR.
RNA Isolation and Semi-quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR) for p53 and p21
For the RT-PCR, the Genetix First Strand cDNA Synthesis kit was used with a total RT reaction volume of 10 μl. The reaction temperature was 30 °C for 10 min, 42 °C for 20 min and 45 °C for 30 min. For the PCR stage, the total reaction volume was 50 μl. Primers for p21 was forward: 5′GATGTCCGTCAGAACCCATG-3 and reverse: 5′-CCACATGGTCTTCCTCTGCTG-3′, with an expected fragment size of 316 bp. For p53, the forward primer was 5′-GTCTGTGACTTGCACGTACT-3′ and the reverse 5′-CAGTCAGAGCCAACCTCAGG-3′, with an expected fragment size of 326 bp. β-actin was used as the internal standard reference with forward primer 5′GTGGGGCGCCCCAGGCACCA-3′ and 5′CTCCTTAATGCACGCACGATTTC’3 reverse primer, and an expected 500-bp band. After cDNA (3 μl), specific primers were added to the master mix and PCR was conducted with initial denaturation at 94 °C for 5 min, followed by 24 cycles of denaturation at 94 °C for 30 s, annealing at 50 °C for 30 s and extension at 72 °C for 30 s. A 5 μl sample of the PCR products was visualized by electrophoresis on 1% agarose gel stained with ethidium bromide.RNA was isolated from CGA treated cell line at IC50 range (1800 µM) and RT-PCR was performedand quantitated by densitometry using the associated software (image lab analysis version 5.2) by measuring the peak level surface area and normalising the values. The test was performed in duplicates for both groups. β Actin was taken as control primer.
Statistical Analysis
After compilation of the data, calculations were performed. The Shapiro Wilk and Levine independent T tests were applied in the present study to test the statistical significance of the results obtained. All data were analyzed using the Statistical Package for Social Sciences (SPSS) for Windows Operating System, Version 25.0 (SPSS Inc., Chicago, USA). Means and standard deviations were calculated. Probability values of p < 0.05 were regarded as statistically significant.
Results
Evaluation of Cytotoxic Effects of CGA on Cell Count
Cells from KB cell line dissolved in DMEM media were seeded in triplicates as 1 × 105 cells/ml in culture plates. After 24 h CGA was added in concentrations from 500 to 1500 μM in 24 well culture plate and from 1500 to 2500 μM in a 6-well culture plate and incubated for 48 h (Fig. 2). After 48 h, cell counting was done in upright bright field microscope (100×) with help of Neubaeur chamber and morphological observations (Fig. 1) were made with the help of inverted microscope (100×). Cell count in KB cell line not treated with CGA (Group I) was 2.5 × 105 cells/ml and KB cell line treated with CGA (Group II) showed significant reduction in cell count with 2.4 × 105 cells/ml at 500 μM decreasing up to 2.1 × 105cells/ml at 1500 μM. Further seeding them in a 6 well culture plate, with CGA concentrations from 1500 to 2500 μM, cell count was exactly reduced by half at 1800 µM (5.2 × 105cells/ml) as compared to control without CGA (10.8 × 105cells/ml). Treatment with CGA showed inhibition of cell proliferation with IC50 (concentration resulting in 50% inhibition of cell survival compared to untreated cells) at 1800 µM (Fig. 2). On intergroup comparison p value was statistically significant (0.000) at 1500, 1800, 2000, 2200, 2500 μM CGA concentrations respectively (Table 1). IC50 value was achieved with the help of Trypan Blue and then reaffirmed with MTT assay (Fig. 3) and the intergroup comparison was found to be significant. This reduction in the cell count after addition of CGA depicted its anticancerous effect by exerting antiproliferative activity.
Fig. 2.
Dose response inhibition histogram by CGA Of KB cell line (500–2500 µm)
Fig. 1.
Photomicrograph depicting morphological observation of KB cell line (control and CGA treated) a control, b 500 µm, c 1800 µm, d 2500 µm
Table 1.
Intergroup comparison of effect of CGA concentration (500–2500 µM)
| Drug concentration | Variable | No. of variable (N) | Mean | Standard deviation | p value |
|---|---|---|---|---|---|
| Control without CGA | Drug | 15 | 2.2 × 105 | 3445.7 | 0.005 |
| Control | 3 | 2.5 × 105 | 3333.3 | ||
| 500 µM | Drug | 3 | 2.4 × 105 | 10,000.0 | 0.116 |
| Control | 3 | 2.5 × 105 | 5773.5 | ||
| 750 µM | Drug | 3 | 2.4 × 105 | 0.00000 | 0.057 |
| Control | 3 | 2.5 × 105 | 5773.5 | ||
| 1000 µM | Drug | 3 | 2.2 × 105 | 5773.5 | 0.005 |
| Control | 3 | 2.5 × 105 | 5773.5 | ||
| 1250 µM | Drug | 3 | 2.2 × 105 | 11,547.0 | 0.016 |
| Control | 3 | 2.5 × 105 | 5773.5 | ||
| 1500 µM | Drug | 3 | 2.1 × 105 | 10,000.0 | 0.003 |
| Control | 3 | 2.5 × 105 | 5773.5 | ||
| Control without CGA | Drug | 15 | 4.9 × 105 | 140,705.7 | 0.000 |
| Control | 3 | 10.8 × 105 | 28,867.5 | ||
| 1500 µM | Drug | 3 | 7.2 × 105 | 30,000.0 | 0.000 |
| Control | 3 | 10.8 × 105 | 28,867.5 | ||
| 1800 µM | Drug | 3 | 5.2 × 105 | 20,000.0 | 0.000 |
| Control | 3 | 10.8 × 105 | 28,867.5 | ||
| 2000 µM | Drug | 3 | 4.8 × 105 | 20,000.0 | 0.000 |
| Control | 3 | 10.8 × 105 | 28,867.5 | ||
| 2200 µM | Drug | 3 | 4.3 × 105 | 32,145.5 | 0.000 |
| Control | 3 | 10.8 × 105 | 28,867.5 | ||
| 2500 µM | Drug | 3 | 3.1 × 105 | 76,376.2 | 0.000 |
| Control | 3 | 10.8 × 105 | 28,867.5 |
P value: > 0.05-non-significant < 0.05-significant < 0.005-very significant independent T test
The values in bold are highly significant P values of the various concentrations of CGA and the IC50 was achieved at 1800 μM where the cells were killed for exactly half the count
Fig. 3.
Dose response inhibition histogram of CGA on KB cell line by MTT assay
Evaluation of CGA Effect on Cell Viability
Results showed no significant reduction in cell viability after addition of various CGA concentrations (500–2500 µM) with Trypan Blue elaborating that cells were not undergoing apoptosis (Fig. 4). Simultaneous morphological observations also revealed no significant number of dead cells confirming that CGA is exerting antiproliferative and not apoptotic effect on the cell count.
Fig. 4.
Effect of CGA on cell viability trypan blue exclusion
Evaluation of DNA Fragmentation
No DNA fragmentation was observed reaffirming that CGA has antiproliferative and not cytocidal action as it did not display apoptosis in the CGA treated cell lines (Fig. 5a).
Fig. 5.
Photomicrograph depicting DNA fragmentation analysis and p21 and p53 expression. a DNA fragmentation analysis with PCR. b p21 and p53 expression with RT-PCR
Evaluation of Expression Level of Tumor Suppressor Genes p53 and p21
Expression levels of p21 and p53 were downregulated after CGA treatment when compared with β actin (control). Results confirmed that increased expression levels of p21 and p53 in cancerous cell line (KB) without CGA is related to the ability of cells to evade apoptosis leading to continuous cellular proliferation, which after CGA treatment was reduced (Fig. 5b).
Discussion
Conventional chemotherapeutic drugs exert their anticancerous effect by rapidly attacking dividing cells. In turn they also affect other normal cells in the body like bone marrow, lining of the mouth, intestines, and hair follicles, which divide quickly resulting in severe side effects such as hair loss, mouth sores, loss of appetite, nausea, vomiting, diarrhea and low blood counts. To counteract these side effects novel strategies preventing and inhibiting OSCC growth and invasion are highly desirable [19, 20]. Natural dietary agents such as fruit and vegetables hold great promise for chemo preventive research due to their potential ability to prevent and suppress cancer. Plant derived compounds have demonstrated anticancerous properties by inhibiting proliferation of cancer cells and inducing apoptotic cell death [21].
Compounds that have been identified and extracted from terrestrial plants for their anticancer properties include polyphenols, brassinosteroids and taxols. Polyphenolic compounds include flavonoids, tannins, curcumin, resveratrol and gallacatechins and all are considered to be anticancerous. Chlorogenic acid (CGA) is a polyphenolic compound which exists in natural plants and several studies have shown that CGA induces cytostatic or cytocidal effects in many human cancer cells.
In the present study, results established that naturally occurring CGA extracts significantly inhibit the proliferation of KB cells with no significant effect on cell viability, which suggests it to be effective cytostatic chemotherapeutic agent against oral cancer cells.The present study comprised of two groups OSCC (KB) cell line not treated with CGA formed the control group (Group I) and OSCC (KB) cell line treated with different concentrations of CGA ranging from 500 to 2500 µM was the study group (Group II). This was done to observe reduction in cell count and viability and to evaluate anticancerous and antiproliferative effect of CGA. Cell counts showed significant reduction in cell number with increasing CGA concentrations depicting IC50 at 1800 µM (0.63 µg/ml).
In concordance with results of this study where CGA showed its cytostatic effect at 1800 µM (IC50value), Bender O evaluated the cytotoxic role of CGA on various breast cancer cell lines (MCF, BT) and observed the IC50 to be952 µM for MCF-7 and 1095 µM for BT thereby concluding that CGA has antiproliferative effect on breast cancer cell lines [22]. Another studyby Chandra G et al. observed the IC50 to be 0.84 µg/ml on human colon cancer cell lines HCT-116 which was almost similar to present study findings (0.63 µg/ml) [12].
Jiang evaluated the effect of CGA in milimolar concentrations on human OSCC cell lines (HSC-2) and concluded that CGA exerted cytotoxic effect on cell line by initiating apoptosis with IC50 range at 1.3 milimolar (1300 µM). This difference in IC50 could be due to the different cell lines used, dosage of CGA which varied from 2, 4, 8 and 16 mM with an observation time of 24 h in the aforementioned study to IC50 1800 µM with an observation time of 48 h in the present study [16]. They further concluded that CGA can exert a bimodal action in which micromolar concentrations (0.003–3) scavenge free radicals and act as antioxidant whereas milimolar concentrations (2–16) produce free radicals and can act as pro-oxidant. In concordance to these findings, micromolar concentration of CGA in the present study (0.63 µg/ml) might have showed its antioxidant activity.
Bansal P, Das SN in their study on OSCC KB cell line evaluated the cytostatic effect of a different drug Tinospora Cordifolia at various concentrations and found cytostatic effect at lower doses and time range (25 µg/ml, 72 h) and cytotoxic effect at higher doses (50 and 75µg/ml, 120 h). Difference in results could be due to difference in chemopreventive drug used, dosage and time range [23].
In present study it was found that at concentration 1800 µM, average cell count of CGA treated cells after 48 h was found to be 5.2 × 105 cells/ml while corresponding control without CGA treatment was 10.8 × 105 cells/ml depicting the inhibition effect of CGA at which cell count is reduced by half which is known as IC50. CGA reduced cell proliferation and induced morphological changes in KB cell line. IC50 value of KB cell line by Trypan Blue exclusion via manual counts (1800 µM) was concordant with MTT assay which also reaffirmed IC50 at the same range. At different observation time and concentrations, CGA did not significantly differ in percentage reduction of viable cells. After establishing the IC50 value and anti-proliferative effect of CGA further analysis was conducted to study the molecular pathways behind the anti-cancerous activity of CGA. The present study findings have been compared with previous studies of CGA on various cell lines performed in the past (Table 2).
Table 2.
Comparison of effect of CGA on various cell lines of present study with past studies
| S. no | Drug used | Study | Study protocol | Cell line origin study | IC50 | Molecular analysis of pathways | Conclusion |
|---|---|---|---|---|---|---|---|
| 1 | Chlorogenic acid | Present study (2018) |
Cell count Trypan blue for cell viability MTT assay |
OSCC(KB) | 1800 µM |
DNA fragmentation not observed Down regulatedexpression of p21 & p53 by PCR |
Cytostatic Antiproliferative Anticancerous |
| 2 | Chlorogenic acid | Jiang [16] |
Cell count Trypan blue for cell viability MTT assay |
OSCC (HSC-2) |
1.3 Mm |
DNA fragmentation observed |
Cytocidal Antiproliferative Anticancerous |
| 3 |
Sodium Chlorogenate |
Bandyopadhyay [12] |
Cell count Trypan blue R and D colorimetry assay kit |
CML cell lines KU812 KCL22 K562 MOLT4 U937 THP-1 |
_ |
DNA fragmentation Observed |
Cytocidal Antiproliferative Anticancerous |
| 4 | Chlorogenic acid | Jin and Lee [25] |
Cell count XTT assay Trypan blue |
Hepatocellular cell line Hep 3 B |
30–50 nm | Reduced expression of MMP-9 |
Cytostatic Antiproliferative Anticancerous |
| 5 | Caffeic acid and Chlorogenic acid | Lee et al. [26] |
Cell count Trypan blue R and D colorimetry assay kit |
Breast cancer cell lines MCF-7 and MAD-MB-231 |
3 µM for Caffeic acid 0.75 µM for CGA |
DNA fragmentation Observed |
Cytocidal Antiproliferative Anticancerous |
| 6 | Chlorogenic acid complex (CGA 7) | Gouthamchndra [12] |
MTT assay LDH leakage assay |
Human colon cancer HCT-116 cells | 0.84 mg/ml |
DNA fragmentation Observed |
Cytocidal Antiproliferative Anticancerous |
| 7 | Chlorogenic acid | Yang [27] |
Cell count R and D colorimetry assay kit |
CML cell line U-937 |
200 µM |
DNA fragmentation Observed |
Cytocidal Antiproliferative Anticancerous |
| 8 | Chlorogenic acid | Bender [22] |
Cell count Trypan blue MTT assay |
Breast cancer MCF-7 SKBR-3 MDA231 BT |
952 µM SKBR-3–940 µM MDA-231–882 µM,BT-1095 µM |
_ |
Cytostatic Antiproliferative Anticancerous |
DNA fragmentation analysis revealed neither apoptosis nor damage to nucleus reaffirming CGA to be an antiproliferative agent. Molecular analyses of human cancers have manifested that cell cycle regulators are frequently mutated in most of the malignancies. The regulatory checkpoints of the G1/S and G2/M phase are p53 (guardian of genome) and p21 (CDK inhibitor) which inspect cell cycle’s DNA repair, regulation and apoptosis [24]. These cell cycle regulators are defective in cancer cells, which enable the upregulated cell proliferation. Consequently, cell-cycle disruption has been a focus of anti-cancer therapies to inhibit cancer-cell growth. To determine and understand the possible mechanisms for antiproliferative effect of CGA and whether the growth inhibitory effects of CGA resulted from growth arrest, expression level of tumor suppressor genes p21 and p53 were measured with the help of RT- PCR. This revealed downregulation of both genes in CGA treated cell line.
Thus it would be concluded that CGA exerts antiproliferative effect by probably altering and downregulating the expression of both p21 and p53 genes which are aberrantly expressed in oral cancers. As there are p53 dependent and independent pathways for cytotoxic activity so mutation status and other regulatory pathways should be explored in the future studies for better understanding the biological behaviour of tumors.
Conclusion
Till date very few studies have been published evaluating the role of natural chemopreventive agents on various OSCC cell lines. Results of the present study provide new theoretical basis and therapeutical strategies in the clinical treatment of OSCC. CGA being a good dietary and effective chemopreventive agent could also act as a promising therapeutic agent for the prevention of cancer. However, future studies are warranted on the dose response relation, mechanism of action and beneficial effects of CGA in advanced tumor models, which proved to be limitations for the present study. Further research and exploration could establish the molecular pathways involved in the action of CGA.
Funding
Self-funded.
Compliance with Ethical Standards
Conflict of interest
All authors have indicated they have no potential conflicts of interest and no financial relationships relevant to this article to disclose.
Ethical Statement
The study was started after prior approval from the institutional ethics committee (PGIDS/ IEC/2018/20).
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Nicolini G, Maggioni D, Biffi L, Ceresa C, Scuteri A, Garavello W, Miloso M. Human oral squamous cell carcinoma proliferation and migration prevented by two flavonoids. IJAE. 2013;118(2):148. doi: 10.13128/IJAE-24159. [DOI] [Google Scholar]
- 2.Mortazavi H, Baharvand M, Mehdipour M. Oral potentially malignant disorders: an overview of more than 20 entities. J Dent Res Dent Clin Dent Prospects. 2014;8(1):6–14. doi: 10.5681/joddd.2014.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Maggioni D, Biffi L, Nicolini G, Garavello W. Flavonoids in oral cancer prevention and therapy. Eur J Cancer Prev. 2015;24(6):517–528. doi: 10.1097/CEJ.0000000000000109. [DOI] [PubMed] [Google Scholar]
- 4.Neville BW, Damm DD, Allen CR, Bouquot JE. Oral and maxillofacial pathology. 2. Philadelphia: WB Saunders; 2002. pp. 316–376. [Google Scholar]
- 5.Garsia M, Jemal A, Ward EM, Hao Y, Siegel RL, Thun MJ. Global cancer facts and figures. Atlanta: American Cancer Society; 2007. [Google Scholar]
- 6.Llewellyn CD, Johnson NW, Warnakulasuriya KA. Risk factors for squamous cell carcinoma of the oral cavity in young people—a comprehensive literature review. Oral Oncol. 2001;37:401–418. doi: 10.1016/S1368-8375(00)00135-4. [DOI] [PubMed] [Google Scholar]
- 7.Andre K, Schraub S, Mercier M, Bontemps P. Role of alcohol and tobacco in the aetiology of head and neck cancer: a case-control study in the Doubs region of France. Oral Oncol Eur J Cancer. 1995;31B:301–309. doi: 10.1016/0964-1955(95)00041-0. [DOI] [PubMed] [Google Scholar]
- 8.Mahajan S, Gupta R. Oral squamous cell carcinoma—an update. J Adv Med Dent Sci Res. 2016;4(1):101–104. [Google Scholar]
- 9.Iriti M, Faoro F. Chemical diversity and defence metabolism: how plants cope with pathogens and ozone pollution. Int J Mol Sci. 2009;10(8):3371–3399. doi: 10.3390/ijms10083371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Naveed M, Hejazi V, Abbas M, Kamboh AA, Khan GJ, Shumzaid M, Ahmad F, Babazadeh D, FangFang X, Modarresi-Ghazani F, WenHua L. Chlorogenic acid (CGA): a pharmacological review and call for further research. Biomed Pharmacother. 2018;97:67–74. doi: 10.1016/j.biopha.2017.10.064. [DOI] [PubMed] [Google Scholar]
- 11.Kang NJ, Shin SH, Lee HJ, Lee KW. Polyphenols as small molecular inhibitors of signaling cascades in carcinogenesis. Pharmacol Ther. 2011;130(3):310–324. doi: 10.1016/j.pharmthera.2011.02.004. [DOI] [PubMed] [Google Scholar]
- 12.Gouthamchandra K, Sudeep HV, Venkatesh BJ, Prasad KS. Chlorogenic acid complex (CGA7), standardized extract from green coffee beans exerts anticancer effects against cultured human colon cancer HCT-116 cells. Food Sci Hum Wellness. 2017;6(3):147–153. doi: 10.1016/j.fshw.2017.06.001. [DOI] [Google Scholar]
- 13.Bandyopadhyay G, Biswas T, Roy CK, Mandal S, Mandal C, Pal CB, Bhattacharya S, Rakshit S. Chlorogenic acid inhibits Bcr-Abl tyrosine kinase and triggers p38 mitogen activated protein kinase dependent apoptosis in chronic myelogenous leukemic cells. Blood. 2004;104(8):2514–2522. doi: 10.1182/blood-2003-11-4065. [DOI] [PubMed] [Google Scholar]
- 14.Xu R, Kang Q, Ren J, Li Z, Xu X. Antitumor molecular mechanism of chlorogenic acid on inducting genes GSK-3 beta and APC and inhibiting gene beta-catenin. J Anal Methods Chem. 2013 doi: 10.1155/2013/951319. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 15.Belkaid A, Currie JC, Desgagnes J, Annabi B. The chemo preventive properties of chlorogenic acid reveal a potential new role for the microsomal glucose-6-phosphate translocase in brain tumor progression. Cancer Cell Int. 2006;6:7. doi: 10.1186/1475-2867-6-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Jiang Y, Kusama K, Satoh K, Takayama F, Watanabe S, Sakagami H. Induction of cytotoxicity by chlorogenic acid in human oral tumor cell lines. Phytomedicine. 2000;7(6):483–491. doi: 10.1016/S0944-7113(00)80034-3. [DOI] [PubMed] [Google Scholar]
- 17.Patil TT, Kowtal PK, Nikam A, Barkume MS, Patil A, Kane SV, Juvekar AS, Mahimkar MB, Kayal JJ. Establishment of a tongue squamous cell carcinoma cell line from Indian gutka chewer. J Oral Oncol. 2014 doi: 10.1155/2014/286013. [DOI] [Google Scholar]
- 18.Kashyap CP, Tikka B, Sharma S, Kumari S, Verma P, Sharma S, Arya V. Human cancer cell lines-a brief communication. J Chem Pharm Res. 2011;3(6):514–520. [Google Scholar]
- 19.Hoffmann TK. Systemic therapy strategies for head-neck carcinomas: Current status. GMS Curr Top Otorhinolaryngol Head Neck Surg. 2012;11:3. doi: 10.3205/cto000085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.American Cancer Society [cited 24 April 2019]. Available from: https://www.cancer.org/treatment/treatments-andsideeffects/treatmenttypes/chemotherapy/chemotherapy-side-effects.html
- 21.Greenwell M, Rahman PK. Medicinal plants: their use in anticancer treatment. Int J Pharm Sci Res. 2015;6(10):4103. doi: 10.13040/IJPSR.0975-8232.6(10).4103-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Bender O, Atalay A. Evaluation of anti-proliferative and cytotoxic properties of chlorogenic acid against breast cancer cell lines by real time monitoring. Multidiscip Digit Publ Inst Proc. 2017;1(10):1009. [Google Scholar]
- 23.Bansal P, Das SN. Study of antiproliferative activity of Tinospora Cordifolia extracts in normal and malignant cells. J Pharm Res. 2010;3(2):382–385. [Google Scholar]
- 24.D’Andrilli G, Kumar C, Scambia G, Giordano A. Cell cycle genes in ovarian cancer: steps toward earlier diagnosis and novel therapies. Clin Cancer Res. 2004;10(24):8132–8141. doi: 10.1158/1078-0432.CCR-04-0886. [DOI] [PubMed] [Google Scholar]
- 25.Jin UH, Lee JY, Kang SK, Kim JK, Park WH, Kim JG, Moon SK, Kim CH. A phenolic compound, 5-caffeoylquinic acid (chlorogenic acid), is a new type and strong matrix metalloproteinase-9 inhibitor: isolation and identification from methanol extract of Euonymus alatus. Life Sci. 2005;77(22):2760–2769. doi: 10.1016/j.lfs.2005.02.028. [DOI] [PubMed] [Google Scholar]
- 26.Lee WJ, Zhu BT. Inhibition of DNA methylation by caffeic acid and chlorogenic acid, two common catechol-containing coffee polyphenols. Carcinogenesis. 2006;27(2):269–277. doi: 10.1093/carcin/bgi206. [DOI] [PubMed] [Google Scholar]
- 27.Yang JS, Liu CW, Ma YS, Weng SW, Tang NY, Wu SH, Ji BC, Ma CY, Ko YC, Funayama S, Kuo CL. Chlorogenic acid induces apoptotic cell death in U937 leukemia cells through caspase-and mitochondria-dependent pathways. in Vivo. 2012;26(6):971–978. [PubMed] [Google Scholar]