SUMMARY
In anamniote embryos the major wave of zygotic genome activation starts during the mid-blastula transition. However, some genes escape global genome repression and are activated substantially earlier and contribute to the minor wave of genome activation. The mechanisms underlying the minor wave of genome activation are little understood. We explored the genomic organisation and cis-regulatory mechanisms of a transcription body, in which the minor wave of genome activation is first detected in zebrafish. We identified the miR-430 cluster with excessive copy number and highest density of Pol II-transcribed promoters in the genome, that is required for forming the transcription body. However, this transcription body is not essential for, nor encompasses minor wave transcription globally. Instead, distinct minor wave-specific promoter architecture suggests that promoter-autonomous mechanisms regulate the minor wave of genome activation. The minor wave-specific features also suggest distinct transcription initiation mechanisms between the minor and major wave of genome activation.
Graphical Abstract

eTOC blurb:
Hadzhiev and Wheatley et al. study nuclear organisation and promoter architectures of the first wave of genome activation in zebrafish. The first active genes are in a high promoter density gene cluster, forming a transcription body, and minor wave genes activated autonomously have distinct promoter features from the main wave.
INTRODUCTION
The major wave of zygotic genome activation (ZGA) is characterized by activation of thousands of genes when dividing cells reach a threshold nucleo-cytoplasmic ratio (reviewed in1–3). At the major wave transcription machinery is suggested to first outcompete maternally deposited repressive factors, including an excess of histones, which get diluted by exponential cell divisions (reviewed in1,3–7. In addition, several molecular mechanisms have been suggested to regulate the timing of genome activation: i) availability of pioneering transcription factors8; ii) availability of transcription initiation machinery9–11; iii) sequential increase in chromatin accessibility12,13; iv) gradual formation of transcriptionally competent chromatin14,15 and vi) cell cycle elongation 15–18.
However, many genes escape global repression and become activated in advance of the rest of the genome, during what is called the minor wave of genome activation19–21. In zebrafish, the minor wave of genome activation starts at the 64-cell stage, reaching high levels of activity by the 512-cell stage interphase, and characterised by high production of miR-430 primary transcripts15,20,22. Notably, in zebrafish miR-430 is a key regulator of maternal mRNA clearance21 and during ZGA miR-430 nascent RNA (primary microRNA) accumulates in a transcription body. During the minor wave of genome activation this body carries most of the cell’s detectable, transcriptionally active Pol II (Pol II Ser2P) and nascent RNAs15,22,23, and the high transcriptional activity of this body has been associated with local chromatin depletion23. Additionally, the genomic locus of miR-430 genes is marked by CTCF and Rad2124, suggesting chromosome conformation mechanisms involved in its activation. MiR-430 activation is dependent on BRD4 and histone H3K27ac marking of its chromatin15,25 and on the pioneer transcription factors (also called stem cell factors): Nanog, Pou5f3, Sox19b8,15,25–27. These stem cell factors have been shown to activate the major wave of ZGA in fish8,13,27,28 and homologs Pou5f3 and Sox3 in Xenopus29, while their role in minor wave genome activation is not yet understood.
Deposition of histone modifications (H3K4me1, H3K4me3, and histone variants (H2AZ) associated with gene regulation, precede genome activation14 and are detected in gametes30. These epigenetic dynamics suggest potential inheritance from parents with a possibly instructive role in both minor and main waves of genome activation31–35.
Taken together, the genetic and epigenetic mechanisms underlying the activation of miR-430 locus may explain the formation of this transcription body and provide insights into the mechanisms of the minor wave of genome activation.
In this study we have examined the molecular mechanisms underlying the activation of minor wave genes using the miR-430 locus. We describe a repetitive structure for the miR-430 cluster and demonstrate that transcription of the miR-430 locus is required for transcription body formation. In addition, we show that minor wave specific core promoters carry distinct architecture from that used by the major wave of genome activation. While promoter density enables the formation of a transcription body, single copy genes with promoters, which share features with those in the transcription body, can escape global transcriptional repression and become activated in the minor wave independently from the transcription body.
RESULTS
Long read sequencing mediated genome assembly reveals the highest promoter density gene cluster in the zebrafish genome
In the current genome assembly (GRCz11) the miR-430 locus is a multi-copy gene cluster, which consist of 8 complete miR-430 gene units, each containing a 650 bp promoter region and triplets of precursor miRNAs, which themselves are repeated in 2 (duplex) or 3 times (triplex) per promoter22 (Figure 1A). Each precursor miRNA triplet consists of 4 different subtypes of precursor genes: a, b, c or the ‘a’ variant, called ‘i’22. In the reference genome assembly (GRCz11), the 5’end of the locus is truncated, missing the promoter sequence, which suggests that this section of the assembly is incomplete, probably due to the difficulty of assembling the highly repetitive structure (Figure 1A). Therefore, we embarked to reassemble the miR-430 locus, generating Oxford Nanopore long read sequencing data from AB male zebrafish at ~44x coverage and complemented this with PacBio (Pacific Bioscience) sequencing from a heat shock diploid “double heterozygous”36 Tuebingen-AB hybrid female zebrafish at ~78x coverage.
Figure 1. De novo assembly of the miR-430 cluster from long read sequencing data.

(A) Schematic of the most common miR-430 gene structure (top), the duplex consisting of promoter region (red) and two pre-miRNA triplets (blue) each containing miR-430a, miR-430b and miR-430c (gray) pre-miR-430 subtypes. Bottom: the miR-430 gene cluster structure in current reference assembly (GRCz11). (B) Genome browser view of the miR-430 gene cluster assembled from long reads. The tracks show a low-resolution continuity structure of the gene cluster (top), long read coverage histogram (middle) and the read to contig assembly layout (bottom). Raw reads with 50 or more promoters are shown as red horizontal bars with the promoter number indicated on top of them. (C) Left: number of BLAST hits in raw long reads of single gene promoters and miR-430. Right: Estimated miR-430 promoter number normalised to that of single copy genes. (D) Estimated miR-430 promoter number (red line) by digital droplet PCR (ddPCR) for three zebrafish strains and the assembled contig. Error bars are standard deviation from the mean of the miR-430 promoter estimate normalised to each of the 6 single copy genes and 6 technical ddPCR replicates respectively. (E) Rainfall plot representing the promoter density across each chromosome of the newly assembled zebrafish genome (GRCz11 reference guided). Red arrow indicates the mirR-430 gene cluster; Abbreviations: TSS, Transcription Start Site; AB, TU-AB, TU, TL are zebrafish strains used in (C) and (D). See also Figure S1 and Table S1/S5
Initial analyses of the long read data revealed 7 reads, which contained 50 or more miR-430 promoters (Figure 1B, Figure S1A), with 74 promoters on a single 111kb read with 128 triplets. The longest read spanning the miR-430 cluster was 122 kb with 67 promoters (149 triplets). This analyses confirmed the previously described sub-structure within precursor triplets and revealed variable number of triplets per promoter (Figure 1A,B, Figure S1B). Assembly of the Oxford Nanopore reads by the Canu assembler37 resulted in 2 contigs containing the miR-430 gene cluster, likely representing allelic variants. The first contig was ~3.44 Mb long with 313 miR-430 promoters (655 triplets) spanning 577 kb (Figure 1B, Data S1). The second contig was 811 kb long containing 306 miR-430 promoters (587 triplets) spanning 534 kb (Figure S1A, Data S1). A comparison of the read to contig layouts (Figure 1B and Figure S1A), showed that contig1 had overall better read support/coverage and was used in further analyses.
The striking increase of copy number from 8 to >300 repeated gene units prompted us to seek independent validation of the copy number of the miR-430 primary transcript genes. To this end we estimated read coverage and compared to known single copy genes on the genome. The raw reads of our Nanopore and PacBio sequencing were queried with the miR-430 promoter sequence (Figure 1B) and the promoter sequences of 6 single copy genes (Table S1) using BLAST38,39. An estimate of promoter number of miR-430 was generated by normalising the BLAST hit number to that of the single copy genes. This analysis led to a calculated copy number of 280±30 and 194±24 for each sequencing run respectively (Figure 1C). In addition, we estimated the miR-430 promoter number by digital droplet PCR (ddPCR) using shha as single copy reference gene for 3 zebrafish stains (AB, TU and TL). The copy number estimated by this approach was 277±25, 229±52 and 100±13 for AB, TU and TL strains respectively (Figure 1D). The assembly of the PacBio reads did not result in continuous, end to end assembly of the miR-430 locus but was split between 14 contigs (Figure S1B). The total number of miR-430 promoters and triplet structures on all contigs from the PacBio data was estimated between 359 and 768 respectively.
While the copy number figures from the above approaches differ, they are in a comparable range to that obtained by copy number calculation on the assembled contigs (Figure 1C,D). Thus the number of promoters in the miR-430 locus is almost 2 orders of magnitude higher than what was annotated on the reference genome. We explored how this promoter density, repeated every 1.8 kb on average over a ~0.6Mb region compares to the rest of the genome. To analyse promoter density, we performed GRCz11 reference-guided chromosome scaffolding of a de novo assembly from the Nanopore sequencing run (see Methods). CAGE-seq40 multi-mapped to the newly scaffolded genome was used to identify promoters and calculate their density. As demonstrated on Figure 1E the miR-430 cluster indeed showed by far the highest promoter density in the assembled genome, more than 4 times higher than other promoter dense regions.
Taken together, the much higher promoter copies and density of the miR-430 gene locus than previously anticipated, provide a potential explanation for the timing and the scale of gene expression during the minor wave of genome activation, which appears in a large transcription body.
Distinct epigenetic regulation of the miR-430 cluster and minor wave genes of genome activation
The occurrence of minor wave gene activation raises the question of what chromatin and DNA sequence features are contributing to its formation. We first aimed to characterise the epigenetic profiles and promoter architecture features of the miR-430 cluster and other minor wave genes, in contrast with those activated at distinct phases of development. Publicly available epigenomic datasets representing chromatin opening (ATAC-seq) and associated with cis-regulatory element regulation (H3K4me3-, H3K27me3- and H3K27ac-ChIP-seq)31,33,35,41, covering key early developmental stages were selected (see Methods).
The datasets were mapped to a custom genome, created by adding the miR-430 cluster containing contig1 sequence from the long read assembly to GRCz11. To investigate the role of epigenomic features in early genome activation, their signal levels and dynamics during blastula stages were compared among 5 distinct gene sets (25 genes each) selected based on the timing of their onset of activation (Figure 2): 1) miR-430 genes: The earliest and most highly transcribed gene cluster during the minor wave. 2) Minor Wave genes: detected as activated during the first wave of the zygotic genome activation20. Genes were selected with no maternal contribution and >2.5 fold change between 128- and 512-cells. 3) Major Wave genes: randomly selected genes activated at the major wave but not detected during the minor wave20. 4) Constitutive Genes (CG): housekeeping genes with maternal contribution and expressed throughout development. These genes were previously shown to use two different promoter codes present on the same core promoter sequence42. Firstly, a TATA-like motif called W-box was utilised in the oocyte, then later replaced by a nucleosome positioning signal of AT/GC enrichment boundary downstream of the transcription initiation start site (TSS) at ZGA. 5) Post-gastrulation genes (PG): activated after gastrulation during early segmentation stages. Expression dynamics for all gene sets were determined based on40 and mapped to GRCz11/danRer11, ENSEMBL v95 gene annotations (Figure S2 A–D, Table S2).
Figure 2. Epigenomic features of miR-430 cluster, compared to other gene sets activated at distinct phases of embryo development.

(A) Aggregation plots showing signal distribution (mean) around the TSS for different gene sets (left side labels) and epigenetic features (top labels). (B) Line graphs of total epigenetic signal. The miR-430 data was multi-mapped (black) and not directly comparable to the other presented gene sets, which are unique mapped (colour). See also Figure S2 and Table S2
Next, the chromatin openness at the selected gene sets was examined by ATAC-seq (Figure 2 A,B). The distribution profile of the signal was as expected for all datasets, peaking 100-150 bp upstream of the TSS in the nucleosome free region of all active promoters. Since miR-430 signals were plotted from multi-mapped data, they were not quantitatively comparable to the rest of the gene sets and were used to explore and compare temporal trends. The signals on the miR-430, as well as on the early and late zygotic gene sets, correlated with their gene expression dynamics. miR-430 was highly active early and shows the most open chromatin, whereas the minor wave genes become similarly open at earlier stage and were generally more open than the major wave genes. The latter genes were comparable to the constitutive gene set, in line with their zygotic activation at and post-MBT.
Next, we compared chromatin states with the appearances of promoter-associated histone modification marks. The levels of the gene activity-associated H3K27ac43–45 correlated with that of the open chromatin states (Figure 2A,B). The miR-430 gene clusters showed high signal already at 256-cell stage (Figure 2A,B). The minor wave gene set showed higher and broader H3K27ac signal distribution than the major wave genes during 256-cell stage, which in contrast, were more comparable to the constitutive genes. Like the ATAC-seq profile, the lowest levels were observed in the post gastrulation set.
Despite the high degree of open chromatin and enrichment in H3K27ac corresponding to the high expression levels at early blastula stages, the miR-430 cluster showed low levels of the active or poised promoter mark H3K4me3 in comparison to other marks14,42,46,47. Minor wave genes showed presence of H3K4me3 extending to the gene body and correlating with the presence and extent of H3K27me3 on this gene set. The highest levels H3K4me3 were observed in the constitutive and minor wave gene sets, with the latter also having a broader distribution of signal (Figure 2 A,B) in line with their activity states. The major wave genes showed lower signal at 256-cell stage, in line with their later expression initiation at sphere/dome stages. Although not expressed at early blastula and only becoming active at significantly later (early segmentation) stages, the post gastrulation genes showed relatively high H3K4me3 signal, comparable to the major wave genes (Figure 2 A,B).
The contrasting dynamic of the H3K4me3 signal was also observed between stages, relatively high levels were observed at the 2-cell with a significant drop at 16-cell, most prominent in the constitutive and major wave gene sets. This dynamic indicates potential parental inheritance or early embryonic pre-marking, that is followed by subsequent erasure and re-deposition at later stages35. However, this “reprogramming” was not observed in the minor wave and post-gastrulation gene sets. In summary, minor wave genes show broadly similar epigenetic profiles to the major wave genes, but with higher H3K27me3 levels. However, there is a notable difference between miR-430 and other minor wave genes in the apparent lack of H3K4me3 at this locus.
Core promoter features distinguish minor and major wave genome activation
Previously, it was shown that zygotic genome activation in Drosophila is characterised by enrichment for the TATA-box48, elongated transcriptional activity states in early development49 and often associated with sharp transcription initiation profiles (Figure 3A). Notably, miR-430 promoters carry a canonical TATA box (Figure 3B) and sharp TSS profile (Figure 3C). In further pursuing features of minor wave genes, which may explain their distinct activation profiles, we analysed core promoter architecture of minor wave genes in relation to the 3 other groups. Sequence analysis of the 4 gene groups indicated enrichment for TATA-box at the canonical distance from the main TSS (Figure 3D) and corresponding sharp TSS in minor wave genes (Figure 3C). These promoter features related to but were not identical with the maternal transcription initiation code42 (see Discussion). However, the minor wave associated promoter profile was distinct from the major wave genes, characterised by lack of TATA-box (Figure 3D) and presence of broad TSS profile (Figure 3C). This result together suggests that miR-430 promoters carry shared and distinctive features with minor wave genes such as the presence of TSS-determining TATA-box or TATA-like sequence signals (W-box) and sharp TSSs.
Figure 3. Promoter architecture features of minor and main wave ZGA genes.

(A) Schematic comparing sharp and broad promoter architectures. (B) Sequence logo of 80 miR-430genes showing the −35 to +15 region relative to the dominant TSS. (C) Genome browser views showing promoter shape as defined by CAGE-seq signal for miR-430, and example genes for the minor (mxtx2) and the major (rgma) wave gene sets. (D) Promoter architecture comparison between the 4 gene sets. Left: sequence logos of the −35 +15 region relative to the TSS, right: percentage of the genes with sharp (red) and broad (blue) promoter in each gene set, determined by the IQW of the corresponding CAGE consensus cluster as demonstrated (A). (E) Chromosomal plot showing the location of sharp (red) and broad (blue) promoter znfs on chr4 and the location of the miR-430 cluster (orange). (F-G), Expression activity of sharp and broad promoter znfs determined by CAGE-seq (F) and EU nascent RNA-seq (G). (H-I) Comparison of the promoter motifs/architecture of the sharp (H) and broad (I) znfs. (J-K) Distribution of H3K4me3 signal around the promoter for the sharp (K) and broad (J) znfs. Abbreviations: TSS: Transcription Start; IQW: interquantile width. See also Table S2/S4
To further analyse the potential contribution of core promoter features to the timing of genome activation we have exploited a family of zinc finger genes (znfs) with distinguishable promoter features and differential expression timing during ZGA. The miR-430 cluster sits in a genomic environment, flanking a gene-poor region on the long arm of chr4, which shows distinct transcriptional dynamics from the rest of the genome50. The long arm of chr4, despite being relatively gene poor contains many C2H2-type znfs, some showing early zygotic transcription22,50. We investigated the transcriptional dynamics of these znfs using CAGE-seq and nascent RNA-seq revealing different temporal dynamic relating to distinct promoter architectures of these znfs. A subset of znfs with sharp, TATA-box promoters were found to be expressed at the minor wave, whereas broad promoter znfs, lacking a TATA-box were active at the major wave (Figure 3E–I, Table S3). This sharp promoter structure of the early expressed znfs was shared with miR-430 promoters (Figure 3B). The broad promoter of the main wave znfs was in line with the predominantly broad promoter containing main wave genes (Figure 3C,D). Notably, H3K4me3 signals were mostly lacking on the sharp promoter znfs expressed at the minor wave (Figure 3J), and thus resemble the miR-430 promoters, in contrast to the broad promoter znfs expressed during main wave, which carry H3K4me3 (Figure 3K).
The proximal promoter sequences of the miR-430 gene cluster autonomously activates early transcription in a single copy on heterologous chromosomes
To identify the promoter sequence features that may inform on the regulation of miR-430 expression we focused on regulators of the major wave ZGA 8,25,27. Publicly available ChIP-seq datasets27,51 were mapped on the de novo assembled miR-430 contig and signal distribution analysed. The majority of the Nanog signal was distributed over the promoter region, upstream of the TSS (Figure 3A), while Pou5f3 and Sox19b showed broader distribution, still focussed on the promoter region. The regions around the miR-430 cluster showed significantly less signal suggesting that these factors mainly bind proximally, with no indication of distal enhancers (Figure 4A and Figure S3A). In silico ClusterBuster transcription factor binding site prediction52 resulted in the miR-430 region being identified as one single cluster of binding sites (Figure 4A and Figure S3A). The binding sites for Nanog and Pou5f1::Sox2 were predominantly located in vicinity of the TSSs, with a Nanog motif at the peak of Nanog ChIP-seq signal (Figure 4A) and a high scoring Pou5f1::Sox2 site ~300 bp upstream of the TSS (Figure 4A).
Figure 4. A single copy of the miR-430 promoter including stem cell transcription factor binding sites is sufficient to activate reporter expression during the minor wave of genome activation.

(A) Browser views showing CAGE-seq signal (top track, blue bar) marking the position of the TSS (red arrowheads). ChIP-seq signal of Nanog (purple), Pou5f1 (green) and Sox2 (pink) are shown below. Bottom annotation tracks show the miR-430 gene features, with the core promoter (red), the precursor triplet (blue) and the position of predicted pluripotency factor binding sites. Purple dash line marks the Nanog binding site in the core promoter region close to the peak of the Nanog ChIP-seq signal. (B) Top: schematic of the generation of miR-430 promoter-containing stable transgenics reporter lines using the PhiC31 site specific integration system. Bottom: expression of the reporter miR-430 promoter (left) and γ-crystalline promoter (right), detected by RT-PCR at the indicated stages. Abbreviations: TSS, Transcription Start Site, γ-Cry (γ-crystalline C). See also Figure S3
The multicopy nature of the miR-430 locus may provide high density of cis-regulatory elements to counter the repressive effect of maternally deposited negative regulators of transcription, such as histones6,7. To test if the multi-copy state is required to drive activity at the minor wave of genome activation, we integrated a single copy of the miR-430 promoter with a reporter gene into heterologous genomic locations. A 650 bp proximal promoter fragment, containing the TATA-box plus Nanog and Pou5f1::Sox2 binding sites (Figure 4B, Data S1). was used to generate reporter transgenic lines using the PhiC31 integrase system53,54 (Figure 4B, Methods). Two lines were generated, integrated on chr17 and chr22 respectively. Expression driven by the miR-430 promoter was detected in both lines at 256/512-cell and sphere stages by RT-PCR (Figure 4B), which together with the lack of detectable expression at earlier or later stages, was in line with the expression dynamics of the miR-430. In contrast, reporter expression from the γ-crystalline promoter active in the lens55, was detected only at 96hpf as expected. These results together demonstrate that the miR-430 promoter sequence contained sufficient regulatory information to activate transcription at early pre-MBT/MBT stages.
The miR-430 gene cluster and its activity are required for the formation of a transcription body at the minor wave of ZGA
To dissect the contribution of underlying genomic sequence and miR-430 chr4 cluster transcription to transcription body formation, we used the CRISPR/Cas9 system to specifically target the miR-430 loci and recruit Cas9-driven loss-of-function tools to the core of the transcription body. This system was optimised for both lesion-generating active Cas9 and catalytically dead Cas9 (dCas9), which blocks transcription by sterically hindering Pol II, in a process termed CRISPRi56. To address the impact of Cas9-mediated lesion and CRISPRi on miR-430 activity, we used RT-PCR. A dramatic reduction in miR-430 RNA was detected at the 512-cell stage, following targeting of the miR-430 cluster by either active Cas9 or dCas9, comparable to total transcription loss achieved by triptolide or α-amanitin treatment (Figure 5A).
Figure 5. Manipulations that limit transcription of the miR-430 cluster also disrupt the transcription body.

(A) Schematic of a single miR-430 triplet showing the position of two qRT-PCR primer sets (orange and brown arrows). Chart shows relative levels of miR-430 RNA at the 512-cell stage, normalised to 5S rRNA, following miR-430 promoter targeting by Cas9 or dCas9, and triptolide (Trp) or α-amanitin (α-am) treatment, compared to control manipulations of active Cas9 targeting gol splice junction, dCas9 targeting gol splice junction and injection control, respectively. Data is based on three biological repeats. Error bars represent standard deviation and asterisks indicate significance-* for p<0.05 and ** for p<0.005. (B) miR-430 MO (red) labelled transcription bodies in live 512-cell stage embryos following either miR-430 promoter or gol splice junction mosaic targeting with dCas9-GFP (green). Grey boxes indicate enlarged region shown on the right; gol targeted: 10 embryos, miR-430 targeted: 8 embryos. White arrowheads: nuclei with two transcription bodies, open arrowheads: nuclei without detectable transcription bodies, scale bar 20μm. (C-D) EU labelling of nascent RNA (green), Pol II ser2P (red) immunostaining and DAPI (blue) in 512-cell stage embryos: Active Cas9; gol targeted: 6 embryos, 31 nuclei; miR-430 targeted: 6 embryos, 28 nuclei (C). Catalytically dead Cas9; gol targeted: 8 embryos, 52 nuclei; miR-430 targeted: 5 embryos, 29 nuclei (D). (E-F) EU labelling of nascent RNA (green) combined with FISH for miR-430 DNA (red) and DAPI (blue) at 512-cell stage: Active Cas9; gol targeted: 4 embryos, 21 nuclei. miR-430 targeted: 4 embryos, 41 nuclei (E). Catalytically dead Cas9; gol targeted: 5 embryos, 41 nuclei. miR-430 targeted: 8 embryos, 66 nuclei (F). White arrowheads (C-F): remnants of transcription body, scale bars 2μm. See also Figure S4
Using the MoVIE to image miR-430 nascent RNA accumulation in vivo 22 following mosaic CRISPRi with dCas9-GFP, we monitored the effect of miR-430 CRISPRi on the accumulation of miR-430 RNA. A dual injection setup allowed for the labelling of miR-430 RNA across the embryo, alongside mosaic and trackable CRISPRi reagents targeting either miR-430 or a control gene (gol) in a mosaic fashion (Figure 5B). We observed efficient CRISPRi, with loss of miR-430 transcription throughout the cell cycle and specifically in cells containing CRISPRi reagents targeting the miR-430 cluster, suggesting a cell autonomous, direct effect (Figure 5B). In 512-cell stage embryos where Cas9 was targeted to the miR-430 locus (Figure 5C,E), or dCas9 sterically blocked the miR-430 cluster (Figure 5D,F), we observed a loss of the transcription body; with nascent RNA accumulation and Pol II Ser2P signal reduced to background levels, and accompanied by a reduction in the size of miR-430 territory (Figure 5E). As shown previously22,23 the volume occupied by the miR-430 locus chromatin correlated with the transcriptional activity of the miR-430 cluster (Figure S4A). Additionally, under wildtype conditions the miR-430 territory occupied a small nuclear volume (<0.07μm3) during early interphase of the 512-cell stage, which grew (≤4μm3) as the cell progressed through prophase (Figure S4B), before re-compaction ready for the next cell division. A similar degree of transcription body loss (Figure S4C–E) and miR-430 locus compaction (Figure S4F–H) was observed following global transcription inhibition. Expression analysis at dome stage for other early genes on chr4, confirmed the dynamic and transient nature of this locus compaction with no permanent reduction in expression following miR-430 targeted manipulation distal to the miR-430 locus (Figure S4 I–L) suggesting that miR-430 DNA volume changes following manipulations was not a result of chromosomal segregation or loss of large chr4 segments.
Together these observations suggest that transcription of the miR-430 cluster is required for the formation and maintenance of the transcription body. We show that 3D expansion of the transcribed territory is dependent on miR-430 transcription specifically, in line with previous observations of the repeats co-transcriptionally forming a growing transcription body which expands the volume occupied by the loci23. Our experiments identify high promoter density and subsequent transcription of the 0.6 Mb miR-430 repetitive locus as the primary reason for transcription body formation.
Activity from the chr4 miR-430 locus is not required for minor wave ZGA globally
Nascent RNA and Pol II Ser2P imaging of pre-ZGA embryos showed that most minor wave transcription is concentrated within the miR-430-driven transcription body. This led us to query whether other early transcribed loci contributed or interacted with the transcription body, to enable their early escape from global transcription repression. To test whether the transcription body had a role in nuclear organisation, we investigated whether manipulation of miR-430 or its transcriptional activity would impact on other minor wave genes. Nascent RNA detection by RNA-seq upon miR-430 CRISPRi did not lead to repression of most minor wave genes apart from a family of chr4 znf genes (Figure S5). This loss of znf gene activity could be a result of pleiotropic effects including potential interference with replication57, as suggested by activation of stress and DNA damage response genes (Figure S5B). Therefore, we focussed on minor wave genes on other chromosomes where replication interference was not expected.
We focussed on klf17, a single copy gene residing on chr2, which showed transcriptional activity at the 512-cell stage and a sharp promoter structure with TATA-box. Using nascent RNA labelling combined with DNA-FISH we observed that klf17 loci reside in a distinct chromosomal territory to the transcription body, marked by nascent RNA (92.4% of klf17 loci observed distal to a major nascent RNA accumulation marking the transcription body, Figure 6A). The distal (95.1%) nature of klf17 locus from the miR-430 locus was confirmed by dual labelling in DNA-FISH at the 512-cell stage Figure 6B). Nascent RNA was accumulating proximal to the klf17 loci (white arrowheads Figure 6A), suggesting that the speckles sometimes visible both as nascent RNA and active pol II (Figure 5C–F) may be from other minor wave loci. These nascent RNA/pol II speckles were small with low signal intensity, emphasising the small number of transcriptionally active loci across the whole genome and their relative expression level to the miR-430 loci, at this early stage. Together, this data shows that although the transcription body is highly enriched for nascent RNA it is not a unique site of transcription within the early nucleus and single copy genes can escape global transcriptional repression despite occupying distinct topological domains from the transcription body.
Figure 6. miR-430 manipulations do not influence early zygotic transcription of minor wave genes on other chromosomes.

(A) Nascent RNA (green) combined with FISH for klf17 DNA (red) and DAPI (blue) in WT 512-cell stage embryos counter-stained with DAPI (blue). 59 nuclei from 16 embryos. Right, chart shows frequency of colocalization frequency between klf17 DNA or RNA and major nascent RNA accumulation (transcription body) in 3D space (59 and 54 nuclei respectively). (B) Double DNA-FISH labelling the miR-430 cluster (green) and the klf17 locus on chr2 (red) in WT 512-cell embryos counter-stained with DAPI (blue). 51 nuclei from 8 embryos. Chart shows frequency of colocalization between klf17 DNA and miR-430 DNA in 3D space. White arrowheads indicate klf17 locus, open arrowheads (A,B) indicate the miR-430 transcription body in (A-B). (C-D) Change in expression in WT 512-cell stage embryos, following manipulations, for miR-430 normalised to 5S rRNA (C), and klf17 normalised to TBP mRNA (D). Charts show mean log2(fold change) between Cas9/dCas9 targeting a control vs targeting miR430, or α-amanitin treatment compared to injection control, from 4 biological repeats. (E) Nascent miR-430 (top) or klf17 RNA (bottom) staining at 512-cell following manipulations. Numbers indicate frequency of staining pattern, scale bars 5μm.(F-G), Relative change in expression, in Tg(Xla.crygc:attP-Gal4vp16,14UAS:Clover)UoBL1 embryos, at the 512-cell stage, following manipulations, for miR-430 RNA , normalised to 5S rRNA (F), or gal4 RNA normalised to TBP mRNA (G). Charts show mean log2(fold change) between Cas9 (n=3 biological repeats) or dCas9 (n=4) targeting, a control vs targeting miR-430, or α-amanitin treatment compared to injection control. (C,D,F&G) Error bars represent standard deviation and asterisks indicate significance- “ns” for p>0.05, * for p<0.05, ** for p<0.005 and *** for p<0.0005.. See also Figure S5/S6
To investigate whether any transient interaction not captured by these fixed imaging approaches, enabled miR-430 activity to influence early klf17 transcription we followed klf17 RNA levels upon miR-430 targeted disruption. The manipulation of miR-430 by either Cas9 or dCas9 did not have significant effect on klf17 RNA levels, while global transcription inhibition induced a significant loss in klf17 RNA (Figure 6C–E, Figure S6A–C). Other early zygotically expressed genes, wnt11f2 and hspb1 (both chr5), also failed to show a response to miR-430 targeted manipulations (Figure S6D,E). This lack of response to miR-430 manipulations suggests that the transcription body did not exert a global effect influencing minor wave activation of genes on other chromosomes, or on the short arm of chr4 (gata3).
To further investigate dependence of minor wave of gene activation on the miR-430 locus, we asked whether transgene activity from a single copy of the miR-430 promoter, would be affected by loss of miR-430 cluster activity. To answer this miR-430 promoter manipulation was performed in the single miR-430 promoter-driven gal4 transgenic line (chr22 transgene, Figure 3B), and the transcriptional outputs of the miR-430 cluster and the single miR-430 promoter-driven gal4 transgene were measured. The targeting guide RNA did not recognise the single transgenic miR-430 promoter but specifically targeted the endogenous miR-430 cluster. Figure 6F,G shows that single miR-430 promoter activity was not significantly affected by either Cas9 or dCas9 targeting the chr4 miR-430 cluster while global transcription block confirmed transgenic miR-430 promoter activity before global genome activation. This suggests that the miR-430 single promoter sequence contains the necessary determinants to efficiently engage in transcription before the main wave of global genome activation.
DISCUSSION
Much is already known about the mechanisms and regulatory networks underlying the main wave of zygotic genome activation, but the mechanisms governing the very first steps of global genome activation are still unclear1–3. Here we explored the minor wave gene activation by studying the miR-430 cluster, the first known expressed genes in zebrafish20. We show that this cluster is composed of unexpectedly high promoter/gene density, which define and is required for the formation of a transcription body, enriched for nascent RNA and Pol II Ser2P during pre-ZGA cell cycles15,22,23. The promoter-dense locus structure provides explanation to the above listed nuclear topology-defining biochemical features and presents a useful experimental model for future transcription imaging and molecular dissection of native transcription machinery. We also demonstrated that not all minor wave transcription occurs in or is dependent on the activity of the miR-430 transcription body. Moreover, we have demonstrated that minor wave genes including the miR-430 cluster share epigenetic and promoter architecture features characteristically distinct form the major wave (Figure 7).
Figure 7. Models of minor wave gene activation in and outside of the miR-430 transcription body.

(A) The miR-430 cluster on chr4 with high promoter density forms a microenvironment during the minor wave of ZGA. Minor wave gene activation occurs distal to the transcription body, such as at the gata3 and klf17 loci, which share promoter architecture features with miR-430 gene but are activated independently from the transcription body (top). Genes that have distinct promoter features from minor wave genes are not activated until the major wave of ZGA (bottom), while minor wave genes continue to function during the major wave of ZGA.
Extreme density of promoter/gene cluster underlies the formation of a minor wave-associated transcription body
We demonstrated by several independent lines of evidence that the copy number of miR-430 transcribed units is almost two orders of magnitude higher than described in the reference genome GRCz11. This highlights the need for end-to-end genome assemblies to resolve highly repeated loci 58. Our locus assemblies, from multiple zebrafish strains suggest that the hundreds of copies of promoters is a robust feature of common zebrafish strains. MiR-430 homolog loci are also multicopy in medaka (manual analysis of the medaka59 and goldfish genomes60) likely indicating a crucial role for abundance of these miRNAs in clearance of maternal mRNAs21. Nevertheless, the exact composition of the gene sets within the cluster appears to be variable and merits further analysis, given the significance of zebrafish chr4, with unique gene organisation50 .
Notably, genome activation is also concentrated in discrete, Pol II Ser2P-containing nuclear compartments in Drosophila16,48,61. Similarly, to zebrafish, genome activation in human and mouse embryos involves multicopy transcribed repeats62,63. Recent in vivo transcription imaging has revealed distinct Pol II Ser2P accumulation foci in several mammalian cells64,65 , reminiscent to that seen in an exaggerated form in the minor wave in zebrafish embryos. Overall, these observations from a variety of models suggest gene clusters are often organised into distinct nuclear topologies66. Thus, understanding the mechanisms underlying the formation of the zebrafish transcription body may reveal genome activation-associated transcription control as well as fundamental regulatory principles of transcription-associated nuclear topology.
The 0.6 Mb miR-430 region packed with >300 promoters suggested that the mechanisms for the early escape from global transcriptional repression may arise from bulk properties and macro-nuclear dynamics. The miR-430 promoter-dense cluster may form a transcriptionally competent body in which the nucleo-cytoplasmic ratio can be passed early in the local microenvironment. However, this model is not supported by two observations. Firstly, miR-430 early activation does not respond to change of the nucleo-cytoplasmic ratio by ploidy manipulation15,22. Secondly, in this study, minor wave activity of a single miR-430 promoter inserted in a heterologous genomic location was demonstrated. This indicates that the large copy number of miR-430 was not necessary for reaching a threshold of transcriptional competence, and the promoter sequence contained the necessary regulatory information for early activation. We propose that the high promoter density facilitates transcription body formation and boosts the promoter-autonomous responsiveness of the miR-430 promoters for high levels of activation (Figure 7).
Distinct promoter features shared by minor wave ZGA genes
Previous studies have shown that miR-430 transcription requires H3K27ac deposition, binding of stem cell factors Sox19b/SoxB1 Nanog and Pou5f1/Pou5f325, and it is characterised by CTCF and Rad21 deployment15,24,25 at a stage when topology associated domains have not yet formed32,67. However, the question remains; what mechanism triggers miR-430 transcription and that of other minor wave genes? While the stem cell factors Pou5f3/Pou5f1, SoxB1/Sox19b and Nanog were shown to be required for miR-430 gene activation8,25,26, they are unlikely to be sufficient for minor wave genome activation, as many major wave genes also depend on these factors8,13,25,28,68.
We demonstrated that minor wave genes are enriched in sharp promoters, carry TATA-box, and similarly to Drosophila48,49 both are features that commonly lack H3K4me3 (reviewed in Lenhard et al. 69). The TATA box and associated positionally-constrained TSS usage resembles the maternal transcription initiation code we previously described42. Oocyte-active genes deposited as mRNA into the embryo are characterised by TATA-like sequences (W-box) and associated distance constraints on the TSS choice, similarly to that seen with the canonical TATA-box. These TSS constraint similarities may indicate shared transcription initiation machineries regulating maternal and minor wave TSS determination despite the differences in their TSS profiles.
In contrast to minor wave genes, TATA-dependent sharp promoters are distinctly lacking at major wave-specific genes42 suggesting functional distinction in the transcription initiation machineries acting on them70–72. However, TATA-dependent sharp promoters are not restricted to the minor wave and yet unidentified factors likely play crucial roles in specifying early zygotic gene activity (candidates include homologs of GAF 73 or Dux74,75). The correlation between TATA box/sharp promoters with minor wave activation is further supported by our analysis of minor wave znf genes interspersed with major wave znfs on chr4. These major wave genes either lack binding sites for minor wave active pioneering factors or their core promoter sequence drives promoter architecture differences in activation-specificity 72,76,77 resulting in the lack of responsiveness of broad promoters to minor wave active trans-activators. Future work may address how minor wave genes bind pioneering factors, which may selectively recognise TATA box dependent, sharp TSS core promoter codes or exploit a favourable chromatin environment at the minor wave genes.
When searching for the promoter features of minor wave genes we observed a distinct lack of H3K4me3 at miR-430 and at minor wave-active znf genes. This mark is generally associated with gene regulation but decoupled from transcriptional activity: with H3K4me3 detected on promoters well before ZGA, upon inhibition of ZGA, and also in transcriptionally inactive sperm14,30,35,42. While this histone mark may be paternally inherited, as seen in mouse78, we do not see indication of such histone modification-dependent inheritance in activation of minor ZGA genes in zebrafish.
We also observed that sharp TSS, TATA promoters are less likely to carry the H3K4me3 mark than broad promoters (reviewed in Lenhard et al. 69) and further suggesting that minor wave gene activation is not globally dependent on H3K4me3-associated mechanisms, as observed in Drosophila79. However, minor wave gene promoters are not always deficient of the H3K4me3 mark. It is conceivable that H3K4me3 is not functional during minor wave activation but is a pre-marking mechanism utilised later in development. H3K4me3 marks may be interpreted by distinct transcription machineries in different stages of development, similarly to how distinct promoter sequence determinants within the same promoters are selectively used during maternal to zygotic transition42.
Notably, minor wave genes, with H3K4me3 enriched promoters also show H3K4me3 enriched at the gene body and coupled to H3K27me3. This observation may indicate enrichment for chromatin bivalency on developmental regulator genes as described in embryonic stem cells (reviewed in Voigt et al. 80).
MiR-430 promoter cluster forms the transcription body but is not required for all minor wave gene activation
Previously it was demonstrated that miR-430 expression is a component of the transcription body15,22,23. Here we demonstrate that transcription of the miR-430 cluster is specifically required for the formation of this transcription body. Similarly, we observe a reduction in nuclear volume occupied by the miR-430 cluster of chr4 following CRISPRi targeting. This correlates with the proposal that high levels of transcription expand chromatin23, and was suggested to form a favourable microenvironment, which may further promote miR-430 transcription. Our results suggest that during the interphase of these early cell cycles, the miR-430 cluster becomes de-compacted. When miR-430 transcription is terminated at a later stage of development in wild type or during the minor wave in manipulated embryos the locus becomes compact and occupies a small nuclear volume, throughout the cell cycle.
The high density of binding sites for stem cell factors contained within the miR-430 promoter cluster may function as ‘enhancers’ for these genes. In this context the 0.6 Mb miR-430 locus, enriched in H3K27ac and stem cell factor binding sites, is not dissimilar from previously described “enhancer clusters” or “super-enhancers”81. The large number of promoters observed here fits with a recent computational model of enhancer-promoter interactions, suggesting generality of equivalent topological and functional impact of enhancers and promoter clusters82.
We have shown, that despite most of the nascent RNA and Pol II Ser2P accumulating at the miR-430-dependent transcription body, minor wave genes do not necessarily colocalise or depend on the miR-430 transcription body, for their activity. This indicates that the specificity of minor wave activation is not based on an exclusive and localised mechanism for transcriptional competence within the transcription body. As exemplified by our single copy transgenic miR-430 promoters and that of endogenous single copy genes, they can autonomously escape the global repressive environment prior to the major wave of ZGA. Similarly, topologically independent activation of minor wave ZGA genes has also been detected in Drosophila83. Our promoter architecture analyses suggest that the autonomy of minor wave gene activation likely resides in the distinct promoter structure characterised by the TATA box and sharp peak TSS choice and does not ubiquitously require H3K4me3 histone marks at the promoter.
The gradual nature of genome activation which manifests as a continuity between the minor and major wave observed in several animal models led to suggestions that the two waves are not distinct (reviewed in Vastenhouw et al. 3). However, the distinct promoter structure of minor wave genes, which discriminate them from the major wave of ZGA, suggest discontinuity in the mechanisms of minor and major wave of genome activation.
Limitation of the study
Due to limitations of the currently available genome assembly software to handle large tandem repeats (such as the miR-430 locus), the exact copy number/structure of the de-novo assembled miR-430 locus may not be entirely accurate. Strain and individual variations are also possible.
Short bursts of transcription in the very short cell cycles (15-20 min) during cleavage stages, may limit the quantification accuracy of lowly expressed genes.
STAR METHODS
Resource Availability
Lead contact
Ferenc Mueller (f.mueller@bham.ac.uk)
Materials Availability
Materials and reagents generated in this study are available upon request from the lead contact.
Data and Code Availability
Log read sequencing and nascent (EU) RNA-seq data are deposited at NCBI Sequence Read Archive (SRA) under BioProject PRJNA900028.
This paper does not report original code.
Raw microscopy images and additional information required for data reanalysis are available upon request from the lead contact.
Experimental model and subject details
Zebrafish maintenance
All zebrafish strains were maintained in a designated facility (according to UK Home Office regulations) in a recirculating system (ZebTEC, Tecniplast) at 26°C in a 10-hour dark, 14-hour light photoperiod and fed 3 times daily. Fish were kept in 3 or 6 litre containers at recommended density of 5 adult fish per litre.
Zebrafish embryos were obtained by natural breeding and maintained at 28°C in E3 medium until desired developmental stages were reached.
Animal work presented in this study was carried out under UK Home Office project licence P51AB7F76 assigned to the University of Birmingham, UK, except the generation of heat shock diploid “double heterozygous” Tuebingen-AB hybrid zebrafish, which was carried out in Shawn Burgess’s laboratory at NIH/NHGRI.
Method details
Isolation of high molecular weight zebrafish genomic DNA
High molecular weight genomic DNA was isolated from one AB male by proteinase K and phenol extraction following the protocol by Green and Sambrook84. Adult fish was euthanized by overdose of anaesthetic (Tricaine) and snap frozen in liquid nitrogen. The frozen tissue was pulverised with liquid nitrogen precooled ceramic pestle and mortar. The powder was slowly spread over the surface of 20 ml lysis buffer in 100 ml beaker. After complete submerging of the tissue powder into the lysis buffer the lysate was transferred to 50 ml falcon tube and treated with pancreatic RNase for 1 hour at 37°C and proteinase K overnight at 50°C, followed by three phenol extractions. The DNA was precipitated from the purified lysate by addition of 0.2 volume of 10 M ammonium acetate and 2 volumes of ethanol, washed twice with 70% ethanol air-dried and reconstituted in TE buffer.
Oxford Nanopore sequencing
Nanopore sequencing library was prepared with Genomic DNA Ligation Sequencing Kit (Oxford Nanopore, SQK-LSK110) according to the manufacture instructions, using 1 μg genomic DNA as input and sequenced on Oxford Nanopore Promethion device. The sequencing run resulted in 1.7133x107 reads and 1.3273x1011 bp in total (app. 44x coverage of the ~1.7Gb zebrafish genome).
Pacific Biosciences (PacBio) sequencing
For the PacBio assembly, Gynogenic offspring of Tuebingen-AB hybrid zebrafish were generated according to the protocol for Production Of Homozygous Diploid Embryos by heat shock as described in The Zebrafish Book36. In more details zebrafish eggs were in-vitro fertilised with ultraviolet light (UV) inactivated sperm. Thirteen minutes after fertilisation, embryos were heat shocked at 41°C in water bath for 2 min and immediately transferred to 28°C, causing the fertilised embryos to skip the first cell division. Homozygosity was confirmed by PCR amplifying 8 independent loci and confirming there were no single nucleotide variants (SNVs) within any sequence. Genomic DNA was purified using TissueLyser II (Qiagen) and Blood & Cell Culture DNA Maxi Kit (Qiagen). The molecular size of genomic DNA at the peak of 40- to 50-kb was confirmed using the Pippin pulse electroporation system (NIPPON genetics). Genomic DNA from the TU/AB double heterozygous fish described above was used to perform whole-genome shotgun sequencing on a PacBio RS II sequencer. ~16 million subreads with a peak length of ~8kb (100X coverage) were collected and used to de novo assemble the genome using the CANU assembler.
De novo genome assembly of long read data
The Oxford nanopore and PacBio sequencing reads were assembled into contigs using Canu software v.2.1.137 with the following parameters for nanopore reads:
-nanopore genomeSize=1.7g minReadLength=5000 minOverlapLength=1000
and PacPio reads:
-pacbio genomeSize=1.7g minReadLength=1000 minOverlapLength=500
To produce guided whole genome assembly from the nanopore data a haplotype purge was performed on the assembled contigs with purge_dups85, following the pipeline guide with default parameters as outlined on (https://github.com/dfguan/purge_dups).
Using the current zebrafish genome (GRCz11) as reference, a guided scaffolding into chromosomes of the haplotig purged assembly (~1.4 Mb in size) was performed with RaGOO v1.186 according to the default pipeline (https://github.com/malonge/RaGOO). enabling misassembly correction with the error corrected nanopore reads (generated by Canu during the assembly step):
ragoo.py hap purged ctigs.fa GRCz11chr ref. fa -R CorrNPRds.fa -T corr
All assemblies were carried out on the University of Birmingham high performance computing cluster BlueBEAR.
Estimation of miR-430 promoter number from raw long reads
To estimate the miR-430 promoter copy number 250 bp promoter region sequences of miR-430 and 6 single copy genes six single copy genes were randomly selected from the Benchmarking Universal Single-Copy Orthologs (BUSCO) database87,88 (Actinopterygii gene set) and confirmed by BLAST38,39 search that the selected 250 bp sequence produced a single hit in the current (GRCz11) zebrafish reference genome. The miR-430 and the 6 single copy genes promoter sequences were used to perform a BLAST search against raw reads BLAST database for each sequencing run. BLAST hits with bit score ≥ 150 were counted for each gene and miR-430 counts were normalised to each of the 6 single copy genes and the average was used as miR-430 promoter number estimate. The genomic coordinates (danRer11) proximal promoter coordinates of miR-430 and the 6 single copy genes are provided in Table S1.
Estimation of miR-430 promoter number by digital droplet PCR (ddPCR)
Genomic DNA from three stains AB, Tuebingen (TU) and Tuebingen Longfin (TL) was prepared from 50, 2-day old embryos collected from a single pair for each strain. The DNA extraction was carried out with the PureLink™ Genomic DNA Mini Kit (ThermoFisher Scientific, K182001) following the manufacture instructions. Genomic DNA was digested with EcoRI-HF (New England Biolabs, NEB), for one hour. Initially dilutions down to 2 ng/μl were prepared from the digested DNA and quantified spectrophotometrically, using NanoDROP (Thermo Scientific, Thermo Fisher Inc, USA). Further dilutions in TE buffer (10mM Tris-HCl, 1 mM EDTA, pH 7.5) to a final concentration of 100 pg/μl were performed using (Fluro dsDNA High Sensitivity kit, DeNovix California, USA), following manufacturer’s instructions. Standard curve ranging from 0 ng/ml to 25 ng/ml, DNA samples and blank (no template) were measured in duplicate using DS-11 spectrophotometer-fluorometer (DeNovix Inc. USA). By plotting the measured fluorescence versus DNA, concentrations were calculated through a standard curve plot.
For the ddPCR reaction mixture, DNA was diluted to 50 ng/μl and then added to 2 ×DX200™ ddPCR™ Evagreen supermix (Bio-Rad, USA) and primers (0.5 μM) in final volume of 22 μl. 20μl of mixture was loaded into a cartridge (Bio-Rad, USA) together with 70 μl of droplet generation oil (Bio-Rad, USA) and placed into the droplet generator (Bio-Rad, USA). After that, each sample was transferred to a 96-well PCR plate (Bio-Rad, USA) and PCR amplification was performed using C1000 thermal cycler (Bio-Rad, USA) with the following program: 95°C for 5 minutes, 40 cycles at 95°C for 30 sec and 60°C for 30 sec; 4°C for 5 min followed by 90°C for 5 minutes; 4° C for 30 minutes. After the amplification, the plate was loaded on the QX200 Droplet Digital Reader (Bio-Rad, USA) and acquired data were analysed with QuantaSoft Analysis Pro software (Bio-Rad, USA).
After a serial dilution assay, 50 ng was selected as DNA concentration giving 1 copy/μl of the shha, single copy gene, used as invariant gene. The final number of miR-430 promoter copies is calculated by the ratio of miR-430 primer pair (copy/μl) and the shha primer pair (copy/μl) (Supplementary Tables 4,5).
Promoter density analysis
CAGE-seq data from Nepal et. al40 were mapped to the zebrafish long-reads assembly genome with Bowtie v1.2.389 in default n-mode allowing 2 mismatches in the 27 bp seed region and reporting all the best alignments up to 1000 (-S -n 2 -l 27 -a -m 1000 --best --strata). The CAGEr package90 was used for downstream processing of the data. First, CAGE Transcription Start Site (CTSS) were called in each of the analysed samples removing the additional G nucleotide (due to the CAGE protocol) not mapping to the genome. Next, reads were counted at each CTSS and subsequently normalized as tags per million (tpm). CTSS supported by at least 0.5 tpm in at least two samples and closer than 20 nucleotides were clustered thus defining the so-called transcriptional clusters (TCs), discarding singletons TCs (i.e., clusters containing only one CTSS). TCs were then trimmed on the edges to obtain a more robust estimation of the promoter width. Toward this end, first the cumulative distribution of CAGE signal along the promoter was defined and the promoter region comprised between the 10th and 90th percentiles of the CAGE signal distribution was considered, as suggested in90. Finally, TCs across all the analysed samples were aggregated, if supported by at least 5 tpm and closer than 100 bp, to form consensus clusters (CC) for downstream analyses. Having defined the final set of promoters (i.e., consensus clusters), the promoter density was calculated as follows. First, using the clusterdist algorithm of the ClusterScan tool (-d 10,000 parameter)91, the zebrafish genome was scanned grouping together all the consecutive promoters closer than 10 kb. Then, for each group of promoters (clusters), the promoter density was calculated by dividing the number of promoters by the cluster length in kilobases. Finally, the rainfall plot representing the promoter density shown in Figure 1E was obtained using the karyoploteR R library92.
Processing of CAGE-seq data
CAGE-seq data set (accession PRJNA169500) from Nepal et al. 40, were mapped with Bowtie v1.1.289 in default n-mode allowing 2 mismatches in the 27 bp seed region and reporting alignments of reads with up to 1 or 1000 valid alignments for unique (‘-S -n 2 -l 27 -a --best -m 1’) and multimapping (‘-s -n 2 -l 27 -a --best -m 1000’) respectively. The CAGEr package90 v1.18 was used for downstream processing of the data, i.e., CAGE Transcription Start Site (CTSS) calling and clustering into tag and consensus clusters (TCs and CCs), interquantile width calculation.
Processing of ChIP-seq and ATAC-seq data
Prior to mapping ChIP-seq and ATAC-seq reads were trimmed from adapters and filtered for quality using TrimGalore with automatic adaptor detection option and quality threshold of 20. Only reads where both mates survived the filtering steps were kept in case of paired end data (https://www.bioinformatics.babraham.ac.uk/projects/trim_galore).
The data were mapped to a reference genome (danRer11) using segemehl aligner (v0.3.4)93 Allowing up to 2500 alignments per read and alignments accuracy of 90 % (command line parameters: ‘ segemehi.x -M 2500 -a 90’). Genome coverage was generated using STAR94 with command line parameters: ‘--runMode inputAlignmentsFromBAM -outWigType bedGraph --outWigStrand Untranded --outWigNorm RPM’.
To compare the dynamics of the epigenetic features between the different gene sets (Figure 2A,B) and datasets, the distribution of average normalised signal relative to the transcription start site for each set and feature was visualised on aggregation plots with the Bioconductor SeqPlots package95 providing the coverage file and genomic regions of features of interest as input with 20 bp bin size. For visualisation purposes a smoothing spline function was applied before plotting.
The transcription start sites (TSSs) were determined using the CAGE-seq dataset40 at a developmental stage where there was sufficiently high signal to accurately determine the dominant TSSs for each gene in the set, or to minimize interference from the maternal contribution in the case of the constitutive gene set. For the miR-430, minor and major wave gene sets high, sphere and 30%-epiboly were used for dominant TSS detection, respectively. For both the constitutive and post-gastrulation sets prim-5 stage was used.
The publicly available ChIP-seq and ATAC-seq data used in this study were obtained from the Sequence Read Archive (SRA) deposited under following BioProject accessions: PRJNA43421614 (H3K4me3 and H3K27me3 ChIP-seq); PRJNA473799 (H3K27ac ChIP-seq); PRJNA395463 (ATAC-seq); PRJNA156233 (Nanog ChIP-seq); PRJNA171706 (Pou5f1 and Sox2 ChIP-seq).
Promoter architecture analyses
To compare core promoter motif composition between gene set (minor wave, major wave, constitutive and postulation) promoter sequences were extracted and centre-aligned to the dominant TSS.
Position weight matrices (PWM) for each core promoter set was calculated from the sequences using the “DiffLogo” R package96 and motif sequence logos were visualised with the “ggseqlogo” R package97.
Promoter architecture (sharp/broads), was determined for each gene in the above four datasets, using the 0.1-0.9 interquantile width (the length of the region in bp where 10%-90% of the CAGE signal is concentrated) of the promoter associated CAGE-tags consensus clusters. Promoters with interquantile width up to 10 bp were classified as sharp and with more than 10 bp as broad.
Transcription factor binding motif analyses
Enrichment for clusters of TF binding sites was done using Cluster-Buster52 with the following parameters: ‘cbust -r10000 -m 5 -c 10’. The optimal motif weights as abundances of the motifs (occurrences per kb) and the average distance between neighbouring motifs to use with Cluster-Buster was calculated using Cluster-Trainer, ran with the following parameters: ‘ctrain -t 10 -r 10000’. As input, a 1.6Mb sequence region, extracted from chr4 of the guided genome assembly of the Nanopore sequencing, flanking the miR-430 cluster (500 kb up- and downstream) was used. Position frequency matrices for Nanog (UN0383.1), Pou5f1::Sox2 (MA0142.1) and Sox2 (MA0143.3) where obtained from JASPAR(2020) database98,99 (http://jaspar.genereg.net)
Generation of stable transgenic zebrafish reporter lines.
The construct Xla.crygc:attP-Gal4vp16-14UAS:Clover for generation of docking transgenic lines for usage with the PhiC31 integrase mediated targeted transgene integration system was generated by replacing the eGFP reporter form pDB783:Xla.crygc:attP-Gal4vp16-14UAS:eGFP (gift form Darius Balciunas, Temple University, PA) with the brighter green fluorescent protein Clover.
Docking lines were generated using the Tol2-mediated transgene integration system53,100,101. In detail 1-cell stage AB wildtype embryos with 1nl solution containing 20ng/μl plasmid and 20ng/μl Tol2 mRNA, supplemented with 0.1% phenol red as injection marker. Injected embryos were kept in E3 medium at 28°C and screen for lens expression (green fluorescence) between 72-96hpf. Positive embryos were grown to adulthood, outcrossed to wild type fish and germline transmitting founders (F0) were identified by screening the resulting F1 embryos for lens expression (green fluorescence) at 72-96hpf. Positive F1 embryos were grown to adulthood to establish stable transgenic lines. Three docking lines in total were established and two of them (Tg(Xla.crygc:attP-Gal4vp16, 14UAS:Clover)UoBL1 and Tg(Xla.crygc:attP-Gal4vp16, 14UAS:Clover)UoBL3) were used to generate miR-430 promoter reporter lines (see below).
The miR-430 promoter region fragment (~650 bp, Data S1) was PCR amplified from zebrafish genomic DNA using the following forward: actcacgtgtggtaccCTTAGTCACCTCTGCCCACCAAG and reverse: catcgataagcggccgcTCCGTTCATAGTCTTTAGCAGCAAG primers (lower case letters correspond to the vector homology arms, upper case letters are specific to the miR-430 promoter regions). The fragment was then cloned into modified pJet:attB:mCherry vector53 containing phiC31 attB site and mCherry reporter using In-Fusion HD Cloning Kit (TaKaRa/Clontech) according to the manufacture instructions. In brief, the pJet vector was digested with Acc65I and NotI restriction enzymes. The purified linearized vector and miR-430 promoter fragments (in 1:3 molar ratio) were incubated with 1x In-Fusion HD cloning mix at 50°C for 15 min and 2 μl of the cloning reaction was transformed into the kit-provided Stellar competent cells. Positive colonies were identified by PCR and the isolated plasmid verified by restriction digestion and sequencing.
MiR-430 promoter reporter lines were generated by following the PhiC31 integrase mediated targeted transgene integration protocol as described in Hadzhiev et al.54. One-cell stage docking line embryos were micro-injected with 1 nl solution containing the reporter plasmid (20 ng/μl) supplemented with PhiC31-nanos 3’UTR mRNA (30 ng/μl). The efficiency of integration events was determined by frequency of lens colour change (from green to red) in the injected embryos at 72-96 hpf. If lens colour change is observed in more than 5 % of the embryos in an injection batch all the embryos from the batch are grown to adulthood, including those without lens colour change, because integration events may have happened with higher frequency in the PGCs due to nanos 3’UTR driven localisation of the PhiC31 integrase mRNA occurring predominantly in the PGCs.
Identification of transgene integration sites.
The integration site of the Tg(Xla.crygc:attP-Gal4vp16, 14UAS:Clover)UoBL3 line has been previously identified (by nanopore sequencing) to be on chr17 ~7 kb upstream of slc16a9a and ~6kb downstream of npy4r (chr17:20640317-20646440, danRer11).
The integration site of the Tg(Xla.crygc:attP-Gal4vp16, 14UAS:Clover)UoBL1 was identified by inverse PCR following the protocol byGreen and Sambrook 102. Genomic DNA was prepared from about 100 4 days old transgenic embryos using PureLink™ Genomic DNA Mini Kit (Themo Fisher, K182002). 5 μg of genomic DNA was digested in three separate reactions with TaqI, a mix of BamHI/BclI/BglII and a mix of XbaI/SpeI/AvrII/NheI restriction enzymes for 2 hours. The restriction digest reactions were purified by phenol-chloroform extraction. The digest DNA was ligated overnight at 16°C at final concentration of 500pg/μl using 5U of T4 DNA ligase in a total volume of 100 μl. Amplification of the genomic flanking sequences was achieved by performing two nested PCR reactions in total volume of 50 μl. For all enzyme mixes, the flanking sequence of the 3′ end of the transgene was amplified with primer pair 3PinvP_F1/3PinvP_R1 in the first PCR reaction using 3 μl of the ligation mixes as template, followed by the second PCR reaction with 3PinvP_F2/3PinvP_R2 using 1 μl from the first PCR reaction as template.
Similarly, for Taql and BamHI/BclI/BglII mix the flanking sequence of the 3′ end of the transgene was amplified using the primer pairs 5PinvP_F1/5PinvP_R1 and 5PinvP_F2/5PinvP_R2 in the first PCR and second PCR reaction respectively. The 5′ end transgene flank from the XbaI/SpeI/AvrII/NheI digestion mix was amplified using the primer pairs 5PinvP_F3/5PinvP_R1 and 5PinvP_F4/5PinvP_R2 in the first PCR and second PCR reaction respectively.
The products of the second PCR reactions were purified using AMPure XP beads and sequenced. The sequencing result of all six PCR products (for both 5’ and 3’ ends and 3 different restriction enzyme combinations for each end) confirmed the integration site to be on chr22 into the 5’UTR of the ccdc50 gene (chr22:24318507-24318514, danRer11). All primers sequences are provided in Table S4.
Reporter expression analyses of miR-430 promoter stable transgenic lines by RT-PCR
Total RNA was extracted from ~50 embryos at the relevant developmental stage, using miRNeasy mini kit (QIAGEN, 217004) following kit instructions. On-column DNAse treatment was performed using RNAse-free DNAse Set (QIAGEN, 79254). Reverse transcription was carried out using 1 μg of total RNA, 0.5 μg of random hexamers (Promega, C1181) and 200U M-MLV reverse transcriptase (Promega, M170A) in 25 μl reaction volume. PCR reactions were performed with GoTaq® Hot Start Master Mix (Promega, M5122) using 1 μl of the reverse transcription reaction as template in 20 μl reaction volume. Thirty amplification cycles were carried out in total and PCR reactions were analysed on agarose gel electrophoresis. The following primer pairs were used: miR430_Prom_FP: AGCAGACAACAAGATGCGTGTG with Gal4VP16_RP: ACTTCGGTTTTTCTTTGGAGCAC and γ-crystalline_Prom_FP GAAACTTCCACTCAGTCAGACTTGC with mCherry_RP: CACCTTGAAGCGCATGAACTC.
Injections at single cell stage for ubiquitous delivery vs late-stage injection for mosaic treatments
For dCas9 and Cas9 targeting, a 1:1 ratio mix of two guide RNAs targeting the miR-430 repeats or one guide targeting the gol promoter was used. Injection mixes for CRISPR mediated manipulations consisted of 650 ng/ul dCas9 protein (NEB, M0652) or Cas9 protein (NEB, M0646), and 200 ng/ul of guide RNA. For visualisation of CRISPRi knockdown reagents 400 ng/ul dCas9-GFP protein (Novateinbio, PR-137213G) and 200 ng/ul of guide RNA was used. These injection mixes were preincubated together at 37 °C for 5 minutes to facilitate complex formation, before supplementation with 0.1% phenol red and injection. Ubiquitous delivery of knock-down and labelling reagents was achieved by 1 nl injection of embryos at the one-cell stage. Mosaic knock-down was produced by 1 nl injection into a single cell at the 8-cell stage.
Nascent RNA capture and sequencing upon dCas9 inhibition of miR-430 transcription.
To capture nascent RNAs, The Click-iT® Nascent RNA Capture Kit (ThermoFisher Scientific, C10365) was used. Embryos were injected with CRISPRi reagents (as described above) and ~30-40 pmols of Click-iT® EU (5-ethynyl Uridine) at one-cell stage. At 512-cell, total RNA from 20 embryos of each treatment and control groups was extracted using TRIzol reagent (Invitrogen). The isolated RNA was biotinylated and captured on streptavidin coated magnetic beads, following the manufacturer’s instructions of the Click-iT® Nascent RNA Capture Kit. The beads were resuspended in 5 μl Click-iT wash buffer2 and used directly as input for cDNA synthesis and stranded RNA-seq library preparation with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (E7760S). The RNA-seq libraries (two biological replica for each treatment and control groups) were sequenced (2x100bp, paired-end) on Illumina NovaSeq 6000 platform.
Analysis of the nascent (EU) RNA-seq data.
Reads were mapped to the zebrafish reference genome (danRer11) using segemehl (v0.3.4) in split(splice) mode, allowing up 2500 multimappers: ‘segemehl.x -M 2500 -S’
Htseq-count (v 0.12.4) was used to count reads (including multimappers) associated with a gene feature (ENSEMBL 95 gene annotations): ‘htseq-count --a=0 --nonunique all --stranded=reverse’
DESeq2 Bioconductor package103 was used to perform differential expression analyses. Low expressed genes (<5 read counts) and very highly expressed 5S rRNA, and some mitochondrial genes (>50000 read counts) were excluded from the analysis. The linear model was adjusted to treat the two replicas pairwise, e.g., ‘~replicate + condition’. The DESeq2 output of the differential expression analysis is provided Table S6.
Gene ontology enrichment analysis of overexpressed genes was performed using Panther gene ontology web interface (http://geneontology.org/). The gene ontology analysis output is provided in Table S7.
Global transcription block with α-amanitin and triptolide treatment
Global transcription block was performed either by treatment with 2 μM triptolide from the one-cell stage (Sigma T3652) in E3 media, or by microinjection of 200 pg α-amanitin (Sigma, A2263) at single-cell stage. As an injection control for α-amanitin, 10 % DMSO in water was used.
PCNA staging
mApple:PCNA fusion protein (400 pg) was injected at the one-cell stage to enable ubiquitous labelling of all daughter nuclei for the selection of synchronous embryos. At the cell cycle of interest embryos were selected for ubiquitous, bright, homogenous nuclear staining, indicative of nuclear-wide replication. These late interphase embryos were immediately snap frozen for RNA extraction or fixed with cold 4% PFA for in situ hybridisation.
miR-430 MO labelling
Single-cell stage embryos were injected with 1 nl solutions containing Cy5-labelled miR-430 targeting morpholinos (Gene Tools LLC)22 at a concentration of 7 μM each in nuclease-free water and 0.1% phenol red.
EU labelling of nascent RNA
Single-cell stage zebrafish embryos were injected with 1 nl of 50 mM ethynyl-uridine (EU, Thermo Fisher, C10329) until fixation with 4% PFA at the stage of interest. Embryos were dehydrated and rehydrated using MeOH gradients then fluorescently labelled using the Click-iT™ RNA Alexa Fluor™ 488 Imaging Kit (Thermo Fisher, C10329), following the manufacturer’s protocol. Labelled embryos were used for subsequent protein RNA, or DNA detection.
3D DNA-FISH (miR-430 or klf17)
BACs DKEY-69C19 and CH1023-918E12 were used as templates for DNA-FISH probe production, corresponding to 214kb of the miR-430 locus on chr4 and 38kb of the klf17 locus on chr2 respectively. The FISH Tag™ DNA Multicolor Kit (ThermoFisher, F32951) was used to label digested BAC fragments with Alexa dyes following kit instructions, with a 60 min digestion per pg of DKEY-69C19 and 10 min per μg of CH1023-918E12. 50-100 ng of probe was used for each sample in with hybridization buffer [50% formamide, 4x SSC, 100mM NaPO4 pH 7.0, 0.1% Tween-20].
Embryos were fixed at the developmental stage of interest using 4% PFA. Isolated animal caps were equilibrated with hybridization buffer, through a series of gradient washes. Embryonic DNA was then denatured at by 85°C for 10 minutes before immediate application of probe and incubation overnight at 37°C. A hybridization buffer: PBS-T gradient of washes was used to remove unbound probe from samples before counterstaining with DAPI. Samples were imaged on a Zeiss LSM 880 with FastAiryscan at maximum resolution, with a 63 ×1.40 numerical aperture objective lens. 20-50 optical sections (500 nm slice thickness) were acquired of each nuclei, and resulting images were processed using Zen Black software (Zeiss).
Expression analysis following miR-430 manipulations
Total RNA was extracted from >30 PCNA-synchronised 512-cell or dome stage embryos, and 500ng of total RNA used to produce equal amounts of total RNA, as detailed above. At least three independent experimental samples were collected for each manipulation condition. For all manipulation experiments performed in WT embryos, 10 μl RT-PCR reactions were prepared with 10 ng of cDNA with 500 nM of each forward and reverse gene-specific primers and PowerUp SYBR Green MasterMix (Applied bio systems, A25742) on a QuantStudioV (Thermo Fisher Scientific) machine. For manipulation experiments performed in the single miR-430 promoter transgenic embryos, 40ng of cDNA was used for gal4 and TBP quantification, or 10ng cDNA for miR-430 and 5S rRNA, both in 10 μl reactions. Thermo Fisher Connect software was used for data acquisition and PRISM for statistical analysis. -RT controls gave Ct values either >7 cycles greater than +RT samples or equivalent to alpha-amanitin treated samples representing complete block of transcription.
Guide RNA production
Double stranded DNA templates for sgRNA guides were produced through PCR annealing and extension of 100 ng common guide RNA backbone oligo and 100 ng target specific sgRNAR oligo (Merck) using Phusion Hot-start II DNA Polymerase (ThermoScientific, F549) with 35 cycles and annealing at 60 °C. Resultant DNA was gel extracted then 400 ng template used for in vitro transcription with the HiScribe RNA synthesis T7 kit (NEB, E2040) for 2 hours at 37 °C, then TurboDNase (Ambion, AM2238) treated for 15 minutes at 37 °C. Protein and non-incorporated nucleotides were removed using the Monarch RNA Clean up kit (NEB, T2040), before quantification by nanodrop.
In situ probe production
Templates for in situ probes were produced by amplification from 100 ng of 1k cell stage cDNA using gene-specific primers with promoter overhangs and Phusion Hot-start II DNA Polymerase (ThermoScientific, F549). Resultant templates were gel extracted then 500 ng transcribed into RNA using T7 RNA polymerase (ThermoScientific, EP0111) and either dig- or FITC-labelling mix (Roche, 3935420 and #32874620 respectively). RNA probes were purified using Microspin G25 (GE Healthcare, 27-5325-01) columns then final RNA concentration determined by nanodrop. 30 ng of pre-exhausted probe in Hybe+ was used per 50 embryo sample, for RNA-ISH and-FISH.
Live embryo imaging
The Zeiss Lightsheet Z1 was used to image live embryos mounted in 1% low melt agarose within size three glass capillaries, incubated at 28 °C in E3 media during imaging. Z-stacks of ~100-200 slices in 1 μm steps were acquired every 30–60 seconds for 1.5–2.5 h, with the ×20 objective.
Whole mount antibody staining
Embryos were fixed at the 512-cell stage in 4% PFA then washed with PBS-0.3% TritonX-100 to permeabilize. 10% goat serum in PBST was used to block embryos before addition of pre-blocked Pol II S2P monoclonal antibody (Diagenode, C15200005) at 1:1000 dilution. PBS-0.1% Tween-20 washes removed excess primary antibody before application of pre-blocked Alexa 633 goat anti-mouse IgG (Life technologies, A21052) secondary antibody at 1:2000 dilution. Embryos were mounted in antifade mounting media with DAPI (Vectashield, H-1200, Vector Laboratories) and imaged with a Zeiss 880 confocal microscope with Fast Airyscan Module with a 63 ×1.40 numerical aperture objective lens and the resulting images were processed using Zen Black software (Zeiss).
Whole mount In Situ Hybridisation
Embryos were fixed in 4% PFA at the developmental stage of interest, then washed with PBST before manual dechorionation and isolation of animal caps. Samples were dehydrated then rehydrated using a MeOH gradient before being equilibrated with hybridization buffer [50% formamide, 1.3x SSC, 5mM EDTA pH 8.0, 0.2% Tween-20]. Embryos were incubated with probe overnight at 58-65°C then unincorporated probe removed by a series of Hybe:SSCT and SSCT:PBST washes. Samples were then blocked in 10% goat serum in PBST before application of pre-blocked anti-dig-AP antibodies at a 1:2000 dilution in block. Excess antibody was removed with dig wash buffer (Roche, 11585762001) before staining with NBT and BCIP in 100mM NaCl, 100mM Tris.HCl pH9.5, 50mM MgCl2 & 0.1% Tween-20.
Samples were imaged on a Zeiss AxioZoom.V16, with an ApoZ 1.5x/0.37 numerical aperture objective lens and the resulting images were processed using Zen Black software (Zeiss) and ImageJ.
Single-molecule fluorescent double in situ hybridization
Target-specific-probes were designed using the Oligostan script developed byTsanov et al. 104 RNA labelling protocol was based on smiFISH method for Drosophila byGarcia et al. 105. Briefly, FLAP oligos (Integrated DNA technologies) were directly labelled at both their 3’ and 5’ termini, with either FITC for FLAP-Y, or Cy5 for FLAP-X. FLAP oligos were hybridised onto the target-specific-probes (FLAP-X for miR-430, FLAP-Y for klf17) at equimolar ratio in 1x NEB buffer 3, by incubating at 85°C for 3 minutes, then 65°C for 3 minutes. Embryos were fixed in 4% PFA, manually dechorionated to isolate animal caps, which were then dehydrated and rehydrated using a MeOH gradient. Samples were equilibrated with 15% formamide in 1xSSC before hybridization in FLAP-hybridized probe mix [0.83uM of each probe, 200ng/ul BSA, 2mM Ribonucleoside Vanadyl Complex (Sigma-Aldrich, 102207064), 15% formamide, 2x SSC, 10% dextran sulphate (Fisher, BP1585), 0.5ug/ul E.coli tRNA] overnight at 37°C. Unincorporated probes were removed by a series of PBST washes before counterstaining and mounting with DAPI/DABCO (Vectashield, H-1200, Vector Laboratories). Samples were imaged with a Zeiss 880 confocal microscope with Fast Airyscan Module with a 63 ×1.40 numerical aperture objective lens and the resulting images were processed using Zen Black software (Zeiss). All primers used in this study are provided in Table S4.
Quantification and Statistical Analysis
For the expression analysis by qPCR, following miR-430 manipulations (Figure 5A, Figure 6C–D, F–G, Figure S4I–L, Figure S4I–L, Figure S6D–E), the ΔΔCt values from independent biological repeats were evaluated by the Shapiro-Wilk test for normal distribution. The p-values were determined by unpaired t-test.
Quantification and differential expression analyses of nascent RNAseq data (Figure S5C) was performed with DESeq2 R package which uses Wald test for null hypothesis testing and Benjamini-Hochberg test for FDR/adjusted p-values calculation
GO enrichment of differentially expressed genes (Figure S5B) was carried out with Panther GO web tool using Fisher’s Exact test.
Supplementary Material
Data S1 Sequences of the de-novo assembled miR-430 locus from nanopore reads, the miR-430 promoter and triplet structures. Related to Results, STAR Methods, Figure 1, Figure S1 and Figure 4
Table S1. Coordinates (danRer11, bed format) of single copy genes and miR-430 promoter regions. Related to Figure 1
Table S2. Gene sets used for epigenetic feature comparison (Promoter feature coordinates, danRer11 and CAGE expression, TPM) Related to Figure 1
Table S3. Zinc finger genes on chromosome 4 (Promoter feature coordinates, danRer11 and CAGE expression, TPM). Related to Figure 3
Table S4. Primers used in this study. Related to STAR Methods
Table S5. miR-430 promoter copy number estimated by digital droplet PCR (normalised to shha single copy gene). Related to STAR Methods and Figure 1
Table S6. Differential gene expression analysis (DESeq2) after dCas9 inhibition of miR-430 transcription. Related to STAR Methods and Figure S5
Table S7. GO enrichment for upregulated genes after dCas9 inhibition of miR-430 transcription. Related to STAR Methods and Figure S5
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Pol II S2P mouse monoclonal antibody | Diagenode | C15200005 |
| Chemicals, peptides, and recombinant proteins | ||
| mApple:PCNA fusion protein | Hadzhiev et al.22 | NA |
| Fluorescently labeled morpholino oligonucleotides | Hadzhiev et al. 22 | NA |
| dCas9 protein | NEB | M0652 |
| dCas9-GFP protein | Novateinbio | PR-137213G |
| Cas9 protein | NEB | M0386M |
| Critical commercial assays | ||
| Genomic DNA Ligation Sequencing Kit | Oxford Nanopore | SQK-LSK110 |
| FISH Tag™ DNA Multicolor Kit | Thermo Fisher | F32951 |
| Click-iT™ RNA Alexa Fluor™ 488 Imaging Kit | Thermo Fisher | C10329 |
| Click-iT™ Nascent RNA Capture Kit | Thermo Fisher | C10365 |
| HiScribe RNA synthesis T7 kit | NEB | E2040 |
| NEBNext® Ultra™ II Directional RNA Library Prep Kit | NEB | E7760S |
| Deposited data | ||
| Oxford Nanopore and PacBio long read sequencing and Nascent RNA capture sequencing | This paper | PRJNA900028 |
| 4-thio-UTP nascent RNA-seq | Heyn P et al.20 | PRJNA207343 |
| CAGE-seq data | Nepal et. al.40 | SRA055273 |
| H3K4me3 and H3K27me3 ChIP-seq | Zhu et al.35 | PRJNA434216 |
| H3K27ac ChIP-seq | Zhang et al.33 | PRJNA473799 |
| ATAC-seq | Liu at al.31 | PRJNA395463 |
| Nanog ChIP-seq | Xu et al.51 | PRJNA156233 |
| Pou5f1 and Sox2 ChIP-seq | Leichsenring et al.27 | PRJNA171706 |
| Experimental models: Organisms/strains | ||
| Zebrafish transgenic line: Tg(Xla.crygc:attP-Gal4vp16, 14UAS:Clover)UoBL1 | This paper | NA |
| Zebrafish transgenic line: Tg(Xla.crygc:attP-Gal4vp16, 14UAS:Clover)UoBL3 | This paper | NA |
| Zebrafish transgenic line: Tg(Xla.crygc:attL-mCherry-miR430-attR-Gal4vp16, 14UAS:Clover)UoBL1 | This paper | NA |
| Zebrafish transgenic line: Tg(Xla.crygc:attL-mCherry-miR430-attR-Gal4vp16, 14UAS:Clover)UoBL3 | This paper | NA |
| Recombinant DNA | ||
| pDB783:Xla.crygc-attP-Gal4vp16-14UAS:Clover | This paper | NA |
| pJET:miR430-attB-mCherry | This paper | NA |
| Software and algorithms | ||
| Canu assembler (v.2.1.1) | Koren et al.37 | https://github.com/marbl/canu/releases |
| ncbi-blast+(v2.11.0) | Altschul et al.38 Camacho et al.39 | https://blast.ncbi.nlm.nih.gov/Blast.cgi |
| purge_dups (v1.2.5) | Guan et al.85 | https://github.com/dfguan/purge_dups |
| RaGOO (v1.1) | Alonge et al.86 | https://github.com/malonge/RaGOO |
| segemehl aligner (v0.3.4) | Otto et al.93 | https://www.bioinf.uni-leipzig.de/Software/segemehl/ |
| bowtie (v1.2.3) | Langmead et al.89 | https://github.com/BenLangmead/bowtie/releases |
| CAGEr (v1.18) | Haberle et al.90 | https://doi.org/doi:10.18129/B9.bioc.CAGEr |
| STAR (v2.7.3a) | Dobin et.al.94 | https://github.com/alexdobin/STAR/ |
| cluster-buster | Frith et al.52 | https://github.com/weng-lab/cluster-buster/ |
| DESeq2 (v1.36.0) | Love et al.103 | https://doi.org/doi:10.18129/B9.bioc.DESeq2 |
| ClusterScan(v0.2.2) | Volpe et al.91 | https://github.com/pyrevo/ClusterScan |
| karyoploteR (v1.18.0) | Gel et al.92 | https://doi.org/doi:10.18129/B9.bioc.karyoploteR |
| SeqPlots(v1.27) | Stempor et al.95 | https://doi.org/doi:10.18129/B9.bioc.seqplots http://przemol.github.io/seqplots/ |
| DiffLogo | Nettling et al.96 | https://doi.org/doi:10.18129/B9.bioc.DiffLogo |
| ggseqlogo | Wagih,O.97 | https://github.com/omarwagih/ggseqlogo |
Highlights:
A high promoter density gene cluster shapes minor wave of ZGA in zebrafish
Minor wave genes can be autonomously activated outside of the transcription body
Minor wave promoter features are distinct from that of the major wave
ACKNOWLEDGEMENTS
This work was funded by a Wellcome Trust Investigator Award (106955/Z/15/Z) and MDS Research Development Fund to FM, supported in part (SB) by the Intramural Research Program of the NHGRI (ZIAHG200386-06). We thank Genomics Birmingham for sequencing, the imaging facility of the Technology Hub core and the BMSU facility at the University of Birmingham. We thank S. Branford and J-B Cazier for support by the University of Birmingham BlueBEAR/CaStLeS high performance computing cluster. We also thank A. Jimenez-Gonzalez for embryo injections, P. Balwierz for advice on gene copy number calculations. We thank M. Lagha for their smiFISH protocol. We thank Darius Balciunas for providing the pDB783:Xla.crygc-attP-Gal4vp16-14UAS:eGFP plasmid.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
DECLARATION OF INTERESTS
The authors declare no competing interests.
REFERENCES
- 1.Lee MT, Bonneau AR, and Giraldez AJ (2014). Zygotic genome activation during the maternal-to-zygotic transition. Annual review of cell and developmental biology 30, 581–613. 10.1146/annurev-cellbio-100913-013027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Schulz KN, and Harrison MM (2019). Mechanisms regulating zygotic genome activation. Nat Rev Genet 20, 221–234. 10.1038/s41576-018-0087-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Vastenhouw NL, Cao WX, and Lipshitz HD (2019). The maternal-to-zygotic transition revisited. Development 146. 10.1242/dev.161471. [DOI] [PubMed] [Google Scholar]
- 4.Palfy M, Joseph SR, and Vastenhouw NL (2017). The timing of zygotic genome activation. Curr Opin Genet Dev 43, 53–60. 10.1016/j.gde.2016.12.001. [DOI] [PubMed] [Google Scholar]
- 5.Wragg J, and Muller F (2016). Transcriptional Regulation During Zygotic Genome Activation in Zebrafish and Other Anamniote Embryos. Adv Genet 95, 161–194. 10.1016/bs.adgen.2016.05.001. [DOI] [PubMed] [Google Scholar]
- 6.Amodeo AA, Jukam D, Straight AF, and Skotheim JM (2015). Histone titration against the genome sets the DNA-to-cytoplasm threshold for the Xenopus midblastula transition. Proc Natl Acad Sci U S A 112, E1086–1095. 10.1073/pnas.1413990112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Joseph SR, Palfy M, Hilbert L, Kumar M, Karschau J, Zaburdaev V, Shevchenko A, and Vastenhouw NL (2017). Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos. Elife 6, e23326. 10.7554/eLife.23326. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Lee MT, Bonneau AR, Takacs CM, Bazzini AA, DiVito KR, Fleming ES, and Giraldez AJ (2013). Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition. Nature 503, 360–364. 10.1038/nature12632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Bartfai R, Balduf C, Hilton T, Rathmann Y, Hadzhiev Y, Tora L, Orban L, and Muller F (2004). TBP2, a vertebrate-specific member of the TBP family, is required in embryonic development of zebrafish. Curr Biol 14, 593–598. 10.1016/j.cub.2004.03.034. [DOI] [PubMed] [Google Scholar]
- 10.Ferg M, Sanges R, Gehrig J, Kiss J, Bauer M, Lovas A, Szabo M, Yang L, Straehle U, Pankratz MJ, et al. (2007). The TATA-binding protein regulates maternal mRNA degradation and differential zygotic transcription in zebrafish. EMBO J 26, 3945–3956. 10.1038/sj.emboj.7601821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Veenstra GJ, Destree OH, and Wolffe AP (1999). Translation of maternal TATA-binding protein mRNA potentiates basal but not activated transcription in Xenopus embryos at the midblastula transition. Mol Cell Biol 19, 7972–7982. 10.1128/mcb.19.12.7972. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Blythe SA, and Wieschaus EF (2016). Establishment and maintenance of heritable chromatin structure during early Drosophila embryogenesis. Elife 5, e20148. 10.7554/eLife.20148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Palfy M, Schulze G, Valen E, and Vastenhouw NL (2020). Chromatin accessibility established by Pou5f3, Sox19b and Nanog primes genes for activity during zebrafish genome activation. PLoS Genet 16, e1008546. 10.1371/journal.pgen.1008546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lindeman LC, Andersen IS, Reiner AH, Li N, Aanes H, Ostrup O, Winata C, Mathavan S, Muller F, Alestrom P, and Collas P (2011). Prepatterning of developmental gene expression by modified histones before zygotic genome activation. Dev Cell 21, 993–1004. 10.1016/j.devcel.2011.10.008. [DOI] [PubMed] [Google Scholar]
- 15.Chan SH, Tang Y, Miao L, Darwich-Codore H, Vejnar CE, Beaudoin JD, Musaev D, Fernandez JP, Benitez MDJ, Bazzini AA, et al. (2019). Brd4 and P300 Confer Transcriptional Competency during Zygotic Genome Activation. Dev Cell 49, 867–881 e868. 10.1016/j.devcel.2019.05.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Blythe SA, and Wieschaus EF (2015). Zygotic genome activation triggers the DNA replication checkpoint at the midblastula transition. Cell 160, 1169–1181. 10.1016/j.cell.2015.01.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Collart C, Smith JC, and Zegerman P (2017). Chk1 Inhibition of the Replication Factor Drf1 Guarantees Cell-Cycle Elongation at the Xenopus laevis Mid-blastula Transition. Dev Cell 42, 82–96 e83. 10.1016/j.devcel.2017.06.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Strong IJT, Lei X, Chen F, Yuan K, and O’Farrell PH (2020). Interphase-arrested Drosophila embryos activate zygotic gene expression and initiate mid-blastula transition events at a low nuclear-cytoplasmic ratio. PLoS Biol 18, e3000891. 10.1371/journal.pbio.3000891. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Abe KI, Funaya S, Tsukioka D, Kawamura M, Suzuki Y, Suzuki MG, Schultz RM, and Aoki F (2018). Minor zygotic gene activation is essential for mouse preimplantation development. Proc Natl Acad Sci U S A 115, E6780–E6788. 10.1073/pnas.1804309115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Heyn P, Kircher M, Dahl A, Kelso J, Tomancak P, Kalinka AT, and Neugebauer KM (2014). The earliest transcribed zygotic genes are short, newly evolved, and different across species. Cell Rep 6, 285–292. 10.1016/j.celrep.2013.12.030. [DOI] [PubMed] [Google Scholar]
- 21.Giraldez AJ, Mishima Y, Rihel J, Grocock RJ, Van Dongen S, Inoue K, Enright AJ, and Schier AF (2006). Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science 312, 75–79. 10.1126/science.1122689. [DOI] [PubMed] [Google Scholar]
- 22.Hadzhiev Y, Qureshi HK, Wheatley L, Cooper L, Jasiulewicz A, Van Nguyen H, Wragg JW, Poovathumkadavil D, Conic S, Bajan S, et al. (2019). A cell cycle-coordinated Polymerase II transcription compartment encompasses gene expression before global genome activation. Nat Commun 10, 691. 10.1038/s41467-019-08487-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Hilbert L, Sato Y, Kuznetsova K, Bianucci T, Kimura H, Julicher F, Honigmann A, Zaburdaev V, and Vastenhouw NL (2021). Transcription organizes euchromatin via microphase separation. Nat Commun 12, 1360. 10.1038/s41467-021-21589-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Meier M, Grant J, Dowdle A, Thomas A, Gerton J, Collas P, O’Sullivan JM, and Horsfield JA (2018). Cohesin facilitates zygotic genome activation in zebrafish. Development 145, dev156521. 10.1242/dev.156521. [DOI] [PubMed] [Google Scholar]
- 25.Miao L, Tang Y, Bonneau AR, Chan SH, Kojima ML, Pownall ME, Vejnar CE, Gao F, Krishnaswamy S, Hendry CE, and Giraldez AJ (2022). The landscape of pioneer factor activity reveals the mechanisms of chromatin reprogramming and genome activation. Mol Cell 82, 986–1002 e1009. 10.1016/j.molcel.2022.01.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kuznetsova K, Ugolini M, Wu E, Lalit M, Oda H, Sato Y, Kimura H, Jug F, and Vastenhouw N (2022). Nanog organizes transcription bodies. bioRxiv, 2022.2006.2013.495463. 10.1101/2022.06.13.495463. [DOI] [PubMed] [Google Scholar]
- 27.Leichsenring M, Maes J, Mossner R, Driever W, and Onichtchouk D (2013). Pou5f1 transcription factor controls zygotic gene activation in vertebrates. Science 341, 1005–1009. 10.1126/science.1242527. [DOI] [PubMed] [Google Scholar]
- 28.Veil M, Yampolsky LY, Gruning B, and Onichtchouk D (2019). Pou5f3, SoxB1, and Nanog remodel chromatin on high nucleosome affinity regions at zygotic genome activation. Genome Res 29, 383–395. 10.1101/gr.240572.118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gentsch GE, Spruce T, Owens NDL, and Smith JC (2019). Maternal pluripotency factors initiate extensive chromatin remodelling to predefine first response to inductive signals. Nat Commun 10, 4269. 10.1038/s41467-019-12263-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Wu SF, Zhang H, and Cairns BR (2011). Genes for embryo development are packaged in blocks of multivalent chromatin in zebrafish sperm. Genome Res 21, 578–589. 10.1101/gr.113167.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Liu G, Wang W, Hu S, Wang X, and Zhang Y (2018). Inherited DNA methylation primes the establishment of accessible chromatin during genome activation. Genome Res 28, 998–1007. 10.1101/gr.228833.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wike CL, Guo Y, Tan M, Nakamura R, Shaw DK, Diaz N, Whittaker-Tademy AF, Durand NC, Aiden EL, Vaquerizas JM, et al. (2021). Chromatin architecture transitions from zebrafish sperm through early embryogenesis. Genome Res 31, 981–994. 10.1101/gr.269860.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhang B, Wu X, Zhang W, Shen W, Sun Q, Liu K, Zhang Y, Wang Q, Li Y, Meng A, and Xie W (2018). Widespread Enhancer Dememorization and Promoter Priming during Parental-to-Zygotic Transition. Mol Cell 72, 673–686 e676. 10.1016/j.molcel.2018.10.017. [DOI] [PubMed] [Google Scholar]
- 34.Murphy PJ, Wu SF, James CR, Wike CL, and Cairns BR (2018). Placeholder Nucleosomes Underlie Germline-to-Embryo DNA Methylation Reprogramming. Cell 172, 993–1006 e1013. 10.1016/j.cell.2018.01.022. [DOI] [PubMed] [Google Scholar]
- 35.Zhu W, Xu X, Wang X, and Liu J (2019). Reprogramming histone modification patterns to coordinate gene expression in early zebrafish embryos. BMC Genomics 20, 248. 10.1186/s12864-019-5611-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Westerfield M, and ZFIN. (2000). The zebrafish book : a guide for the laboratory use of zebrafish Danio (Brachydanio) rerio, 4th Edition (ZFIN). [Google Scholar]
- 37.Koren S, Walenz BP, Berlin K, Miller JR, Bergman NH, and Phillippy AM (2017). Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome Res 27, 722–736. 10.1101/gr.215087.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Altschul SF, Gish W, Miller W, Myers EW, and Lipman DJ (1990). Basic local alignment search tool. J Mol Biol 215, 403–410. 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- 39.Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, and Madden TL (2009). BLAST+: architecture and applications. BMC Bioinformatics 10, 421. 10.1186/1471-2105-10-421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Nepal C, Hadzhiev Y, Previti C, Haberle V, Li N, Takahashi H, Suzuki AM, Sheng Y, Abdelhamid RF, Anand S, et al. (2013). Dynamic regulation of the transcription initiation landscape at single nucleotide resolution during vertebrate embryogenesis. Genome Res 23, 1938–1950. 10.1101/gr.153692.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Baranasic D, Hortenhuber M, Balwierz PJ, Zehnder T, Mukarram AK, Nepal C, Varnai C, Hadzhiev Y, Jimenez-Gonzalez A, Li N, et al. (2022). Multiomic atlas with functional stratification and developmental dynamics of zebrafish cis-regulatory elements. Nature genetics 54, 1037–1050. 10.1038/s41588-022-01089-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Haberle V, Li N, Hadzhiev Y, Plessy C, Previti C, Nepal C, Gehrig J, Dong X, Akalin A, Suzuki AM, et al. (2014). Two independent transcription initiation codes overlap on vertebrate core promoters. Nature 507, 381–385. 10.1038/nature12974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Creyghton MP, Cheng AW, Welstead GG, Kooistra T, Carey BW, Steine EJ, Hanna J, Lodato MA, Frampton GM, Sharp PA, et al. (2010). Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A 107, 21931–21936. 10.1073/pnas.1016071107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Ernst J, Kheradpour P, Mikkelsen TS, Shoresh N, Ward LD, Epstein CB, Zhang X, Wang L, Issner R, Coyne M, et al. (2011). Mapping and analysis of chromatin state dynamics in nine human cell types. Nature 473, 43–49. 10.1038/nature09906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Rada-Iglesias A, Bajpai R, Swigut T, Brugmann SA, Flynn RA, and Wysocka J (2011). A unique chromatin signature uncovers early developmental enhancers in humans. Nature 470, 279–283. 10.1038/nature09692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Heintzman ND, Stuart RK, Hon G, Fu Y, Ching CW, Hawkins RD, Barrera LO, Van Calcar S, Qu C, Ching KA, et al. (2007). Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nature genetics 39, 311–318. 10.1038/ng1966. [DOI] [PubMed] [Google Scholar]
- 47.Vastenhouw NL, Zhang Y, Woods IG, Imam F, Regev A, Liu XS, Rinn J, and Schier AF (2010). Chromatin signature of embryonic pluripotency is established during genome activation. Nature 464, 922–926. 10.1038/nature08866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Chen K, Johnston J, Shao W, Meier S, Staber C, and Zeitlinger J (2013). A global change in RNA polymerase II pausing during the Drosophila midblastula transition. Elife 2, e00861. 10.7554/eLife.00861. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Pimmett VL, Dejean M, Fernandez C, Trullo A, Bertrand E, Radulescu O, and Lagha M (2021). Quantitative imaging of transcription in living Drosophila embryos reveals the impact of core promoter motifs on promoter state dynamics. Nat Commun 12, 4504. 10.1038/s41467-021-24461-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.White RJ, Collins JE, Sealy IM, Wali N, Dooley CM, Digby Z, Stemple DL, Murphy DN, Billis K, Hourlier T, et al. (2017). A high-resolution mRNA expression time course of embryonic development in zebrafish. Elife 6, e30860. 10.7554/eLife.30860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Xu C, Fan ZP, Muller P, Fogley R, DiBiase A, Trompouki E, Unternaehrer J, Xiong F, Torregroza I, Evans T, et al. (2012). Nanog-like regulates endoderm formation through the Mxtx2-Nodal pathway. Dev Cell 22, 625–638. 10.1016/j.devcel.2012.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Frith MC, Li MC, and Weng Z (2003). Cluster-Buster: Finding dense clusters of motifs in DNA sequences. Nucleic Acids Res 31, 3666–3668. 10.1093/nar/gkg540. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Roberts JA, Miguel-Escalada I, Slovik KJ, Walsh KT, Hadzhiev Y, Sanges R, Stupka E, Marsh EK, Balciuniene J, Balciunas D, and Muller F (2014). Targeted transgene integration overcomes variability of position effects in zebrafish. Development 141, 715–724. 10.1242/dev.100347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Hadzhiev Y, Miguel-Escalada I, Balciunas D, and Müller F (2016). Testing of Cis-Regulatory Elements by Targeted Transgene Integration in Zebrafish Using PhiC31 Integrase. In Zebrafish: Methods and Protocols, Kawakami K, Patton EE, and Orger M, eds. (Springer; New York: ), pp. 81–91. 10.1007/978-1-4939-3771-4_6. [DOI] [PubMed] [Google Scholar]
- 55.Davidson AE, Balciunas D, Mohn D, Shaffer J, Hermanson S, Sivasubbu S, Cliff MP, Hackett PB, and Ekker SC (2003). Efficient gene delivery and gene expression in zebrafish using the Sleeping Beauty transposon. Dev Biol 263, 191–202. 10.1016/j.ydbio.2003.07.013. [DOI] [PubMed] [Google Scholar]
- 56.Larson MH, Gilbert LA, Wang X, Lim WA, Weissman JS, and Qi LS (2013). CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Nat Protoc 8, 2180–2196. 10.1038/nprot.2013.132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Matozel EK, Parziale S, and Price AC (2022). A programmable DNA roadblock system using dCas9 and multivalent target sites. PLoS One 17, e0268099. 10.1371/journal.pone.0268099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Treangen TJ, and Salzberg SL (2011). Repetitive DNA and next-generation sequencing: computational challenges and solutions. Nat Rev Genet 13, 36–46. 10.1038/nrg3117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Ichikawa K, Tomioka S, Suzuki Y, Nakamura R, Doi K, Yoshimura J, Kumagai M, Inoue Y, Uchida Y, Irie N, et al. (2017). Centromere evolution and CpG methylation during vertebrate speciation. Nat Commun 8, 1833. 10.1038/s41467-017-01982-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Chen Z, Omori Y, Koren S, Shirokiya T, Kuroda T, Miyamoto A, Wada H, Fujiyama A, Toyoda A, Zhang S, et al. (2019). De novo assembly of the goldfish (Carassius auratus) genome and the evolution of genes after whole-genome duplication. Sci Adv 5, eaav0547. 10.1126/sciadv.aav0547. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Hug CB, Grimaldi AG, Kruse K, and Vaquerizas JM (2017). Chromatin Architecture Emerges during Zygotic Genome Activation Independent of Transcription. Cell 169, 216–228 e219. 10.1016/j.cell.2017.03.024. [DOI] [PubMed] [Google Scholar]
- 62.Grow EJ, Flynn RA, Chavez SL, Bayless NL, Wossidlo M, Wesche DJ, Martin L, Ware CB, Blish CA, Chang HY, et al. (2015). Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells. Nature 522, 221–225. 10.1038/nature14308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Macfarlan TS, Gifford WD, Driscoll S, Lettieri K, Rowe HM, Bonanomi D, Firth A, Singer O, Trono D, and Pfaff SL (2012). Embryonic stem cell potency fluctuates with endogenous retrovirus activity. Nature 487, 57–63. 10.1038/nature11244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Cisse II, Izeddin I, Causse SZ, Boudarene L, Senecal A, Muresan L, Dugast-Darzacq C, Hajj B, Dahan M, and Darzacq X (2013). Real-time dynamics of RNA polymerase II clustering in live human cells. Science 341, 664–667. 10.1126/science.1239053. [DOI] [PubMed] [Google Scholar]
- 65.Conic S, Desplancq D, Ferrand A, Fischer V, Heyer V, Reina San Martin B, Pontabry J, Oulad-Abdelghani M, Babu NK, Wright GD, et al. (2018). Imaging of native transcription factors and histone phosphorylation at high resolution in live cells. J Cell Biol 217, 1537–1552. 10.1083/jcb.201709153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Cook PR, and Marenduzzo D (2018). Transcription-driven genome organization: a model for chromosome structure and the regulation of gene expression tested through simulations. Nucleic Acids Res 46, 9895–9906. 10.1093/nar/gky763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Kaaij LJT, van der Weide RH, Ketting RF, and de Wit E (2018). Systemic Loss and Gain of Chromatin Architecture throughout Zebrafish Development. Cell Rep 24, 1–10 e14. 10.1016/j.celrep.2018.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Gao M, Veil M, Rosenblatt M, Gebhard A, Hass H, Buryanova L, Yampolsky LY, Grüning B, Timmer J, and Onichtchouk D (2020). Pluripotency factors select gene expression repertoire at Zygotic Genome Activation. bioRxiv, 2020.2002.2016.949362. 10.1101/2020.02.16.949362. [DOI] [Google Scholar]
- 69.Lenhard B, Sandelin A, and Carninci P (2012). Metazoan promoters: emerging characteristics and insights into transcriptional regulation. Nat Rev Genet 13, 233–245. 10.1038/nrg3163. [DOI] [PubMed] [Google Scholar]
- 70.Muller F, Zaucker A, and Tora L (2010). Developmental regulation of transcription initiation: more than just changing the actors. Curr Opin Genet Dev 20, 533–540. 10.1016/j.gde.2010.06.004. [DOI] [PubMed] [Google Scholar]
- 71.Levine M, Cattoglio C, and Tjian R (2014). Looping back to leap forward: transcription enters a new era. Cell 157, 13–25. 10.1016/j.cell.2014.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Haberle V, and Stark A (2018). Eukaryotic core promoters and the functional basis of transcription initiation. Nature reviews. Molecular cell biology 19, 621–637. 10.1038/s41580-018-0028-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Gaskill MM, Gibson TJ, Larson ED, and Harrison MM (2021). GAF is essential for zygotic genome activation and chromatin accessibility in the early Drosophila embryo. Elife 10. 10.7554/eLife.66668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Hendrickson PG, Dorais JA, Grow EJ, Whiddon JL, Lim JW, Wike CL, Weaver BD, Pflueger C, Emery BR, Wilcox AL, et al. (2017). Conserved roles of mouse DUX and human DUX4 in activating cleavage-stage genes and MERVL/HERVL retrotransposons. Nature genetics 49, 925–934. 10.1038/ng.3844. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.De Iaco A, Planet E, Coluccio A, Verp S, Duc J, and Trono D (2017). DUX-family transcription factors regulate zygotic genome activation in placental mammals. Nature genetics 49, 941–945. 10.1038/ng.3858. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Gehrig J, Reischl M, Kalmar E, Ferg M, Hadzhiev Y, Zaucker A, Song C, Schindler S, Liebel U, and Muller F (2009). Automated high-throughput mapping of promoter-enhancer interactions in zebrafish embryos. Nature methods 6, 911–916. 10.1038/nmeth.1396. [DOI] [PubMed] [Google Scholar]
- 77.Zabidi MA, Arnold CD, Schernhuber K, Pagani M, Rath M, Frank O, and Stark A (2015). Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation. Nature 518, 556–559. 10.1038/nature13994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Lismer A, Dumeaux V, Lafleur C, Lambrot R, Brind’Amour J, Lorincz MC, and Kimmins S (2021). Histone H3 lysine 4 trimethylation in sperm is transmitted to the embryo and associated with diet-induced phenotypes in the offspring. Dev Cell 56, 671–686 e676. 10.1016/j.devcel.2021.01.014. [DOI] [PubMed] [Google Scholar]
- 79.Li XY, Harrison MM, Villalta JE, Kaplan T, and Eisen MB (2014). Establishment of regions of genomic activity during the Drosophila maternal to zygotic transition. Elife 3, e03737. 10.7554/eLife.03737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Voigt P, Tee WW, and Reinberg D (2013). A double take on bivalent promoters. Genes Dev 27, 1318–1338. 10.1101/gad.219626.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Hnisz D, Shrinivas K, Young RA, Chakraborty AK, and Sharp PA (2017). A Phase Separation Model for Transcriptional Control. Cell 169, 13–23. 10.1016/j.cell.2017.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Zhu I, Song W, Ovcharenko I, and Landsman D (2021). A model of active transcription hubs that unifies the roles of active promoters and enhancers. Nucleic Acids Res 49, 4493–4505. 10.1093/nar/gkab235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Huang SK, Whitney PH, Dutta S, Shvartsman SY, and Rushlow CA (2021). Spatial organization of transcribing loci during early genome activation in Drosophila. Curr Biol 31, 5102–5110 e5105. 10.1016/j.cub.2021.09.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Green MR, and Sambrook J (2017). Isolation of High-Molecular-Weight DNA from Mammalian Tissues Using Proteinase K and Phenol. Cold Spring Harb Protoc 2017. 10.1101/pdb.prot093484. [DOI] [PubMed] [Google Scholar]
- 85.Guan D, McCarthy SA, Wood J, Howe K, Wang Y, and Durbin R (2020). Identifying and removing haplotypic duplication in primary genome assemblies. Bioinformatics 36, 2896–2898. 10.1093/bioinformatics/btaa025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Alonge M, Soyk S, Ramakrishnan S, Wang X, Goodwin S, Sedlazeck FJ, Lippman ZB, and Schatz MC (2019). RaGOO: fast and accurate reference-guided scaffolding of draft genomes. Genome Biol 20, 224. 10.1186/s13059-019-1829-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Manni M, Berkeley MR, Seppey M, and Zdobnov EM (2021). BUSCO: Assessing Genomic Data Quality and Beyond. Curr Protoc 1, e323. 10.1002/cpz1.323. [DOI] [PubMed] [Google Scholar]
- 88.Simao FA, Waterhouse RM, Ioannidis P, Kriventseva EV, and Zdobnov EM (2015). BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 31, 3210–3212. 10.1093/bioinformatics/btv351. [DOI] [PubMed] [Google Scholar]
- 89.Langmead B, Trapnell C, Pop M, and Salzberg SL (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25. 10.1186/gb-2009-10-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Haberle V, Forrest AR, Hayashizaki Y, Carninci P, and Lenhard B (2015). CAGEr: precise TSS data retrieval and high-resolution promoterome mining for integrative analyses. Nucleic Acids Res 43, e51. 10.1093/nar/gkv054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Volpe M, Miralto M, Gustincich S, and Sanges R (2018). ClusterScan: simple and generalistic identification of genomic clusters. Bioinformatics 34, 3921–3923. 10.1093/bioinformatics/bty486. [DOI] [PubMed] [Google Scholar]
- 92.Gel B, and Serra E (2017). karyoploteR: an R/Bioconductor package to plot customizable genomes displaying arbitrary data. Bioinformatics 33, 3088–3090. 10.1093/bioinformatics/btx346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Otto C, Stadler PF, and Hoffmann S (2014). Lacking alignments? The next-generation sequencing mapper segemehl revisited. Bioinformatics 30, 1837–1843. 10.1093/bioinformatics/btu146. [DOI] [PubMed] [Google Scholar]
- 94.Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, and Gingeras TR (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95.Stempor P, and Ahringer J (2016). SeqPlots - Interactive software for exploratory data analyses, pattern discovery and visualization in genomics. Wellcome Open Res 1, 14. 10.12688/wellcomeopenres.10004.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Nettling M, Treutler H, Grau J, Keilwagen J, Posch S, and Grosse I (2015). DiffLogo: a comparative visualization of sequence motifs. BMC Bioinformatics 16, 387. 10.1186/s12859-015-0767-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Wagih O (2017). ggseqlogo: a versatile R package for drawing sequence logos. Bioinformatics 33, 3645–3647. 10.1093/bioinformatics/btx469. [DOI] [PubMed] [Google Scholar]
- 98.Fornes O, Castro-Mondragon JA, Khan A, van der Lee R, Zhang X, Richmond PA, Modi BP, Correard S, Gheorghe M, Baranasic D, et al. (2020). JASPAR 2020: update of the open-access database of transcription factor binding profiles. Nucleic Acids Res 48, D87–D92. 10.1093/nar/gkz1001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Sandelin A, Alkema W, Engstrom P, Wasserman WW, and Lenhard B (2004). JASPAR: an open-access database for eukaryotic transcription factor binding profiles. Nucleic Acids Res 32, D91–94. 10.1093/nar/gkh012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Kawakami K (2004). Transgenesis and gene trap methods in zebrafish by using the Tol2 transposable element. Methods Cell Biol 77, 201–222. 10.1016/s0091-679x(04)77011-9. [DOI] [PubMed] [Google Scholar]
- 101.Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, Yost HJ, Kanki JP, and Chien CB (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev Dyn 236, 3088–3099. 10.1002/dvdy.21343. [DOI] [PubMed] [Google Scholar]
- 102.Green MR, and Sambrook J (2019). Inverse Polymerase Chain Reaction (PCR). Cold Spring Harb Protoc 2019. 10.1101/pdb.prot095166. [DOI] [PubMed] [Google Scholar]
- 103.Love MI, Huber W, and Anders S (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Tsanov N, Samacoits A, Chouaib R, Traboulsi AM, Gostan T, Weber C, Zimmer C, Zibara K, Walter T, Peter M, et al. (2016). smiFISH and FISH-quant - a flexible single RNA detection approach with super-resolution capability. Nucleic Acids Res 44, e165. 10.1093/nar/gkw784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Garcia HG, Tikhonov M, Lin A, and Gregor T (2013). Quantitative imaging of transcription in living Drosophila embryos links polymerase activity to patterning. Curr Biol 23, 2140–2145. 10.1016/j.cub.2013.08.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data S1 Sequences of the de-novo assembled miR-430 locus from nanopore reads, the miR-430 promoter and triplet structures. Related to Results, STAR Methods, Figure 1, Figure S1 and Figure 4
Table S1. Coordinates (danRer11, bed format) of single copy genes and miR-430 promoter regions. Related to Figure 1
Table S2. Gene sets used for epigenetic feature comparison (Promoter feature coordinates, danRer11 and CAGE expression, TPM) Related to Figure 1
Table S3. Zinc finger genes on chromosome 4 (Promoter feature coordinates, danRer11 and CAGE expression, TPM). Related to Figure 3
Table S4. Primers used in this study. Related to STAR Methods
Table S5. miR-430 promoter copy number estimated by digital droplet PCR (normalised to shha single copy gene). Related to STAR Methods and Figure 1
Table S6. Differential gene expression analysis (DESeq2) after dCas9 inhibition of miR-430 transcription. Related to STAR Methods and Figure S5
Table S7. GO enrichment for upregulated genes after dCas9 inhibition of miR-430 transcription. Related to STAR Methods and Figure S5
Data Availability Statement
Log read sequencing and nascent (EU) RNA-seq data are deposited at NCBI Sequence Read Archive (SRA) under BioProject PRJNA900028.
This paper does not report original code.
Raw microscopy images and additional information required for data reanalysis are available upon request from the lead contact.
