Glycine regulates lipid peroxidation promoting porcine oocyte maturation and early embryonic development

Abstract

In vitro-cultured oocytes are separated from the follicular micro-environment in vivo and are more vulnerable than in vivo oocytes to changes in the external environment. This vulnerability disrupts the homeostasis of the intracellular environment, affecting oocyte meiotic completion, and subsequent embryonic developmental competence in vitro. Glycine, one of the main components of glutathione (GSH), plays an important role in the protection of porcine oocytes in vitro. However, the protective mechanism of glycine needs to be further clarified. Our results showed that glycine supplementation promoted cumulus cell expansion and oocyte maturation. Detection of oocyte development ability showed that glycine significantly increased the cleavage rate and blastocyst rate during in vitro fertilization (IVF). SMART-seq revealed that this effect was related to glycine-mediated regulation of cell membrane structure and function. Exogenous addition of glycine significantly increased the levels of the anti-oxidant GSH and the expression of anti-oxidant-related genes (glutathione peroxidase 4 [GPX4], catalase [CAT], superoxide dismutase 1 [SOD1], superoxide dismutase 2 [SOD2], and mitochondrial solute carrier family 25, member 39 [SLC25A39]), decreased the lipid peroxidation caused by reactive oxygen species (ROS) and reduced the level of malondialdehyde (MDA) by enhancing the functions of mitochondria, peroxisomes and lipid droplets (LDs) and the levels of lipid metabolism-related factors (peroxisome proliferator activated receptor coactivator 1 alpha [PGC-1α], peroxisome proliferator-activated receptor γ [PPARγ], sterol regulatory element binding factor 1 [SREBF1], autocrine motility factor receptor [AMFR], and ATP). These effects further reduced ferroptosis and maintained the normal structure and function of the cell membrane. Our results suggest that glycine plays an important role in oocyte maturation and later development by regulating ROS-induced lipid metabolism, thereby protecting against biomembrane damage.

Glycine maintains redox balance and block reactive oxygen species-induced lipid peroxidation by improved mitochondrial, peroxisome and lipid droplet function in porcine oocytes.Glycine protects against biomembrane damage and reducing the occurrence of ferroptosis to maintain normal oocyte development function.

Introduction

Production of high-quality gametes is the premise of livestock reproduction and conservation of germplasm resources, especially high-quality oocytes, as oocyte quality determines the quality of offspring. Low-quality oocytes are the main reason for the failure of fertilization or embryonic development. Due to the limitations in approaches and the number of mature oocytes in vivo, in vitro maturation (IVM) culture has become an important way to obtain mature oocytes. However, IVM-cultured oocytes are separated from the follicular micro-environment in vivo and are, thus, more vulnerable than in vivo oocytes to changes in the external environment. This vulnerability disrupts the homeostasis of the intracellular environment, such as by causing oxidative stress, which affects oocyte meiotic completion and subsequent embryonic developmental competence in vitro (Wiener-Megnazi et al. 2004).

Oxidative stress manifests mainly as an imbalance in reactive oxygen species (ROS) or decreased antioxidant activity. Elevated levels of ROS have been associated with decreased meiotic completion, altered spindle microtubules, chromosome misalignment, decreased in vitro fertilization (IVF) success rates and diminishing embryonic developmental potential. In addition, it has been well-established that excessive ROS initiate mitochondrial dysfunction and lipid peroxidation (LPO; Elezaby, 2017), damaging cell membranes and cells overall. Mitochondrial dysfunction leads to useless ATP hydrolysis and increased oxidative stress. When LPO occurs, ROS react with the side chains of polyunsaturated fatty acids (PUFAs) and nucleic acids related to phospholipids, enzymes, and membrane receptors on the biomembrane, forming LPO products such as MDA and 4-hydroxynonenal (4-HNE). These products change the fluidity and permeability of the cell membrane and cause an LPO chain reaction. In particular, when the glutathione (GSH)-dependent lipid peroxide repair system is damaged, the excessive production of ROS and the activation of LPO are linked to ferroptosis-dependent cell death, which causes damage to the lipid bilayer of the plasma membrane through accelerated oxidation of membrane lipids and eventually leads to changes in cell structure and function, affecting the developmental ability of oocytes (Stockwell et al., 2017; Stockwell and Jiang, 2020). Mitochondrial damage has been found to be involved in LPO and iron homeostasis imbalance in porcine oocyte maturation and embryonic developmental competence (Hu et al., 2021;Gu et al., 2022). Reducing ROS and LPO levels can effectively alleviate ferroptosis, membrane damage, and cell damage. Therefore, ameliorating the ferroptosis and membrane damage caused by lipid metabolism is urgently needed. The ferroptosis and damage to cells and biomembranes elicited by LPO can be countered through activation of anti-oxidant defences and/or stringent repair pathways.

Mitochondria are well-studied major sites of ROS generation and are related to signal initiation. Moreover, they play an important role in energy metabolism, and mitochondrial respiration and the electron transport chain (ETC) play critical roles in ATP production through oxidative phosphorylation. Peroxisomes are also capable of ROS generation (Antonenkov et al., 2010), and previous studies have demonstrated that intraperoxisomal redox status is strongly influenced by environmental growth conditions. Furthermore, generating excess ROS inside peroxisomes quickly perturbs the mitochondrial redox balance and leads to excessive mitochondrial fragmentation (Novikoff and Novikoff, 1982; Wang et al., 2013). and previous studies have demonstrated that the intraperoxisomal redox status is strongly influenced by environmental growth conditions. Furthermore, the generation of excess ROS inside peroxisomes quickly perturbs the mitochondrial redox balance and leads to excessive mitochondrial fragmentation (Ivashchenko et al., 2011; Walton, 2012). Similar studies have also shown that glycine can maintain mitochondrial homeostasis and improve the preimplantation development of oocytes (Cao et al., 2016; Zander-Fox et al., 2013). In mammals, peroxisomes and mitochondria are metabolically linked (Wanders, 2004), and they participate and cooperate in fatty acid (FA) degradation and LPO regulation (Ravi et al., 2021). Therefore, LPO-elicited ferroptosis and damage to cells and biomembranes can be countered by regulating the functions of mitochondria and peroxisomes and by increasing the antioxidant capacity.

Glutathione (GSH) is an important anti-oxidant that is exclusively synthesized in the cytosol. Mitochondria and peroxisomes, as the major sites of oxidative reactions, must maintain sufficient levels of GSH to perform their protective and biosynthetic functions. Studies have confirmed that the molecules of reduced GSH (molecular mass 307.3 Da) freely penetrate the mitochondrial membrane (Wang et al., 2021) and peroxisomal membrane (Antonenkov et al., 2010). GSH peroxidase (GSH-PX) specifically catalyzes the reaction of GSH with ROS to generate oxidized GSSG. GSH/GSSG can maintain redox balance, eliminate harmful peroxide metabolites in cells, and block LPO chain reactions, thereby protecting biomembranes from ROS damage and maintaining normal cell function. Glycine is an important component of the anti-oxidant GSH in mammals. Our previous studies have shown that supplementation with exogenous glycine can improve the function of mitochondria by increasing GSH and ATP levels and by decreasing ROS levels during IVM of porcine oocytes, thereby significantly increasing the efficiency of IVM and IVF (Li et al., 2018; Yu et al., 2021a). These findings show that glycine positively affects the regulation of mitochondrial function and GSH and ROS levels. Although there have been studies on the anti-oxidant mechanisms of these factors in cells, there are no reports on the effect of glycine on LPO, especially in porcine oocytes or embryos.

The objective of this study was to confirm whether glycine can regulate LPO induced by ROS, thus protecting oocytes from ferroptosis and promoting oocytes maturation in vitro. This study will provide a theoretical basis for preventing and improving oxidative damage during oocyte culture in vitro.

Materials and Methods

All animal experiments were carried out based on the Guide for the Care and Use of Agricultural Animals in Research and Teaching.

Cumulus–oocyte complex (COC) collection and culture

Ovaries of prepubertal sows were collected from local abattoirs, placed in 0.9% physiological saline in a thermos bottle and transported to our laboratory within 2 h. COCs were aspirated from 3- to 6-mm follicles using a 20-mL syringe and an 18-gauge needle. Oocytes with intact and dense cumulus cells and uniform ooplasm were selected for this study. NCSU-37 supplemented with bicarbonate, 10 ng/mL Epidermal growth factor (EGF), 10 IU/mL pregnant mare serum gonadotropin (PMSG), 10 IU/mL Human Chorionic Gonadotrophin (hCG), and 10% pFF were used as IVM medium. Oocytes were incubated in four-well culture dishes at 38.5 °C and 5% CO₂ for 26 to 28 h to middle phase I (MI) or 44 to 48 h to MII. Cumulus cells around COCs were gently dissected with a fine-well pipettes in 0.1% hyaluronidase (NCSU-37), and the stripped oocytes were collected for subsequent analysis.

Glycine treatment

Our previous studies have shown that 6-mM glycine treatment have a benefcial effect on the development of porcine oocytes after IVM culture and subsequent parthenogenetic activation (PA) of blastocysts (Li et al., 2018). Therefore, 6-mM glycine was used directly for sequencing in this study. Glycine was dissolved in NCSU-37 medium to a 1.2-M stock solution and then diluted in IVM medium to a final concentration of 6 mM. The working solution for each experiment was used immediately.

Measurement of cumulus cell expansion degree

The diameter expansion of cumulus cells was measured by microscopy (ix70, Olympus, Tokyo, Japan). COCs were measured using the two vertical diameters at maturity in all groups, each oocyte was regarded as a circle, two perpendicular diameters were selected, and the length of diameter was measured to evaluate the cumulus expansion.

In vitro fertilization

Mature cumulus-free oocytes were treated with 113.1-mM NaCl, 3-mM KCl, 7.5-mM CaCl₂, 11-mM glucose, 20-mM Tris, 2-mM caffeine, and 5-mM sodium pyruvate; and 2 mg/mL BSA was washed three times in modified Tris buffer medium (mTBM). After washing, 15 to 20 oocytes were transferred into 50-μl mTBM droplets and covered with warm mineral oil in a 35 × 10 mm petri dish at 38.5 °C and 5% CO₂. Each semen sample was washed three times by centrifugation at 1,000 × g for 3 min in Dulbecco phosphate buffered saline (DPBS) supplemented with 0.1% bovine serum albumin. After the last wash, the sperm pellet was resuspended in mTBM at a concentration of 1 × 106 cells/mL, and 50 μL of the sperm suspension was added to 50 μl of mTBM droplets containing 15 to 20 oocytes. The culture was incubated for 6 h at 38.5 °C in a humid environment containing 5% CO₂. Fertilized eggs were transferred to PZM-3 Petri dishes. The cleavage rate and blastocyst rate were calculated on the seventh day of culture in vitro.

Analysis of ROS and GSH levels

Live oocyte cells were incubated with CellTracker Blue 4-chloromethyl-6.8-difluoro-7-hydroxycoumarin (CMF₂HC, Invitrogen) and 2’,7’-dichlorodihydrofluorescein diacetic acid (H₂DCFDA) for 30 min in the dark. After being washed three times in PBS+0.1% PVA, oocytes were mounted on glass-bottom culture dishes supplemented with PBS droplets and observed under a fluorescence microscope (Olympus, Tokyo, Japan).

LDs and ATP detection

The distribution of LDs and ATP was detected with BODIPY 493/503 and BODIPY FL ATP, respectively. Mature oocytes were fixed with 4% paraformaldehyde at room temperature (RT) for 2 h. Then, they were stained with 2.5 mg/mL BODIPY 493/503 and 500 nM BODIPY FL ATP for 1 h at 38.5 °C in a 5% CO₂ incubator. After being washed three times in PBS+0.1% PVA, the oocytes were fixed on a slide and examined under a confocal laser-scanning microscope.

Quantification of MDA levels

The MDA levels in the oocytes were analyzed using an MDA assay kit according to the manufacturer’s protocol. TBA reagent was prepared by mixing 25 mg of TBA, 6.76 mL of TBA mixed liquid, and 2.2 mL of TBA diluent; then, 100 µL of each homogenized oocyte sample was mixed with 200 µL of TBA and 3 µL of anti-oxidant reagent. The mixture was incubated in a boiling water bath for 15 min and then cooled on ice. After cooling, the mixture was centrifuged at 4,000 rpm for 10 min. The absorbance of the supernatant was determined at 532 nm against a blank.

Mitochondrial detection

Mitochondrial volume was evaluated using MitoTracker CMXRos Red (Molecular Probes). Mature oocytes were washed with PBS+0.1% PVA three times and stained with MitoTracker Red (1:200) for 20 min at 37 °C. After being washed three times in PBS+0.1% PVA, the oocytes were mounted on a glass-bottom culture dish supplemented with PBS droplets and observed under a fluorescence microscope.

Ferrous ion staining

The Fe²⁺ levels in oocytes were detected using FerroOrange. The samples were stained with FerroOrange (1:200) for 30 min at 37 °C. After washing three times in PBS+0.1% PVA, oocytes were placed in glass-bottom petri dishes supplemented with PBS droplets and observed under a fluorescence microscope.

Immunofluorescence staining

Denuded oocytes from each group were fixed with 4% paraformaldehyde at RT for 30 min. Then, the cells were permeabilized with 1% Triton X-100 at RT for 10 min after blocking with PBS supplemented with 3% BSA for 1 . The oocytes were stained with an NRF2 antibody (Beyotime AF7623) and a PEX19 antibody (Gen Tex 43915) overnight at 4 °C. After three washes with PBS+0.1% PVA, the oocytes were incubated with goat antirabbit IgG for 1 h at RT in the dark. Finally, oocytes were mounted on glass slides and then observed with a Leica TCS SP5.

RNA sequencing (RNA-seq) and analysis

cDNA libraries were constructed from control and glycine porcine oocyte RNA and sequenced on the Illumina NovaSeq6000 platform. The quality of RNA was assessed using the miRNeasy Kit (Qiagen, USA). Using pairwise end RNA-seq, we sequenced the transcriptome, yielding a total of 1 million 2 × 150 bp pairwise end reads. To obtain high-quality clean reads, we further filtered the reads with Cutadapt. Subsequently, we used the HISAT2 package to align reads from all samples with the porcine oocyte reference genome. The transcripts of all samples were then combined using gffcompare software to construct a comprehensive transcriptome. After the final transcriptome generation, StringTie and Ballgown were used to estimate the expression levels of all transcripts, and mRNA abundance was determined by calculating fragment values per kilobase per million (FPKM). Gene Ontology (GO) enrichment analysis was performed for differentially expressed genes.

RNA extraction and quantitative real-time fluorescence PCR (qPCR)

Total mRNA was extracted from 30 oocytes using the Arcturus PicoPure RNA Isolation Kit (Thermo, KIT0204). The RNA was reverse transcribed to cDNA with the PrimeScript RT kit and then stored at −20 °C until use. qPCR was performed using a QuantStudio 5 Flex Real-Time PCR system (Thermo Fisher, Waltham, MA, USA) using SYBR Green PCR Master Mix. Data were calculated by the 2^−ΔΔCt method with 18S RNA as a control. The primers are shown in Table 1.

Table 1.

Sequences of primers used for RT-PCR

Gene	Primers	Primer sequence (5ʹ to 3ʹ)	Product size, bp
18SRNA	Forward	TCCAATGGATCCTCGCGGAA	82
	Reverse	GGCTACCACATCCAAGGAAG
AMFR	Forward	ATCGTCAGCGCCTACCGC	87
	Reverse	AACCCACACGAAAAGGCTGTC
SREBF1	Forward	GAGCCGCCCTTCACAGAG	78
	Reverse	GTCTTCGATGTCGGTCAGCA
SLC25A39	Forward	GGCCAAGAGCCAGAACTGA	135
	Reverse	GACCTTCACCACATCCAGGG
GPX4	Forward	TGTGTGAATGGGGACGATGC	139
	Reverse	CTTCACCACACAGCCGTTCT
PEX19	Forward	CCCTCGGGCCAACAATATCA	108
	Reverse	ATCTTGCCACCTCCGACTTG
NRF2	Forward	GCCCAGTCTTCATTGCTCCT	105
	Reverse	AGCTCCTCCCAAACTTGCTC
YAP1	Forward	CACAGACAGCGGACTAAGCA	189
	Reverse	CCCTCCAGTGTTCCAAGGTC
MSMO1	Forward	GCTTCTGGGGAGCAGAAATAA	198
	Reverse	AACTGGGCCGAACAGACA
SUV39H2	Reverse	CGAGGCGCGAGGAGGATATG	165
	Forward	TTGCTTTGCCTTTCTTTACCTGAG
TUBA1B	Reverse	GCCGCAAAACAGCAACTATG	152
	Forward	TCCTCCCCCAATGGTCTTGT
HUOY1	Forward	GCCCAGAAGCCAAGTGACAA	104
	Reverse	TCCACCATTCTCTGCTTCCG
PPARγ	Forward	TCCACCATTCTCTGCTTCCG	104
	Reverse	TGTCAACCATGGTCACCTCG
PGC-1α	Reverse	TTCCGTATCACCACCCAAAT	137
	Forward	ATCTACTGCCTGGGGACCTT
ACSL4	Reverse	CGCCTCTGATTGAAAGCACG	169
	Forward	AAGGCAGTAATGGAAGCAGCA

Statistical analysis

Data from at least three independent replicates were specified as the mean percentages (mean ± SEM). SPSS 26.0 software was used for the independent sample t test. P < 0.05 was considered to indicate statistically significant differences.

Results

Effect of glycine treatment on porcine oocyte maturation and early embryonic development

First, we investigated the effects of glycine on the maturation of porcine oocytes. Cumulus diffusion is an important indicator of oocyte maturation. After 42 h of IVM, most cumulus cells in the control group had expanded well, and glycine treatment significantly promoted the proliferation of cumulus cells (Figure 1A). This result was also confirmed by diffusion analysis of cumulus cells (control: 100.57 ± 2.41, N = 80 oocytes vs. glycine: 108.42 ± 1.68, N = 104 oocytes, P < 0.01; Figure 1B). We then calculated the percentage of oocytes at each stage of meiosis. As shown in Figure 1C, compared with the control, glycine treatment significantly reduced the proportion of oocytes developing to the MI stage and promoted the development of most oocytes to the MII stage (MI, control: 19.5 ± 1.13, N = 80 oocytes vs. glycine: 11.9 ± 1.64, N = 104 oocytes, P < 0.05; MII, control: 70.55 ± 0.39, N = 80 oocytes vs. glycine: 78.43 ± 1.08, N = 104 oocytes, P < 0.05).

Figure 1.

Effects of glycine treatment on porcine oocyte maturation and early embryonic development. (A) Effects of glycine exposure on cumulus cell expansion. Bar = 100 µm. (B) The cumulus cell diameter was measured in each group. **P < 0.01. (C) Cell cycle progression in the glycine-treated and control groups. *P < 0.05, **P < 0.01. (D) IVF blastocysts of pigs in the control and glycine groups. Bar = 200 µm. (E) Cleavage rate in the control and glycine groups. *P < 0.05. (F) Blastocyst rate in the control and glycine groups. **P < 0.01.

To examine the effect of glycine treatment on the early embryonic development of porcine oocytes, MII oocytes were fertilized in vitro. As shown in Figure 1D, the cleavage rate was significantly upregulated in the glycine group compared with the control group (control: 90.36 ± 0.11, N = 92 oocytes vs. glycine: 94.57 ± 0.29, N = 95 oocytes, P < 0.05; Figure 1E). A similar result was obtained for the blastocyst rate, which was significantly higher in the glycine group than in the control group (control: 25.29 ± 0.51, N = 92 oocytes vs. glycine: 35.23 ± 1.09, N = 95 oocytes, P < 0.01; Figure 1F). In conclusion, glycine treatment promotes the maturation of porcine oocytes and the development of early embryos.

Effects of glycine on mRNA expression in porcine oocytes

To investigate the potential mechanisms underlying the effect of glycine treatment on the quality of porcine oocytes, we analyzed the transcriptome profiles of the control and glycine groups and subjected porcine oocytes to RNA-seq. As shown in the volcano map, a total of 15,000 differentially expressed genes were identified in oocytes of the glycine group compared with oocytes of the control group, including 171 ­upregulated genes and 153 downregulated genes (padj < 0.05, fold change > 2; Figure 2A). The SMART-seq data were further validated by qPCR for five randomly selected genes (Figure 2C and D). The enrichment of the differentially expressed genes for terms in the biological process, cellular component and molecular function GO categories was analyzed. The results showed that the differentially expressed genes after glycine treatment were associated with cell components, including the nucleus, membrane, integral membrane components, membrane-bound organelles, plasma membrane, and mitochondria (Figure 2B). Therefore, we concluded that glycine may promote oocyte maturation by improving biofilm structure and function.

Figure 2.

Transcriptome analysis to assess the effects of glycine on oocyte maturation. (A) Cluster analysis of the differentially expressed genes after glycine treatment for construction of a volcano plot. (B) GO enrichment analysis of the genes with differential expression after glycine treatment. (C) The SMART-seq results of selected genes in glycine-treated oocytes were compared with those in control oocytes. (D) qPCR validation of SMART-seq data from control oocytes and glycine-treated oocytes.

Effects of glycine on LPO in oocytes

We also examined intracellular ROS levels, as shown in Figure 3A. We found that the ROS fluorescence intensity was significantly lower in the glycine treatment group than in the control group (control: 12.40 ± 0.53, N = 24 oocytes vs. glycine: 9.63 ± 0.55, N = 21 oocytes, P < 0.01; Figure 3B). We also measured the content of MDA in oocytes. As shown in Figure 3C, the MDA content was significantly lower in the glycine treatment group than in the control group (control: 1.00, N = 42 oocytes vs. glycine: 0.78 ± 0.04, N = 40 oocytes, P < 0.05). Taken together, these results suggest that glycine treatment may reduce LPO in porcine oocytes.

Figure 3.

Effects of glycine on lipid metabolism in oocytes. (A) ROS signals in oocytes of the control group and glycine group. Bar = 100 µm. (B) Analysis of ROS fluorescence intensity. *P < 0.01. (C) MDA levels in oocytes of the control group and glycine group. *P < 0.05.

Effects of glycine on mitochondrial function in oocytes

Proper mitochondrial function is essential for oocyte maturation. To investigate the effect of glycine treatment on oocyte maturation, mitochondrial dynamics were assessed. As shown in Figure 4A, the mitochondrial fluorescence intensity was significantly higher in the glycine supplementation group than in the control group. This result was also confirmed by fluorescence intensity analysis (control: 10.69 ± 0.66, N = 24 oocytes vs. glycine: 10.69 ± 0.66, N = 25 oocytes, P < 0.05; Figure 4B).

Figure 4.

Effects of glycine on mitochondrial function in oocytes. (A) Mitochondrial signals in oocytes of the control group and glycine group. Bar = 20 µm. (B) Analysis of mitochondrial fluorescence intensity. *P < 0.05. (C) ATP signals in oocytes of the control group and glycine group. Bar = 20 µm. (D) Analysis of ATP fluorescence intensity. ***P < 0.001.

Mitochondria are the main sites of ATP production. Therefore, we also examined the effect of glycine treatment on ATP. As shown in Figure 4C, compared with that in the control group, the ATP fluorescence intensity was significantly upregulated after glycine supplementation (control: 12.00 ± 0.52, N = 24 oocytes vs. glycine: 18.53 ± 1.07, N = 28 oocytes, P < 0.001; Figure 4D). These results indicate that glycine promotes mitochondrial function development in porcine oocytes.

Effects of glycine on oocyte peroxisomes

According to the GO enrichment results, peroxisome-related genes were significantly enriched after the addition of glycine. Therefore, we detected the protein expression of PEX19 and NRF2, which are important indicators related to peroxisomes, by immunofluorescence staining. As shown in Figure 5A and C, compared with those in the control group, the signal intensities of PEX19 and NRF2 in the glycine group were significantly enhanced. This finding was also confirmed by fluorescence intensity analysis (PEX19, control: 21.76 ± 0.93, N = 42 vs. 33.12 ± 1.02, N = 40, P < 0.001; NRF2: 11.37 ± 0.39 ± 0.39, N = 32 vs. 13.13 ± 0.60, N = 34, P < 0.05; Figure 5B and D).

Figure 5.

Effects of glycine on oocyte peroxisomes. (A) PEX19 signals in oocytes of the control group and glycine group. Bar = 20 µm. (B) Analysis of PEX19 fluorescence intensity. ***P < 0.001. (C) NRF2 signals in oocytes of the control group and glycine group. Bar = 20 µm. (D) Analysis of NRF2 fluorescence intensity. *P < 0.05. (E) mRNA expression of peroxisome-related genes in oocytes of the glycine and control groups. *P < 0.05. ***P < 0.001.

Then, we detected the mRNA expression of the peroxisome-related genes PEX19 and NRF2. As shown in Figure 5E, the expression levels of PEX19 and NRF2 were significantly upregulated in oocytes treated with glycine (PEX19, control: 1.00 vs. glycine: 3.38 ± 0.29, N = 40 oocytes, P < 0.001; NRF2, control: 1.00 vs. glycine: 1.20 ± 0.05, N = 34, P < 0.05). These data suggest that glycine treatment promotes peroxisomal function in porcine oocytes.

Effect of glycine on lipid metabolism in oocytes

We used BODIPY-LD, a novel green fluorescent stain for neutral lipids, to detect the cytoplasmic lipid content of oocytes. As shown in Figure 6A, the LDs levels of oocytes in the control group were relatively low, while those of oocytes in the glycine group were significantly higher, which was also confirmed by fluorescence intensity analysis (control: 7.46 ± 0.61, N = 42 oocytes vs. glycine: 9.52 ± 0.47, N = 40 oocytes, P < 0.05; Figure 6B). We also analyzed the expression of several genes related to lipid metabolism. As shown in Figure 6C, the expression of PGC-1α and SREBF1 was significantly increased, while the expression of AMFR was significantly decreased (PGC-1α, control: 1.00 vs. glycine: 1.76 ± 0.19, P < 0.05, N = 32 oocytes; SREBF1, control: 1.00 vs. glycine: 1.68 ± 0.10, P < 0.05, N = 35 oocytes; AMFR, control: 1.00 vs. glycine: 0.65 ± 0.02, P < 0.05, N = 30 oocytes). These results indicated that glycine can promote lipid metabolism in oocytes.

Figure 6.

Effects of glycine on lipid metabolism in oocytes. (A) LD signals in oocytes of the control group and glycine group. Bar = 20 µm. (B) Analysis of LD fluorescence intensity. *P < 0.05. (C) Relative expression of genes related to lipid metabolism in oocytes of the glycine and control groups. *P < 0.05, **P < 0.01.

Effect of glycine on GSH and iron ion levels in oocytes

Glycine is an important amino acid involved in GSH synthesis. Therefore, we examined the effect of glycine supplementation on GSH levels in oocytes. As shown in Figure 7A, weak GSH fluorescence signals were generated in control oocytes. However, the oocytes in the glycine group produced very strong GSH fluorescence signals. GSH fluorescence intensity analysis confirmed this finding (control: 42.83 ± 0.72, N = 22 oocytes vs. glycine: 71.71 ± 1.88, N = 23 oocytes, P < 0.001; Figure 7B). We also analyzed the mRNA expression of several anti-oxidant-related genes, and as shown in Figure 7C, the expression of SOD1, SOD2, CAT, and SL25H39 was significantly upregulated, which further confirmed our results (SOD1, control: 1.00 vs. glycine: 1.71 ± 0.08, N = 30 oocytes, P < 0.05; SOD2, control: 1.00 vs. glycine: 3.04 ± 0.08, N = 34, P < 0.001; CAT, control: 1.00 vs. glycine: 1.23 ± 0.02, N = 32, P < 0.05; SLC25H39, control: 1.00 vs. glycine: 1.21 ± 0.03, N = 32 oocytes, P < 0.05; Figure 6C).

Figure 7.

Effect of glycine on GSH and iron ion levels in oocytes. (A) GSH signals in oocytes of the control group and glycine group. Bar = 100 µm. (B) Analysis of GSH fluorescence intensity. ***P < 0.001. (C) mRNA expression of antioxidant-related genes in oocytes of the glycine and control groups. *P < 0.05, **P < 0.01. (D) Fe²⁺ signals in oocytes of the control group and glycine group. Bar = 100 µm. (E) Analysis of Fe²⁺ fluorescence intensity. ***P < 0.001. (F) mRNA expression of ferroptosis-related genes in oocytes of the glycine and control groups. *P < 0.05, ** P < 0.01.

An increase in iron accumulation is key to the induction of ferroptosis. Therefore, we examined Fe²⁺ accumulation. As shown in Figure 7D, the iron level was high in the control group but low in the glycine group. This result was confirmed by fluorescence intensity analysis (control: 12.96 ± 0.45, N = 22 oocytes vs. glycine: 9.07 ± 0.17, N = 23 oocytes, P < 0.001; Figure 7E). Next, the expression levels of the ferroptosis-related genes GPX4 and ACSL4 were detected by qPCR. As shown in Figure 7F, GPX4 mRNA expression was upregulated after glycine treatment, while ACSL4 mRNA expression was downregulated (GPX4, control: 1.00 vs. glycine: 1.35 ± 0.02, N = 30 oocytes, P < 0.01; ACSL4, control: 1.00 vs. glycine: 0.85 ± 0.03, N = 34, P < 0.05). Taken together, these results indicate that glycine expression can reduce the occurrence of ferroptosis by increasing GSH levels.

Discussion

Our previous studies have shown that glycine, one of the main synthetic components of GSH, plays an important role in regulating the levels of ROS and the functions of mitochondria and the endoplasmic reticulum (ER; Yu et al., 2021a, 2021b). Glycine plays an active role in promoting IVM and IVF of oocytes (Li et al., 2018; Redel et al., 2016). To further clarify the mechanism of glycine, SMART-seq was used to investigate the effects of glycine treatment on the IVM and development of porcine oocytes. The differentially expressed genes identified by SMART-seq were subjected to GO enrichment analysis, which revealed enrichment of cellular components, including the nucleus, membrane, integral component of membrane, intracellular membrane-bound organelle, plasma membrane and mitochondria. Thus, the role of glycine in promoting oocyte development seems to be related to improvement of the structure and function of the biomembrane (Figure 8).

Figure 8.

Mechanism by which glycine regulates lipid peroxidation in oocytes.

It has been demonstrated that cell membrane structure and function are dynamically affected by lipid composition, temperature, and oxygen concentration and are maintained mainly by unsaturated FA production (Elezaby, 2017). However, excessive ROS can react with PUFAs on the cell membrane and induce LPO; as a result, the fluidity and permeability of the cell membrane is changed, which ultimately leads to changes in cell structure and function. Therefore, we hypothesized that glycine may improve the structure and function of the cell membrane by reducing ROS-induced LPO.

In this study, we first tested the effect of glycine on LPO induced by ROS. We evaluated the levels of MDA, which is a product of LPO and an important indicator of oxidative damage (Sezer et al., 2020), and found that the levels of ROS and MDA were significantly reduced after glycine treatment. This finding suggests that glycine can reduce LPO induced by ROS that are produced by oxidative stress in in vitro-cultured oocytes.

Mitochondria (Jain et al., 2020), peroxisomes (Ding et al., 2021), and LDs (Olzmann and Carvalho, 2019) are closely related, and these components interact and play an important role in the regulation of LPO (Zhou et al., 2018). One of the numerous consequences of mitochondrial dysfunction is an increase in ROS production as a byproduct of electron leakage from the ETC. The resulting increase in ROS concentration may also lead to LPO. Our study results are consistent with this mechanism, as we proved that glycine enhances mitochondrial function and increases ATP production while decreasing ROS and MDA production.

Peroxisome dysfunction sensitizes cells to oxidative stress. Wang et al. confirmed that cells lacking peroxisomes are more sensitive to oxidative stress than corresponding control cells (Wang et al., 2013). A likely explanation for this difference may be that a partial or complete decrease in peroxisome function influences a cell’s ability to shorten very long-chain FAs and to synthesize sufficient amounts of plasmalogens (Van Veldhoven, 2010), two processes that are likely to alter membrane composition, structure, fluidity, and function (Nagura et al., 2004). To track the enzymatic activities and function in peroxisomes, we detected PEX19 and NRF2. PEX19, one of the major factors associated with peroxisomal membrane biogenesis, plays numerous roles in the functional assembly of peroxisomes and participates in the categorization of membrane proteins for transport to other organelles, such as LDs and mitochondria (Jansen and Klei, 2019). Research has shown that melatonin upregulates the β-oxidation of FAs in peroxisomes by increasing the expression of PEX19 (Sunyer-Figueres et al., 2020). Regarding NRF2, previous studies have shown that NRF2 and peroxisomes synergistically prevent the generation of ROS and enhance porcine oocyte quality (Kim et al., 2020). NRF2 not only participates in the maintenance of cellular redox homeostasis but also mediates FA β-oxidation, mitochondrial membrane potential, and ATP production. Interestingly, we also demonstrated that glycine can significantly increase the expression of PEX19 and NRF2 and enhance mitochondrial function and ATP production to prevent ROS generation and enhance porcine oocyte quality. Similar research results have shown that knockdown of PEX19 leading to peroxisome dysfunction causes severe ultrastructural alterations in mitochondria accompanied by changes in the expression and activity of mitochondrial respiratory chain complexes and simultaneous suppression of NRF2 signaling activation and facilitation of ROS accumulation (Dirkx et al., 2005).

LDs are storage organelles at the center of lipid and energy homeostasis. LDs, which originate from the ER, can associate with most other cellular organelles (including mitochondria and peroxisomes) through membrane contact sites. LD-associated mitochondria exhibit reduced β-oxidation and display increased ATP synthesis. In mammals, most β-oxidation occurs in mitochondria, but peroxisomes are essential for β-oxidation of very-long-chain FAs and branched-chain FAs, and mice lacking peroxisomes accumulate enlarged LDs in their livers (Dirkx et al., 2005). In this study, we found more LDs with glycine treatment than without glycine treatment during IVM. The larger numbers and areas of LDs in the cytoplasm were closely related to subsequent embryonic development. It has been confirmed that the developmental competence of oocytes depends in part on the capacity of oocytes to increase their intracellular energy stores, and accumulation of energy helps oocytes resist excessive production of ROS. To study this phenomenon, we examined some key factors related to the regulation of lipogenesis and lipolysis. We found that the glycine treatment group exhibited a higher blastocyst formation rate than the other treatment and control groups as well as significantly increased ATP content and expression of genes related to lipid metabolism, including PGC-1α, PPARγ, SREBF1, and AMFR. These factors are important regulators of lipid metabolism and participate in LPO (Jain et al., 2020). Our previous studies have also shown that glycine mainly improves the function of mitochondria and promotes ATP production. Moreover, our results may be supported by some studies demonstrating that lipid-derived ATP synthesis by mitochondria promotes porcine embryonic development (Sturmey and Leese, 2003).

ROS-induced accumulation of lipid peroxides, mainly lipid hydroperoxides, and iron induces ferroptosis, which damages the lipid bilayer of the plasma membrane through accelerated oxidation of membrane lipids (Stockwell et al., 2017). A previous study has shown that the plasma membrane phospholipid peroxidation caused by ROS that are produced during Fenton reactions can be used as an indicator of ferroptosis (Dixon et al., 2012). Porcine oocytes have higher intracellular lipid levels than oocytes of other species, making them highly sensitive to ROS-induced impairments (Gajda, 2009). In addition, GPX4 plays a crucial role in protecting against ferroptosis by reducing the levels of phospholipid hydroperoxides and hence repressing lipoxygenase-mediated LPO (Yang et al., 2014). Furthermore, ACSL4 is needed for the production of PUFAs that are required for the execution of ferroptosis (Wang et al., 2022). These findings are consistent with our results. We compared the levels of Fe²⁺ between the control group and the glycine group in in vitro culture and found that they were significantly reduced in the glycine group. Subsequently, we found that GSH levels and GPX4 mRNA expression were significantly increased and that ROS levels and ACSL4 mRNA expression were significantly decreased in oocytes treated with glycine. Glycine is one of the main synthetic components of GSH and is catalyzed by the cytosolic enzymes glutamate cysteine ligase and GSH synthetase to participate in the regulation of ferroptosis (Xu et al., 2021). In addition, various ROS-detoxifying enzymes, including CAT, SOD, and SLC25A39 (which are necessary for mitochondrial GSH import in mammalian cells) were detected. We verified that glycine treatment can significantly enhance the antioxidant capacity of porcine oocytes and reduce the adverse effects of ROS production.

Conclusion

In summary, our results suggest that glycine can maintain redox balance and block ROS-induced LPO, thereby protecting against biomembrane damage and reducing the occurrence of ferroptosis to maintain normal oocyte development function.

Glossary

Abbreviations

ACSL4

member 4 of the long chain acyl-CoA synthetase family

AMFR

autocrine motility factor receptor

CAT

catalase

GPX4

glutathione peroxidase 4

GSH

glutathione

GV

germinal vesicle

GVBD

germinal vesicle breakdown

IVM

in vitro maturation

IVF

in vitro fertilization

LPO

lipid peroxidation

MI

metaphase I

MII

metaphase II

MDA

malondialdehyde

PA

parthenogenetic activation

PGC1α

peroxisome proliferator-activated receptorcoactivator 1 alpha

PPARγ

peroxisome proliferator-activated receptor γ

ROS

reactive oxygen species

SLC25A39

mitochondrial solute carrier family 25, member 39

SREBF1

sterol regulatory element binding factor 1

Conflict of Interest Statement

The authors declare no real or perceived conflicts of interest.