Identification of Salmonella carriers by amplification of FimA, Stn and InvA genes and bacterial culture methods in fecal samples of buffalo

Abstract

Salmonellosis is one of the most important bacterial diseases in human and animals. Rapid diagnosis and sub sequence accurate treatment of Salmonella carriers help reduce the salmonellosis in human and livestock animals. In this study, 420 fecal samples were taken during year 2019 from buffalo in the Urmia, Khoy and Piranshahr regions in west Azerbaijan province, Iran. Samplings were carried out in different seasons. Presence of Salmonella invasion genes (FimA, Stn and InvA) were evaluated by polymerase chain reaction. The bacterial culture and biochemical tests were performed on feces samples for isolation of bacterium Salmonella; however, all samples were negative in culture method. PCR findings showed that, 50 (11.90%) fecal samples were positive to the genes. The analysis of results showed that frequency of salmonellosis outbreak in different parts of west Azerbaijan province followed a similar pattern and the incidence of salmonellosis according to forecast in the warm seasons (spring and summer) was more than in cold seasons (autumn and winter). The prevalence of Salmonella in buffalo’s feces based on warm and cold seasons were 32 (64.00%) and 18 (36.00%), respectively. The results showed significant difference between cold and warm season in the prevalence of salmonellosis. Therefore, the application of molecular technics is essential for the prevention and treatment of salmonellosis. The results also showed that specificity of PCR method was better than culture method for detection of Salmonella in feces sample.

Introduction

Salmonella spp. is gram-negative, anaerobic and toxin producing that belongs to the Enterobacteriaceae family.¹ Salmonellosis is one of the most important zoonotic infectious diseases in humans and animals.² The disease is usually associated with miscarriage, enterocolitis with diarrhea and foul-smelling and watery diarrhea followed by septicemia and death. Salmonellosis is usually associated with active and inactive carriers of the bacterium.³ The role of carriers in the spread of infection is very important. Excoriation of Salmonella through feces has reported to lead to contaminate the environment, water, food and a wide range of human and animal populations.⁴

To date, 2,700 Salmonella serotypes have been reported with S. typhimurium being more important than the rest.⁵ Food-borne diseases caused by non-typhoid Salmonella are a major public health problem worldwide.⁶ In underdeveloped countries, more than one billion intestinal infections and up to 5.00 million deaths are reported annually.⁷ Controlling the spread of Salmonella infection requires rapid detection, treatment of infected animals and separation of infected animal from others. However, different Salmonella servers may differ in their severity.⁸ however, it means that all Salmonella typhimurium and S. enterica are pathogenic.⁹ In particular, it is considered as the cause of human salmonellosis.¹⁰ In southeast Asia, S. enteric is on the rise. The infectious dose of Salmonella for pathogenicity in the host is usually 10⁶ to 10⁸ CFU.¹¹ In the past, culture methods and biochemical tests were basically used to diagnose Salmonella. ¹² However, due to the low efficiency and time consuming of these methods, nowadays molecular and serological methods have replaced.¹³

In the present study identification of Salmonella was confirmed by detection of different genes (FimA, Stn and InvA) by polymerase chain reaction.^14,15 The gene InvA invading Salmonella is present in Salmonella isolates and is responsible for invading the epithelial tissue of the human and animal intestines.¹⁶ The Stn gene is toxic to intestinal epithelial cells and leads to intestinal disorders. The reason for selecting this gene is it’s approximately 99.00% abundance in different Salmonella serotypes. This gene is not only specific for Salmonella but is present in all pathogenic Salmonella.^17,18 In this study, feces sample were used to diagnose salmonellosis in buffaloes. The use of stool samples is important not only for the diagnosis of salmonellosis but also for diagnosis of carriers of this bacterium.

The aim of this study was to investigate the prevalence of Salmonella carriers in buffaloes of west Azerbaijan province. The Buffalo’s meat and milk products are playing important role in food production in west Azerbaijan province. Therefore, this livestock can play an important role in spreading the prevalence of salmonellosis in urban and rural communities as well as other livestock herds. Also, sampling was done in different seasons of the year and in different parts of the province to determine the prevalence of salmonellosis seasonally and geographically. Also, in this study, the sensitivity of PCR method was compared to culture method.

Materials and Methods

Sampling. In 420 buffaloes 15.00 gr of feces sample were taken from each animal by sterile gloves during 2019 in Urmia, Khoy and Piranshahr regions, West Azerbaijan province, Iran (140 samples from each region). Also, these samples were taken in different seasons of the year so that 70 samples were taken in warm season (spring and summer) and 70 samples in cold season (autumn and winter). Samples were collected directly during defecation and placed in sterile packages in plastic bags. The samples were transferred to the microbiology laboratory in the Faculty of Veterinary Medicine, Urmia University and kept at – 20.00 ˚C until to onset of culture and molecular methods.

Isolation of Salmonella by culture method. Each sample (5.00 g) was transferred to test tubes containing 4.00 mL of selenite F Broth (Merck, Darmstadt, Germany) enrichment solution. After mixing with vortex, the tubes were incubated at 37.00 ˚C for 24 hr. Then, samples were cultured on Salmonella-Shigella agar (Merck). The suspected colonies were tested biochemically on urea Broth, peptone water, sulfur-indole-motility, citrate and triple sugar iron media (Merck). The growth of bacterium on culture medium was evaluated after 24 hr incubation at 37.00 ˚C.¹⁹

DNA extraction for detection of Salmonella by PCR method. Enriched feces samples in selenite F medium were removed from the incubator and vortexed for about a few seconds to homogenize. Then 500 μL of enriched samples were transferred to a micro centrifuge (Eppendorf, Hamburg, Germany) tube with of 500 μL DNase-RNase (DNA Zist Asia, Mashhad, Iran) free distilled water. The cell suspension was centrifuged (Sigma, Ostode am Hrz, Germany) for 10 min at 14,000 g. The supernatant was discarded carefully. The pellet was suspended in 300 μL of DNase-RNase free distilled water (DNA Zist Asia) by vortexing (Fanavaran Sahand Azar, Tehran, Iran). The tube was centrifuged at 14,000 g for 5 min and the supernatant was discarded carefully. The pellet was suspended in 200 μL of DNase-RNase-free distilled water by vortexing. The micro centrifuge tube was incubated for 15 min at 100 ˚C and immediately chilled on ice. The tube was centrifuged for 5 min at 14,000 g at 4.00 ˚C. The supernatant was carefully transferred to a new micro centrifuge tube (Eppendorf) and incubated again for 10 min at 100 ˚C and chilled immediately on ice. An aliquot of 5.00 μL of the supernatant was used as the template DNA in the PCR (http://www.pcr.dk/DNA-purification.htm).

Primers and PCR. After making sure that the primers (NCBI) were suitable, they were sent to Pishgam Co. (Tehran, Iran) for synthesis. For the molecular detection of Salmonella PCR targeting the 16S rRNA and transposon (InvA, FimA and Stn) genes were employed. The primers for the PCR used in this study were previously described by Revolledo and Ferreira, and Quan et al.^14,20 To perform the PCR, Taq DNA Polymerase Master Mix RED (Amplicon, Sten huggervej, Denmark) was used. The PCR reaction was carried out in 25.00 μL volume comprising 5.00 μL of extracted DNA, 50.00 pmol of each primer (InvA-F-R, FimA-F-R, and Stn-F-R), 12.50 μL of master mix. The PCR thermal programs were set on the thermal cycler device (Quanta Biotech, Byfleet, UK). During PCR, Water DEPC-Treated (California, Santa Cruz, USA) was used as negative control of extraction. S. typhimurium (ATCC 1730) was used as positive control of DNA amplification procedure. Time and temperature for amplification of the selected genes in PCR method were detailed as follow: InvA gene, the first denaturation was performed in 94.00 ˚C for about 3 min, 35 temperature cycles including second denaturation fulfilled in 94.00 ˚C for about 30 sec. and annealing was performed in 53.00 - 69.30 ˚C for about 30 sec and elongation in 72.00 ˚C for about 30 sec. Final elongation was carried out in 72.00 ˚C for about 3 min. For Stn gene the first denaturation was performed in 94.00 ˚C for about 3 min, 35 temperature cycles including second denaturation fulfilled in 94.00 ˚C for about 30 sec and annealing was performed in 55.00 ˚C for about 30 sec and elongation in 72.00 ˚C for about 30 sec. Final elongation was carried out in 72.00 ˚C for about 10 min. For Fim gene the first denaturation was performed in 94.00 ˚C for about 3 min, 45 temperature cycles including second denaturation fulfilled in 94.00 ˚C for about 1 min and annealing was performed in 55.00 ˚C for about 30 sec and elongation in 72.00 ˚C for about 1 min. Final elongation was carried out in 72.00 ˚C for about 10 min. Eventually, in order to replicate the 16S rRNA gene the following steps were taken: The first denaturation was performed in 95.00 ˚C for about 5 min, 35 temperature cycles including second denaturation fulfilled in 94.00 ˚C for about 1 min and annealing was performed in 60.00 ˚C for about 30 sec and elongation in 72.00 ˚C for about 1 min Final elongation was carried out in 72.00 ˚C for about 10 min. The presence of 284, 260, 85 and 660 base pairs indicated the presence of InvA, Stn, FimA and 16S rRNA genes, respectively. Moreover, primer sequences were as follow: InvA gene (F-5- GTGAAATTATCGCCACGTTCGGG CAA-3, R-5- TCATCGCA CCGTCAAAGGAACC-3), Stn gene (F-5- CTTTGGTCGTAAAATAAGGCG-3, R-5- TGCCCAAAG CAGAGAGATTC-3), FimA gene (F-5-CCTTTCTCCATCGTC CTGAA-3, R-5- TGGTGTTATCTGCCTGACCA3) and 16S rRNA gene (F-5- GGAACTGAGACACGGTCCAG-3, R-5- CCAGGTAAGGTTCTTCGCGT-3).^14,19

Electrophoresis of PCR products. The PCR products (16S rRNA, InvA and Stn genes) were electrophoresed on a 1.50% agarose gel containing safe stain and then visualized using Ingenius Gel Documentation (Syngene Bio Imaging, Cambridge, UK). The PCR product for FimA gene was electrophoresed in 3.00% agarose gel.

Sequencing of DNA isolates. For confirmation of Salmonella genus, two samples of the isolated DNA were sent to the Pishgam Company, Tehran, Iran.

Results

The results showed that isolation of Salmonella in culture method was negative in all samples. In contrast, PCR method indicated the presence of Salmonella genes (16S rRNA, InvA, Stn and FimA in 50 samples (11.90%). The number of positive samples in Urmia, Khoy and Piranshahr were 14 (28.00%), 20 (40.00%) and 16 (32.00%), respectively. The analysis of positive results showed that out of 16 positive samples in Piranshahr, 10 (62.50%) samples were belonged to warm season and 6 (37.50%) samples were related to cold season. Also, in Urmia and Khoy regions, the frequencies of positive samples in warm season were 8 (57.10%) and 14 (70.00%), respectively, and in cold season were 6 (40.90%) and 6 (30.00%), respectively. In whole samples, the frequencies of positive samples in the warm and cold seasons of the year were 32 (64.00%) and 18 (36.00%), respectively. All positive samples were belonged to buffaloes whose fecal consistency had a normal appearance and did not show clinical signs of salmonellosis. In Figures 1, 2, 3, and 4, the PCR results based on FimA, Stn, InvA and 16S rRNA genes of the samples are shown on gel electrophoresis.

Fig. 1.

Agarose gel image of amplified fragment of Salmonella FimA gene (85 bp) using PCR. Lanes 1, and 10: 50 bp molecular ladder (Smobio Technology Inc., Hsinchu, Taiwan), Lane 2: Positive control (S. typhimurium ATCC 1730), Lanes 3, 4, 5, and 6: Positive samples to Salmonella, Lanes 7, and 8: Negative samples to Salmonella, Lane 9: Negative control

Fig. 2.

Agarose gel image of amplified fragment of Salmonella Stn gene (260 bp) using PCR. Lane 1: 50 bp molecular ladder (Smobio Technology Inc.), Lane 8: Positive control (S. typhimurium ATCC 1730), Lanes 2, 3, and 4: Positive samples to Salmonella, Lanes 5, 6, 7, and 9: Negative samples to Salmonella, Lane 10: Negative control

Fig. 3.

Agarose gel image of amplified fragment of Salmonella InvA gene (284 bp) using PCR. Lane 1: 50 bp molecular ladder (Smobio Technology Inc.), Lane 2: Positive control (S. typhimurium ATCC 1730), Lanes 3, 4 and 5: Positive samples to Salmonella, Lanes 6, 7, 8 and 9: Negative samples to Salmonella, Lane 10: Negative control

Fig. 4.

Agarose gel image of amplified fragment of Salmonella 16S rRNA gene (660 bp) using PCR. Lane 1: 50 bp molecular ladder (Smobio Technology Inc.), Lane 2: Positive control (S. typhimurium ATCC 1730), Lanes 3, 4, and 5: Positive samples to Salmonella, Lanes 6 and 7: Negative samples to Salmonella, Lane 8: Negative control

Phylogenetic analysis of Salmonella species InvA, and 16S rRNA genes sequences of two isolates of DNA obtained from animals showed that they were belonged to the genus Salmonella and all of them were closely related to each other with less significant genetic distance (99.9:100) and less significant branches. The similarity between the Iranian isolates and other sequences obtained from the gene bank was slightly different and this might be attributed to the differences of the host, source and locality. Depending on the obtained results, phylogenetic analysis and testing of the genetic distances, the Iranian Salmonella isolates from animals were closely related. The sequences were registered in NCBI with the accession numbers ON954830 and ON968482).

Discussion

Salmonellosis is a common disease of humans and animals and is economically important in the world. Livestock and livestock products are the most important reservoir of bacteria to human being.²¹ Therefore, the diagnosis of salmonellosis in livestock is very important. The common habitant of Salmonella is the gastrointestinal tract. The carrier animals excrete bacterium through the feces daily. Usually, these animals have no obvious clinical symptoms; therefore, it can be important as the public health.²² Ruminants such as buffalo up to 10 weeks and horses up to fourteen months can excrete bacteria to environment. This long period excretion leads to the contamination of the environment and the creation of new hosts.²² Therefore, in salmonellosis, asymptomatic carriers are more important than infected animals with clinical symptoms. Prompt diagnosis and subsequent appropriate treatment of carriers are very important in preventing the further spread of salmonellosis and its risk.²³ There are various methods for diagnosing Salmonella including microbial culture and using various biochemical tests, immunological and serological methods as well as the detection of nucleic acid of Salmonella in suspected sample.²⁴ Long-standing methods of diagnosing Salmonella in feces or food are slow and time consuming.²⁵ However, the polymerase chain reaction method is a sensitive and specific method that relies on an effective gene present in all Salmonella strains and specific to this genus such as the InvA gene, effective in attacking and invading Salmonella. In recent years, promising results have been shown in the diagnosis of salmonella in cattle, dogs and horses.²⁶

In the present study, Salmonella species were isolated at the same from from buffaloes. On the contrary, higher infection rate was reported in buffaloes (5.70%) than in cows (5.00%) in another study in Egypt.²⁷ Much higher percentage (22.50%) of Salmonella isolation was reported in cows in another study in USA.¹⁹ Regarding the infection in buffaloes, much higher percentage (2.16%) was reported in another study in Egypt.²⁸ S. enteritidis was the prevalent species among cows and S. typhimurium was the prevalent species among buffaloes. Conversely, other investigators reported that nearly similar serovars of Salmonella were recovered from both cows and buffaloes.²⁹ The variation in the reported Salmonella species in cows and buffaloes in different studies might be due to the difference in the prevalent species in the studied area.

Regarding the recovery of S. enteritidis from healthy buffaloes in this study, it is well-documented that animals may act as carriers of Salmonella species and the herd carrier status is positively correlated to the herd size.³⁰ The inability to isolate Salmonella from buffaloes with diarrhea might be attributed to infection of buffaloes by another enteric microorganism rather than Salmonella or because of the intermittent shedding of Salmonella in the feces of animals. Contrary to this finding, the higher Salmonella infection rate was recovered from diarrheic cows (7.69%) compared to apparently healthy cows (0.97%).³¹ The differences in the isolation rates reported in different studies might be due to differences in the ecological conditions, type of samples and/or culture methods.³²

The InvA gene encodes Salmonella's inner membrane proteins to invade host intestinal epithelial cells. Sequences of this gene are present in all species of Salmonella and are also specific to this genus and do not exist in other bacteria.³³ Rahn et al. were able to identify an intrinsic component of the InvA gene that play key roll to Salmonella invasion in cell culture. This method is completely economical and is specific in the diagnosis of Salmonella and other bacteria.³⁴ According to previous studies, excretion of Salmonella through feces is the most common way of contaminating the environment, water and food, and probably the most appropriate approach to confirm Salmonella infection in live animals is stool sampleing.^{7,11,15,18,35} The presence of Salmonella has been studied in meat, urine, blood and water samples.³⁶ Contamination of meat, urine, blood and other tissues as well as water and the environment can lead to environmental contamination and generalization of bacteria in the body (septicemia and bacteremia).³⁶

However, considering the main place of bacteria in the body, it could be claimed that to confirm the presence of Salmonella, none of these samples are as important as feces, and feces is the main cause of environmental and animals’ contamination.³⁷ Time is the important factor in the diagnosis and treatment of Salmonellosis. The advantage of PCR method, in addition to being specific, is the high speed of this method in diagnosing Salmonella in different samples such as urine, blood, milk, feces, meat and other body tissues as well as water.³⁸ This method is able to detect the lowest number of Salmonella per gram of sample. PCR is a reliable, sensitive and effective method for detecting the InvA gene in Salmonella species.³⁹ In 2010, Ahmadi et al. used the InvA gene and the primers to detect Salmonella in bovine and buffalo feces. They also used the same primers in 2009 to diagnose Salmonella in feces.¹ In 2011, the prevalence of Salmonella in German shepherd dogs in Garmsar, Semnan province, was determined using the mentioned genes and primers.³⁸ In 2003, Malorny et al. used a variety of primers (P1 / P2, S18 / S19, ST11 / ST15, and S139 / S141) to detect Salmonella in fecal samples.³⁵ They found S139 and S141 primers more suitable than the others. However, detecting Salmonella with traditional methods such as microbial culture requires repeated sampling and a long time for different cultures and specific media. Sometimes there may be specimens containing large amounts of dead mass that the presence of Salmonella in these specimens cannot be detected by microbial culture. However, using PCR method, these samples can also be examined for the presence of Salmonella. Various studies have been performed comparing culture and PCR methods in the diagnosis of salmonellosis. In 2001, Feder et al. showed that the accuracy of PCR in the detection of Salmonella in water was 80.00%. In the same study, however, the culture method detected only 44.00% of Salmonella- contaminated water samples.⁴⁰ In a study by Chaudhary et al., out of 37 Salmonella isolates, all isolates contained virulence genes (FimA, Stn, InvA). In another study by Kadry et al., 8 Salmonella isolates contained the InvA gene.^41,42 Also in a study, phylogenetic analysis showed that Salmonella isolated in humans and eggs were the same. Cohen et al. showed similar results in Salmonella enteritidis from equine feces.⁴³ High sensitivity and specificity of PCR method in the study of Pusterla et al. were reported 100% and 98.00%⁴⁴ and in the study of Gentry-Weeks et al. 80.00% and 98.60%, respectively.⁴⁵ Shanmugasamy et al. also mentioned the sensitivity and specificity of this method for the diagnosis of Salmonella as 99.60% and 100%, respectively.⁴⁶

However, Salehi et al. noted that PCR and the InvA gene could not be used to detect a specific serotype of Salmonella.⁴⁷ Cohen et al. in their studies in 1995 and 1996 were able to detect Salmonella in a stool sample for 24 hr using PCR.^43,48 However, the use of culture method requires much more time and also its accuracy and specificity are less than PCR method. It is important and essential to enrich the samples before direct DNA extraction by PCR. In the present study, the samples were incubated in Selenite-F Broth at 37.00 ˚C for 18 hr. This method, while being cheap, leads to an increase in the number of living bacteria and also prevents the growth of other organisms. In West Azerbaijan province, buffalo is one of the most important domestic livestock in villages and even industrial and semi-industrial farms. Milk, meat, wool and other by- products of this animal are used in this province. Contamination of this animal with Salmonella leads to the spread of infection in urban and rural communities as well as livestock herds.¹

Therefore, considering the importance of this livestock in this province and other provinces makes it necessary to study the prevalence of salmonellosis and rapid diagnosis and subsequent appropriate treatment of carriers. In the present study, samples were taken from different regions of the province to determine the prevalence of salmonellosis in the province to some extent, which according to the results of the pattern of Salmonella prevalence in different parts was almost the same. In the same study conducted by Ahmadi et al., the rate of salmonellosis in buffaloes in Urmia was reported to be 3.00%.¹ Meanwhile, in the present study, this rate was 28.00% in the same city and 11.90% in the total of three cities being sampled.¹ This is an important figure in the province and requires more attention to prompt and appropriate treatment of salmonellosis. Shekarforoush et al. Reported contamination of buffalo milk with Salmonella is 7.00% in Ahvaz city, Khuzestan province.⁴⁹ Also, in a study on slaughtered chickens in Mashhad city by Afshari-Nic et al., the Salmonella positive samples were 11.90%.⁵⁰ Therefore, due to the long cold season in West Azerbaijan province, the growth and distribution of Salmonella should be less than other regions. In the results of our study, this issue was quite obvious and the number of positive samples taken in the warm seasons was much more than the cold seasons of the year. Due to this issue, it is recommended to study the prevalence of Salmonella in different provinces of Iran.

The results of this study showed that, buffaloes, like other ruminants and other domestic animals, can carry Salmonella and excrete it in the feces. The rate of Salmonella contamination was 16.00%. Due to role of this animal and its products in human societies, the transmission of Salmonella from buffalo to humans is important. In general, the presence of carriers in livestock populations should be taken into consideration seriously because the issue of public health and prevention of further outbreaks of the disease is directly related to carriers. Therefore, rapid and appropriate diagnosis, isolation and treatment of carriers seems absolutely necessary.

Conflict of interest

The authors declare that they have no competing interests.