Abstract
Wheat leaf rust is caused by the fungal pathogen Puccinia triticina and is one of the wheat diseases of concern globally. Among the known leaf rust resistance genes (Lr) genes, Lr32 is a broadly effective gene derived from the diploid species Aegilops tauschii coss. accession RL5497-1 and has been genetically mapped to chromosome arm 3DS. However, Lr32 resistance has not been utilized in current cultivars in part due to the lack of modern, predictive DNA markers. The goals of this study were to fine map the Lr32 region and develop SNP-based kompetitive allele-specific polymerase chain reaction markers. The genomic analysis was conducted by using doubled haploid and F2-derived mapping populations. For marker development, a 90K wheat chip array, 35K and 820K Axiom R SNPs, A. tauschii pseudomolecules v4.0 and International Wheat Genome Sequencing Consortium ReqSeq v2.1 reference genomes were used. Total 28 kompetitive allele-specific polymerase chain reaction and 2 simple sequence repeat markers were developed. The Lr32 region was fine mapped between kompetitive allele-specific polymerase chain reaction markers Kwh142 and Kwh355 that flanked 34–35 Mb of the diploid and hexaploid reference genomes. Leaf rust resistance mapped as a Mendelian trait that cosegregated with 20 markers, recombination restriction limited the further resolution of the Lr32 region. A total of 10–11 candidate genes associated with disease resistance were identified between the flanking regions on both reference genomes, with the majority belonging to the nucleotide-binding domain and leucine-rich repeat gene family. The validation analysis selected 2 kompetitive allele-specific polymerase chain reaction markers, Kwh147 and Kwh722, for marker-assisted selection. The presence of Lr32 along with other Lr genes such as Lr67 and Lr34 would increase the resistance in future wheat breeding lines and have a high impact on controlling wheat leaf rust.
Keywords: Lr32, leaf rust, wheat, Plant Genetics and Genomics
Introduction
Leaf rust is the most common and widely occurring wheat rust disease (Triticum aestivum L. 2n = 6x = 42, AABBDD) and is caused by a biotrophic fungal pathogen Puccinia triticina Eriks (Pt) (Bolton et al. 2008). There are presently 79 leaf rust resistance (Lr) genes that have been identified (McIntosh et al. 2019). Among 3 wheat genomes, the D genome progenitor Aegilops tauschii coss. (2n = 2x = 14, DD genome) is known to be a great resource of rust resistance genes compared with other 2 progenitors T. urartu Tumanian ex Gandylian (2n = 2x = 14, AA) and a close relative of Aegilops speltoides ssp. lingustica Tausch (2n = 2x = 14, SS) (see Faris 2014 for review). To date, 5 Lr genes have been transferred to bread wheat from the A. tauschii: Lr21/Lr40 (1DS), Lr22a (2DS), Lr32 (3DS), Lr39/Lr41 (2DS), and Lr42 (1DS) (Dyck and Kerber 1970; Rowland and Kerber 1974; Kerber 1987; Cox et al. 1994).
Plant disease resistance genes have been classified into race-specific and nonrace-specific groups. The race-specific resistance follows the gene-for-gene model described by Flor (1955) that states that for each resistance (R) gene in the plant there will be a corresponding avirulence (AVR) gene in the pathogen. Some of the nonrace-specific resistance type genes are effective against many pathogens and were reported to be associated with a variety of genes encoding receptor kinases, transcription factors, membrane proteins, Kinase-START, and ATP-binding cassette (ABC) transporters (Singh et al. 2015). Many of the race-specific R genes in wheat were associated with the nucleotide-binding domain and leucine-rich repeat (NLR) gene family. To date, only 7 Lr genes have been cloned Lr1 (Cloutier et al. 2007), Lr10 (Feuillet et al. 2003), Lr21 (Huang et al. 2003), Lr22a (Thind et al. 2017), Lr34/Yr18/Sr57/Pm38 (Krattinger et al. 2009), Lr67/Yr46/Sr55/Pm46 (Moore et al. 2015), and Lr14a (Kolodziej et al. 2021). Out of which, race-specific leaf rust genes Lr1, Lr10, and Lr21 belong to the NLR gene family. Lr14a was sequenced and was found to belong to ankyrin (ANK) transmembrane-like gene family, which is a first in wheat (Kolodziej et al. 2021). Genes conditioning race-specific resistance tend to lose their effectiveness as the pathogen population evolves virulence. For example, the P. triticina population in Canada has evolved virulence to Lr1, Lr2a, Lr10, Lr12, Lr13, Lr14a, and Lr21 which were all used in Canadian wheat cultivars to control leaf rust (McCallum et al. 2016). In contrast durable, race nonspecific, slow-rusting leaf rust resistance genes Lr34, Lr46, and Lr67 have proved to be long-lasting and are able to confer resistance against multiple pathogens and races (Singh et al. 1998; Krattinger et al. 2009; Moore et al. 2015; McCallum et al. 2016). High levels of durable leaf rust resistance have been achieved by combining race-specific and race-nonspecific resistance genes in the same cultivar, such as the Canadian cultivar Carberry with Lr2a, Lr16, Lr23, Lr34, and Lr46 (Bokore et al. 2022). Consequently, new gene combinations need to be introduced in the wheat cultivars to achieve the durable resistance and decrease the selection pressure on Pt populations for virulence against R genes. For combining multiple R genes, the availability of gene-based and functional molecular makers is ideal. Within the last few years, high-throughput genetic analysis has become more advanced with the development of single nucleotide polymorphism (SNP) chips (Wang et al. 2014; Allen et al. 2017) and the availability of reference genome resources (Luo et al. 2017; Maccaferri et al. 2019; Zhu et al. 2019) which has led to better markers for a higher number of genes and resources needed for gene cloning experiments.
Among the broadly effective leaf rust resistance genes (Lr21, Lr22a, Lr32, Lr52, and Lr60) identified at the Morden Research and Development Centre, AAFC, Morden (and the former Cereal Research Centre, Winnipeg): Lr32, Lr52, and Lr60 have not been deployed in Canadian commercial cultivars (Thomas et al. 2010) and Lr22a has been deployed in 3 cultivars (AC Minto, 5500HR, and 5600HR) that occupied minimal acreage (Hiebert et al. 2007). The seedling leaf rust resistance gene Lr32 was discovered in A. tauschii coss. (accession number RL5497-1) and was mapped using simple sequence repeat (SSR) markers on chromosome arm 3DS. It was physically located in deletion bin 6 (3DS6–0.55–1.00) which spans ∼75 cM of genetic distance (Kerber 1987, 1988; Sourdille et al. 2004; Thomas et al. 2010). The SSR map was not dense, and while some SSRs were very closely linked to Lr32, markers that reliably flanked the gene had large genetic distances to Lr32. Hence, the objectives of this study were: (1) to develop the new kompetitive allele-specific polymerase chain reaction (PCR) (KASP) markers for Lr32 suitable for marker-assisted selection (MAS) and (2) fine map the Lr32 region.
Materials and methods
Plant material
Wheat line BW196 (=Katepwa*6//RL5713/2*MarquisK) was found to be heterogeneous for Lr32 based on phenotype and molecular marker data (Thomas et al. 2010). Therefore, for the development of mapping populations, a single resistant reselection (BW196R) was used as a resistance parent as explained in Thomas et al. (2010). A double haploid (DH) population (n = 244), an initial F2 (n = 196) population, and an expanded large F2 (n ≈ 2,000) population were developed from a cross between the susceptible parent Thatcher and the resistant line BW196R. The initial, smaller F2 population and the expanded F2 population were generated from the same cross, but there was no overlap in individuals between the 2 populations. The F3 families were developed from the large F2 population lines based on markers flanking the Lr32 region (recombinants were selected, detailed description in the Genotyping section). From these recombinant F3 progenies, fixed recombinant lines were selected based on the marker genotypes. The DH population was developed using the maize pollination method as described by Thomas et al. (1997). For the validation of the newly developed MAS markers, a panel of 32 wheat lines was used which consisted of material ranging from F1 progeny to advanced generations (with Lr32 plus additional Lr genes), Lr32-lacking susceptible check Neepawa, and an Lr32 carrier (BW196R).
Leaf rust testing
The leaf rust phenotyping of the parents, Thatcher and BW196R, DH population, F2 population, F3 progenies from the initial F2 population, and fixed recombinants derived from expanded F2 population was done with the urediospores of Pt race 12-3 MBDS at the seedling stage following the method described by McCallum and Seto-Goh (2003). Briefly, the plants were inoculated at the first leaf stage (∼7 day old) with urediospores of Lr32 avirulent Pt race 12-3 MBDS suspended in light mineral oil (McCallum et al. 2021). After inoculation plants were kept in humidity-maintained chambers for 16 h at 18–20°C and subsequently transferred to the greenhouse which was kept at 20 ± 2°C. After 12–14 days plants were scored in the scale of 0–4 (0, 1, 2, 3, 4) where 0–2 were considered resistant and 3–4 considered susceptible, the symbols “+” and “−” were used to note pustule sizes that were larger or smaller than typically observed for a given infection type (McCallum et al. 2021).
Genotyping and marker development
The DNA extraction of parents and mapping populations (DH, F2, and fixed recombinants) was done using a modified ammonium acetate method (Pallota et al. 2003). The DH population was genotyped using 90K iSelect SNP array (Wang et al. 2014) and 8 SSR markers, barc128, barc135, barc376, cfd34, gwm2, gwm183, wmc43, and wmc539 reported in the Thomas et al. (2010). A linkage map was constructed using the software MapDisto 1.8.2 (Lorieux 2012) and genetic distances were calculated using the Kosambi mapping function (Kosambi 1943). After locating the Lr32 region on the linkage map, the associated SNPs were converted into KASP markers (Tables 1 and 2). Total 17 KASP were developed from the 90K SNP array and genotyping was done according to the procedure described in Kassa et al. (2016). One SSR marker Swh28 was developed from the A. tauschii pseudomolecules v4.0 gene-based region by using the software package Batchprimer3 (You et al. 2008) (Table 3). In addition, FASTA sequences of NBS-LRR gene regions from International Wheat Genome Sequencing Consortium (IWGSC) ReqSeq v1.0 were also used to develop the SSR markers, and out of which Swh45 is polymorphic between parents (Table 3). The F2 population (n = 196) was genotyped with the 12 KASP developed in the DH population and 3 SSR markers barc135, Swh28, and Swh45. After that, codominant flanking DNA markers were selected and these markers were used for the screening of ∼2,000 F2 individuals to identify plants with a recombination event within the interval carrying Lr32. F3 progeny (minimum 16 progenies/family) from each recombinant F2 plant was tested with the flanking markers to select progeny fixed for recombination events and were genotyped with the remaining KASP markers.
Table 1.
Lr32 region-associated kompetitive allele-specific (KASP) PCR markers source, SNP name, primer sequence information.
| Marker name | SNP name/gene ID | Primer name | Primer A1 (5ʹ–3ʹ)a | Inheritance |
|---|---|---|---|---|
| Kwh142 | RFL_Contig2471_119 | kwh142-A1 | {Tail-1}GGGTCGAACACGTTGCTCCG | Codominant |
| kwh142-A2 | {Tail-2}GGGTCGAACACGTTGCTCCA | |||
| kwh142-C | CGAGCGCACAAGCCGAAGCAAT | |||
| Kwh147 | RAC875_c59977_246 | kwh147-A1 | {Tail-1}AAGCAACACAGATCTCCACCTCA | Codominant |
| kwh147-A2 | {Tail-2}AGCAACACAGATCTCCACCTCG | |||
| kwh147-C | GGTCGGTGTTGCCTCCTCGGT | |||
| Kwh148 | BobWhite_c16071_165 | kwh148-A1 | {Tail-1}AACGCCAAGATCGAAGCGTATTAC | Codominant |
| kwh148-A2 | {Tail-2}GAACGCCAAGATCGAAGCGTATTAT | |||
| kwh148-C | TCCAGTCCAGTACCGGTCTCGT | |||
| Kwh149 | D_contig34048_162 | kwh149-A1 | {Tail-1}ATTCCACATTGTGGCTTTCCAACCT | Codominant |
| kwh149-A2 | {Tail-2}CCACATTGTGGCTTTCCAACCC | |||
| kwh149-C | TCGAATACGATGACCCTGATGCCAT | |||
| Kwh152 | D_GDRF1KQ02F7Y6F_336 | kwh152-A1 | {Tail-1}CCTGTCGCACCGCAGCCAT | Codominant |
| kwh152-A2 | {Tail-2}CTGTCGCACCGCAGCCAC | |||
| kwh152-C | CCATTGTTTGATCTCTTTTTGCAGCGTT | |||
| Kwh340 | BS00093856_51 | kwh340-A1 | {Tail-1}GTTGAGTGGTATGCCGCCGC | Codominant |
| kwh340-A2 | {Tail-2}GGTTGAGTGGTATGCCGCCGT | |||
| kwh340-C | CATTTCTGTGGTGCGGCTGTGCAT | |||
| Kwh342 | D_contig09222_937 | kwh342-A1 | {Tail-1}CTTTCTGAATGTTACAAAGTATTTACATGTTA | Codominant |
| kwh342-A2 | {Tail-2}CTTTCTGAATGTTACAAAGTATTTACATGTTG | |||
| kwh342-C | GCTCAACCCTCAGCTGAAGCTGAA | |||
| Kwh343 | D_contig17344_388 | kwh343-A1 | {Tail-1}CAAACTGTTCGATGCTATGAATTTAGTG | Codominant |
| kwh343-A2 | {Tail-2}ATCAAACTGTTCGATGCTATGAATTTAGTA | |||
| kwh343-C | TGCAAAATTAACCCGCAAAACTCACGAT | |||
| Kwh345 | D_F5XZDLF01EIBB2_65 | kwh345-A1 | {Tail-1}GAGTTTAAAACAAGAACAGAGCAACAAA | Codominant |
| kwh345-A2 | {Tail-2}GAGTTTAAAACAAGAACAGAGCAACAAC | |||
| kwh345-C | GACAACATCACTCATGCAGTACTCCTT | |||
| Kwh346 | D_F5XZDLF02HWOJZ_227 | kwh346-A1 | {Tail-1}AACAGCAAGCTTTCTCTGGTCACAA | Codominant |
| kwh346-A2 | {Tail-2}CAGCAAGCTTTCTCTGGTCACAG | |||
| kwh346-C | GAAATATATGGATCAACTGCGAGCACTTT | |||
| Kwh349 | Excalibur_c11594_181 | kwh349-A1 | {Tail-1}GGCCCTGCCTATCCAACAAGAA | Codominant |
| kwh349-A2 | {Tail-2}GCCCTGCCTATCCAACAAGAG | |||
| kwh349-C | CCCACAGGAAAAAGTAAATCCAACGTATT | |||
| Kwh353 | Kukri_c28730_207 | kwh353-A1 | {Tail-1}TGCTCAACGGATGATCGCACAT | Codominant |
| kwh353-A2 | {Tail-2}GCTCAACGGATGATCGCACAC | |||
| kwh353-C | GCAGCTCTCTCTGTTGGATCYTCAA | |||
| Kwh355 | Kukri_c80364_374 | kwh355-A1 | {Tail-1}GTGTGTTGTCCAATTGCTGGTTGT | Codominant |
| kwh355-A2 | {Tail-2}GTGTTGTCCAATTGCTGGTTGC | |||
| kwh355-C | CTGTAGTGGTCTTCAAAGTCCTCCAA | |||
| Kwh357 | RAC875_c10628_1037 | kwh357-A1 | {Tail-1}GCCTGTTACTGCTGCCAAGACT | Codominant |
| kwh357-A2 | {Tail-2}CCTGTTACTGCTGCCAAGACG | |||
| kwh357-C | GCTCACCATTATCAGGTAGCCTTCAT | |||
| Kwh360 | RAC875_rep_c110663_1499 | kwh360-A1 | {Tail-1}ATCCCTTTACACCGTATGCTTTCG | Codominant |
| kwh360-A2 | {Tail-2}ATATCCCTTTACACCGTATGCTTTCA | |||
| kwh360-C | ATCCTCTCCGAAACATTTCTTCATTGCTT | |||
| Kwh362 | wsnp_Ex_c1602_3055066 | kwh362-A1 | {Tail-1}CAAACATGACTATGGCACGATAGAC | Codominant |
| kwh362-A2 | {Tail-2}CCAAACATGACTATGGCACGATAGAA | |||
| kwh362-C | GAACTGTGATATACTTTCCGTATCAGCAA | |||
| Kwh364 | BobWhite_c17617_133 | kwh364-A1 | {Tail-1}ACCAACGAGGAAACCATCGACG | Codominant |
| kwh364-A2 | {Tail-2}CACCAACGAGGAAACCATCGACA | |||
| kwh364-C | AGTTGGCCGCGCAGCCCGA | |||
| Kwh489 | BS00070468 | kwh489-A1 | {Tail-1}CCTTGTGGACAATTTCCTCTTTTGG | Dominant |
| kwh489-A2 | {Tail-2}CCCTTGTGGACAATTTCCTCTTTTGA | |||
| kwh489-C | CGTTGATTATTCAACAGCAGATGGGATTT | |||
| Kwh491 | BS00072718 | kwh491-A1 | {Tail-1}CCTTGTGGACAATTTCCTCTTTTGG | Dominant |
| kwh491-A2 | {Tail-2}CCCTTGTGGACAATTTCCTCTTTTGA | |||
| kwh491-C | CGTTGATTATTCAACAGCAGATGGGATTT | |||
| Kwh605 | BA00271713 | kwh605-A1 | {Tail-1}CACCAGAGTCATAATTTAAGTTGGAG | Codominant |
| kwh605-A2 | {Tail-2}CCACCAGAGTCATAATTTAAGTTGGAA | |||
| kwh605-C | CCTCAGAAAATGCACCTGGCAGTA | |||
| Kwh617 | BA00169625 | kwh617-A1 | {Tail-1}AGGCAAATGATACAGGTGCAGCT | Codominant |
| kwh617-A2 | {Tail-2}GGCAAATGATACAGGTGCAGCC | |||
| kwh617-C | CATTCCTCAGTTCTTGTTCTTGCAG | |||
| Kwh628 | BA00575742 | kwh628-A1 | {Tail-1}CGGGACGAGACTTGAGGAACC | Codominant |
| kwh628-A2 | {Tail-2}CGGGACGAGACTTGAGGAACT | |||
| kwh628-C | ACGTGGAGTATCTCCGCCGGA | |||
| Kwh645 | >AET3Gv20190400.18 | kwh645-A1 | {Tail-1}GCACAGAACAACTTGACTGGGC | Codominant |
| kwh645-A2 | {Tail-2}GGCACAGAACAACTTGACTGGGT | |||
| kwh645-C | CACCGACAGCAATGTCAAATTTTGTAGAA | |||
| Kwh646 | >AET3Gv20190400.18 | kwh646-A1 | {Tail-1}CAGGGTCACTCATGCTACTAGTG | Codominant |
| kwh646-A2 | {Tail-2}AACAGGGTCACTCATGCTACTAGTT | |||
| kwh646-C | CTTTGAGCTTCCTGTGGAGTAACCAA | |||
| Kwh662 | >AET3Gv20200600.2 | kwh662-A1 | {Tail-1}GCGTGCGAGATCGGCGTC | Codominant |
| kwh662-A2 | {Tail-2}GCGTGCGAGATCGGCGTG | |||
| kwh662-C | GCACGATGTTGCGGTGGCGCA | |||
| Kwh721 | BA00024318 | kwh721-A1 | {Tail-1}CGTCTGTAGAATACAAGGTTCTC | Dominant |
| kwh721-A2 | {Tail-2}CTCGTCTGTAGAATACAAGGTTCTG | |||
| kwh721-C | CCTCCACATGTGTGTTACAAAATTACAAAT | |||
| Kwh722 | BA00186143 | kwh722-A1 | {Tail-1}ACCATGGATCCTACCAAAGAGGA | Codominant |
| kwh722-A2 | {Tail-2}CCATGGATCCTACCAAAGAGGG | |||
| kwh722-C | GCGGCTATTGTTCGACAACTGCTAA | |||
| Kwh727 | BA00078867 | kwh727-A1 | {Tail-1}CTTCCCCTTCCTTTCTGTTT | Dominant |
| kwh727-A2 | {Tail-2}GCTCTTCCCCTTCCTTTCTGTTC | |||
| kwh727-C | CAGAGGTGTGTATGTGGTGATGGAT |
Tail-1 (FAM tail-GAAGGTGACCAAGTTCATGCT), Tail-2 (VIC tail-GAAGGTCGGAGTCAACGGATT)
Table 2.
Sequence information for the SSR markers developed from the Chinese spring RefSeq v2.1 and A. tauschii pseudomolecules v5.0.
| Marker name | Forward | Reverse |
|---|---|---|
| Swh28 | AGTCGTCCTGGCTTACGTGT | CGAAACGCACCTTGCTTTAT |
| Swh45 | AGCGGCTGTAGCTTTTGTTC | TGCATGAATGTTTGGTCCAG |
Table 3.
Coordinates of Kompetitive allele-specific (KASP) PCR and the SSR markers source sequences on the Chinese spring RefSeq v2.1 and A. tauschii pseudomolecules v5.0.
| Marker name | SNP name/gene ID | Source | IWGSC RefSeq v2.1 | Aegilops tauschii pseudomolecules v5.0 |
|---|---|---|---|---|
| Kwh142 | RFL_Contig2471_119 | 90K Wheat SNPa | 17416838–17416738 | 17822798–17822698 |
| Kwh489 | BS00070468 | CerealsDB-KASPb | 18794498–18794398 | 19599880–19599780 |
| Kwh491 | BS00072718 | CerealsDB-KASP | 18794498–18794398 | 19599880–19599780 |
| Kwh721 | BA00024318 | Axiom 35K and 820Kc | 19907918–19907818 | 20595051–20594951 |
| Kwh722 | BA00186143 | Axiom 35K and 820K | 19960762–19960862 | 20647473–20647573 |
| 20640902–20641002 | ||||
| 20656768–20656868 | ||||
| Kwh727 | BA00078867 | Axiom 35K and 820K | 21829292–21829390 | 23302561–23302659 |
| Kwh340 | BS00093856_51 | 90K Wheat SNP | 22049657–22049557 | 23435820–23435720 |
| Kwh149 | D_contig34048_162 | 90K Wheat SNP | 24039549–24039298 | 25780968–25781219 |
| 26231058–26230808 | ||||
| Swh28 | Aegilops tauschii pseudomolecules v5.0 | — | 27076467–27076484 | |
| gene region | ||||
| Swh45 | IWGSC RefSeq_NB-LRR region | 26290206–26294113 | — | |
| Kwh147 | RAC875_c59977_246 | 90K Wheat SNP | 28724554–28724454 | 30772352–30772252 |
| 30783260–30783160 | ||||
| Kwh346 | D_F5XZDLF02HWOJZ_227 | 90K Wheat SNP | 31777459–31777708 | 34568768–34569017 |
| Kwh360 | RAC875_rep_c110663_1499 | 90K Wheat SNP | 32277430–32277331 | — |
| Kwh364 | BobWhite_c17617_133 | 90K Wheat SNP | 33167119–33167035 | 36372653–36372569 |
| Kwh357 | RAC875_c10628_1037 | 90K Wheat SNP | 36693579–36693479 | 38119477–38119377 |
| Kwh148 | BobWhite_c16071_165 | 90K Wheat SNP | 36693749–36693849 | 38119647–38119747 |
| Kwh342 | D_contig09222_937 | 90K Wheat SNP | 37167341–37167092 | 38613914–38613665 |
| Kwh349 | Excalibur_c11594_181 | 90K Wheat SNP | 37846513–37846613 | 39264726–39264823 |
| Kwh345 | D_F5XZDLF01EIBB2_65 | 90K Wheat SNP | 39445515–39445330 | 40921768–40921582 |
| Kwh353 | Kukri_c28730_207 | 90K Wheat SNP | 43918204–43918108 | 45744256–45744160 |
| Kwh605 | BA00271713 | Axiom 35K and 820K | 44114802–44114732 | 46068489–46068419 |
| Kwh645 | >AET3Gv20190400.18 | Aegilops tauschii pseudomolecules v4.0d | 45121378–45121531 | 47128503–47128656 |
| Kwh646 | >AET3Gv20190400.18 | Aegilops tauschii pseudomolecules v4.0 | 45121532–45121779 | 47128657–47128904 |
| Kwh617 | BA00169625 | Axiom 35K and 820K | 45122722–45122652 | 47129847–47129777 |
| Kwh362 | wsnp_Ex_c1602_3055066 | 90K Wheat SNP | — | 480327588–480327388 |
| Kwh628 | BA00575742 | Axiom 35K and 820K | 46020254–46020324 | 49080031–49080101 |
| Kwh662 | >AET3Gv20200600.2 | Aegilops tauschii pseudomolecules v4.0 | 46675509–46675694 | 49760125–49760310 |
| Kwh152 | D_GDRF1KQ02F7Y6F_336 | 90K Wheat SNP | 47438552–47438794 | 50412774–50413021 |
| Kwh343 | D_contig17344_388 | 90K Wheat SNP | 47742563–47742314 | 50841817–50841568 |
| Kwh355 | Kukri_c80364_374 | 90K Wheat SNP | 47743405–47743326 | 50842656–50842580 |
No hit.
To increase the resolution of the Lr32 spanning genetic region, an additional 11 KASP markers were developed or selected from the CerealsDB database, 35K and 820K Axiom R SNPs, and A. tauschii (accession AL8/78) pseudomolecules v4.0 (Tables 1 and 2). First, the flanking KASP markers source sequences were aligned against the IWGSC ReqSeq v1.0 via using the basic local alignment search tool (BLAST) (Altschul et al. 1997) and the Jbrowse portal was used to explore the region. Within that region, 2 SNPs (BS00070468 and BS00072718) were selected and associated KASP markers Kwh489 and Kwh491 (Tables 1 and 2) were used for genotyping the fixed recombinant lines (CerealsDB database; Wilkinson et al. 2012). Within that region, additional 35K and 820K Axiom R SNPs were also selected to develop KASP markers (Allen et al. 2017). Total 6 KASP markers, Kwh605, Kwh617, Kwh628, Kwh721. Kwh722, and Kwh727, were developed from the Axiom SNPs and used to genotype the fixed recombinants (Tables 1 and 2). Moreover, the flanking KASP markers source sequences were also used to select the A. tauschii (accession AL8/78) pseudomolecules v4.0 (Luo et al. 2017) gene regions. Out of which, LRR motif-containing gene regions were selected and BLASTed against the IWGSC RefSeq v1.0 assembly. After aligning the FASTA sequence from both assemblies, SNPs were identified and 3 KASP markers, Kwh645, Kwh646, and Kwh662, were manually developed by using the Primer3 software package (Ye et al. 2012). The source sequences of KASP and SSR markers were used to determine the physical coordinates on the A. tauschii pseudomolecules v4.0 and IWGSC ReqSeq v2.1. The mode of inheritance (dominant/codominant) of the markers developed in the current study was determined on the F2 population. To validate these markers a genetic analysis was conducted with F1 and prebreeding germplasm carrying Lr32 (Supplementary Table 1). The Aet_v4.0 and IWGSC ReqSeq v2.1 reference genomes data were used to extract the disease resistance candidate genes between flanking markers Kwh142 and Kwh355.
Results
The leaf rust screening showed that the susceptible parent Thatcher had IT 3 and the resistant parental line BW196R had IT 1− (Fig. 1). The DH population phenotypic ratio fitted that expected for a single gene (109R:134S; χ2 = 2.25, P = 0.11). The initial F2:3 population had 51 resistant (HR), 96 segregating (hetero), and 49 susceptible (HS) families which also fitted a single gene ratio (χ2 = 0.12, P = 0.94). The DH and F2:3 population IT scores ranged between 1− and 3 (HR = 1−/12/12, hetero = 2− to 3−, HS = 3/3+) (Supplementary Files 1 and 2). Linkage mapping in the DH population using 90K SNP markers and SSR markers developed for the Lr32 region resulted in a genetic map of chromosome arm 3DS that spanned 37.4 cM and consisted of 39 SNP and 8 SSR markers (Fig. 2 and Supplementary Files 1 and 2). Lr32 was mapped at position 17.8 cM and cosegregated with SSRs wmc43 and barc135. In addition, a total of 24 SNP markers cosegregated with Lr32 (Supplementary Files 1 and 2). This region was flanked by SNPs IWB32645 and IWB18374 (Fig. 2). Genetic analysis conducted on the F2 population with 12 KASP and 3 SSR markers developed a chromosome arm 3DS linkage map of 6.73 cM (Fig. 2).
Fig. 1.

Seedling stage leaf rust infection type (IT) on the Lr32 DH mapping populations parents Thatcher (IT = 3) and BW196R (IT =; 1−) 14th day postinoculation of the Pt race MBDS.
Fig. 2.
a) The chromosome 3DS deletion Bin6. b) The SSR markers based chromosome arm 3DS linkage map spanning Lr32 developed in the DH population (Thomas et al. 2010). c) The Lr32 associated chromosome arm 3DS 90K SNP’s linkage map developed in the Thatcher × BW196R DH population. d) The 3DS linkage map developed in the Thatcher × BW196R F2 population (n = 196) by using 12 KASP and 3 SSR markers. Common SSR markers between 3DS map developed by Thomas et al. (2010) and current study were shown in Blue fonts and KASP markers developed from the 90K SNPs were represented with the green fonts.
The KASP markers Kwh142 and Kwh355 positioned at 14.5 and 22.1 cM on the chromosome 3DS DH linkage map were selected as the flanking markers and used for screening the ∼2,000 F2 progenies (Fig. 2). Selected F2 progeny were used to generate F3 progeny. Based on genotypic and phenotypic screening of these F3 progenies, 106 fixed recombinants (i.e. both homologs carried the same recombination event between the flanking markers with no heterozygous alleles for the flanking markers) were identified (Fig. 3). Further genetic analysis was done on these 106 fixed recombinants with the remaining 26 KASP and 2 SSR markers were developed from 90K SNP chip, Axiom SNPs, A. tauschii gene-based regions and CerealsDB database (Fig. 3 and Tables 1 and 2). The overall genomic analysis conducted on the fixed recombinants fine-mapped Lr32 to a region spanning 2.57 cM between the flanking markers. In the fine mapping population, a total of 18 KASP and 2 SSR markers cosegregated with Lr32 and were flanked by KASP markers Kwh 722 and Kwh 638 (Supplementary File 3). Mapping of KASP markers source sequences on reference genomes showed that the Lr32 region is collinear in both diploid and hexaploid genome assemblies. Total 11 and 10 candidate genes belonging to the gene’s classes typical of disease resistance genes were identified between the flanking markers Kwh142 and Kwh355 in the IWGSC RefSeq v2.1 and A. tauschii pseudomolecules v4.0. reference genomes, respectively (Table 4).
Fig. 3.
Collinearity of Lr32 high resolution genetic region-associated KASP markers (b) on the Aegilops tauschii (Aet v 5.0) (a) and 3DS Chinese spring reference (Refseq v2.1) genomes. The high-resolution mapping was done by using 106 fixed recombinants.
Table 4.
Candidate genes between flanking markers Kwh142 and Kwh355 identified in reference genome assemblies of A. tauschii pseudomolecules v4.0 and International Wheat Genome Sequencing Consortium (IWGSC) RefSeq v2.1.
| Gene list | Aegilops tauschii pseudomolecules v4.0 coordinates | IWGSC RefSeq v2.1 coordinates | Gene function |
|---|---|---|---|
| LOC109770626 | 371107079–371130152 | — | Leaf rust 10 disease resistance locus receptor-like PROTEIN KINASE-like 2.8% 2C transcript variant ×1 |
| LOC109770629 | 371186179–371191403 | — | Leaf rust 10 disease resistance locus receptor-like PROTEIN KINASE-like 2.7 |
| LOC109770630 | 371356207–371376463 | — | Leaf rust 10 disease resistance locus receptor-like PROTEIN KINASE-like 1.2% 2C transcript variant ×2 |
| LOC109786043 | 403287941–403288597 | — | Putative disease resistance protein RGA3 |
| LOC109786041 | 403289550–403292234 | — | Disease resistance protein RGA2 |
| LOC109786040 | 403294816–403296642 | — | Disease resistance protein RGA2 |
| LOC109757481 | 431756637–431759708 | — | Disease resistance protein RPM1-like |
| LOC109749583 | 439761646–439765270 | — | Disease resistance protein RPS2 |
| LOC109779823 | 442696038–442705114 | — | Disease resistance RPP13-like protein 4%2C transcript variant ×4 |
| LOC109779825 | 442700026–442701359 | — | Probable disease resistance protein At5g45440 |
| TraesCS3D03G0659400.1 | — | 396867186–396868224 | NBS–LRR-like resistance protein |
| TraesCS3D03G0659900.1 | — | 396875344–396875847 | Disease resistance protein RGA2 |
| TraesCS3D03G0683400.1 | — | 413254998–413257949 | Disease resistance protein (TIR–NBS class) |
| TraesCS3D03G0697900.1 | — | 421489316–421489550 | Disease resistance protein (TIR–NBS–LRR class) family |
| TraesCS3D03G0705600.1 | — | 425470383–425473025 | NBS–LRR disease resistance protein |
| TraesCS3D03G0721700.1 | — | 433489667–433492396 | CC–NBS–LRR family disease resistance protein |
| TraesCS3D03G0728800.1 | — | 436220239–436221414 | NBS–LRR disease resistance protein |
| TraesCS3D03G0728900.1 | — | 436222190–436223924 | Disease resistance protein |
| TraesCS3D03G0737800.1 | — | 440586174–440589527 | NBS–LRR resistance protein, putative |
| TraesCS3D03G0790700.1 | — | 469421914–469422111 | Disease resistance protein (TIR–NBS–LRR class) family |
| TraesCS3D03G0801200.1 | — | 476629268–476630671 | Nematode resistance protein-like HSPRO2 |
Discussion
The phenotyping results showed that the DH and initial F2 populations segregated for 1 gene. The collinearity of SSR and KASP markers in the DH and F2 mapping populations and their corresponding physical order on reference genomes demonstrate the marker order was robust (Figs. 1 and 3). In addition, large numbers of 90K SNP/KASP markers cosegregating with the Lr32 resistance phenotype in the 3 populations (DH, F2, and fixed recombinants) analyzed in the current study indicates that Lr32 region is associated with a linkage block with recombination restriction. Physical mapping of the SNP source sequences on the A. tauschii pseudomolecules v4.0 and IWGSC ReqSeq v2.1 reference genomes showed that the Lr32 region spanned about 34–36 Mb between the flanking markers Kwh142 and Kwh355, which clearly showed that the physical size of these segments is large (11–13 Mb/cM) (Fig. 3). The cosegregating markers with Lr32 phenotype represent 26–28 Mb on both reference genomes (Fig. 3). These results explained the limitation to further increase the resolution of the Lr32 region. In addition, it also indicates a lower recombination frequency associated with alien R genes. Among the candidate genes identified from the reference genomes, NLR is the most abundant one. Besides that Protein Kinase and RGA types genes were also identified. Both classes of NLR genes, Toll-interleukin receptor type (TIR) and N-terminal coiled-coil (CC) were identified. Whereas, to date only CC–NBS–LRR has been identified in wheat for disease resistance (reviewed in Md. Hatta et al. 2019).
The validation analysis done with the F1 and advanced prebreeding lines showed that the 2 KASP markers Kwh147 and Kwh722 are codominant and able to differentiate between plants carrying Lr32 in the heterozygous/homozygous states (Fig. 4). Marker Kwh340 also detects the presence of the Lr32-resistant allele; however, clusters are not well differentiated. These markers should be useful for the selection of Lr32 in wheat breeding programs. Pyramiding Lr32 with other effective genes such as adult–plant resistance genes Lr34, Lr46 or Lr67 should help to delay the evolution of Lr32 virulent P. triticina isolates. To date virulence to Lr32 has not been detected in Canada (McCallum et al. 2021), although there is a report for virulence in South Africa (Pretorius and Bender 2010). The absence of virulence to Lr32 in Canada may be due to the fact that this gene has not been deployed in a commercial wheat cultivar to drive evolution of virulence in the pathogen population. The resistance gene Lr67 was recently shown to have a significant interaction with Lr32 when the 2 genes were in combination in a population that segregated for these 2 genes in the Thatcher background (McCallum and Hiebert 2022). The interaction between Lr34 and Lr32 was not significant in a population that segregated for both these genes; however, lines with both genes were more resistant than lines with either-gene alone. Using the molecular markers developed in this study Lr32 can be successfully incorporated into wheat lines, such as Carberry with Lr34, Lr46, and other resistance genes, that already have a good base of genetic resistance (Bokore et al. 2022). Deploying Lr32 in isolation would likely lead to the evolution of virulence on Lr32 as was seen for Lr21, a similar resistance gene also derived from A. tauschii, both in the USA (Kolmer and Anderson 2011) and Canada (McCallum et al. 2017). In conclusion, the development of these new functional markers will accelerate integration of Lr32 into the breeding lines and will be helpful in MAS to develop the future wheat cultivars with durable resistance.
Fig. 4.

The validation analysis done on the F1 and advanced multigene lines with Lr32-region functional molecular markers Kwh 147 and Kwh 722.
Supplementary Material
Acknowledgments
The authors thank Mira Popovic, Ghassan Mardli, Tobi Malasiuk, and Elsa Reimer for technical assistance and Dr Wayne Xu and Zhen Yao for Bioinformatics support.
Funding
Funding was provided by the Western Grains Research Foundation, Manitoba Agriculture, Manitoba Crop Alliance, Agriculture and Agri-Food Canada and the Alberta Wheat Commission as part of the Genome Canada CTAG2 and 4DWheat projects.
Contributor Information
Jyoti Saini Sharma, Agriculture and Agri-Food Canada, Morden Research and Development Centre, Morden, MB R6M 1Y5, Canada.
Curt A McCartney, Department of Plant Sciences, University of Manitoba, Winnipeg, MB R3T 2N2, Canada.
Brent D McCallum, Agriculture and Agri-Food Canada, Morden Research and Development Centre, Morden, MB R6M 1Y5, Canada.
Colin W Hiebert, Agriculture and Agri-Food Canada, Morden Research and Development Centre, Morden, MB R6M 1Y5, Canada.
Data Availability
Seed is available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables. Genotypic and phenotypic data available in supplementary files.
Supplemental material is available at G3 online.
Literature cited
- Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ.. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25(17):3389–3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Allen AM, Winfield MO, Burridge AJ, Downie RC, Benbow HR, Barker GLA, Wilkinson PA, Coghill J, Waterfall C, Davassi A, et al. Characterization of a Wheat Breeders' array suitable for high-throughput SNP genotyping of global accessions of hexaploid bread wheat (Triticum aestivum). Plant Biotechnol J. 2017;15(3):390–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bolton MD, Kolmer JA, Garvin DF.. Wheat leaf rust caused by Puccinia triticina. Mol Plant Pathol. 2008;9(5):563–575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bokore FE, Knox RE, Hiebert CW, Cuthbert RD, DePauw RM, Meyer B, N’Diaye A, Pozniak CJ, McCallum BD. A combination of leaf rust resistance genes, including Lr34 and Lr46, is the key to the durable resistance of the Canadian wheat cultivar, Carberry. Front Plant Sci. 2022;12:775383. 10.3389/fpls.2021.775383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cloutier S, McCallum BD, Loutre C, Banks TW, Wicker T, Feuillet C, Keller B, Jordan MC.. Leaf rust resistance gene Lr1, isolated from bread wheat (Triticum aestivum L.) is a member of the large psr567 gene family. Plant Mol Biol. 2007;65(1–2):93–106. [DOI] [PubMed] [Google Scholar]
- Cox TS, Raupp WJ, Gill BS.. Leaf rust-resistance genes Lr41, Lr42 and Lr43 transferred from Triticum tauschii to common wheat. Crop Sci. 1994;34(2):339–343. [Google Scholar]
- Dyck PL, Kerber ER.. Inheritance in hexaploid wheat of adult-plant leaf rust resistance derived from Aegilops squarrosa. Can J Genet Cytol. 1970;12(1):175–180. [Google Scholar]
- Faris JD. Wheat domestication: key to agricultural revolution past and future. In: Tuberosa R, Graner A, Frison E, editors. Genomics of Plant Genetic Resources, Vol. 1 Managing, Sequencing and Mining Genetic Resources. Berlin (Germany: ): Springer; 2014. P. 439–464. [Google Scholar]
- Feuillet C, Travella S, Stein N, Albar L, Nublat A, Keller B.. Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc Natl Acad Sci USA. 2003;100(25):15253–15258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flor HH. Host-parasite interaction in flax rust- its genetics and other implications. Phytopathology. 1955;45:680–685. [Google Scholar]
- Hiebert CW, Thomas JB, Somers DJ, McCallum BD, Fox SL.. Microsatellite mapping of adult-plant leaf rust resistance gene Lr22a in wheat. Theor Appl Genet. 2007;115(6):877–884. [DOI] [PubMed] [Google Scholar]
- Huang L, Brooks SA, Li W, Fellers JP, Trick HN, Gill BS.. Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics. 2003;164(2):655–664. [DOI] [PMC free article] [PubMed] [Google Scholar]
- International Wheat Genome Sequencing Consortium (IWGSC) . Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science. 2018;361(6403):eaar7191. 10.1126/science. aar7191. [DOI] [PubMed] [Google Scholar]
- Kassa MT, You FM, Fetch TG, Fobert P, Sharpe A, Pozniak CJ, Menzies JG, Jordan MC, Humphreys G, Zhu T, et al. Genetic mapping of SrCad and SNP marker development for marker-assisted selection of Ug99 stem rust resistance in wheat. Theor Appl Genet. 2016;129(7):1373–1382. [DOI] [PubMed] [Google Scholar]
- Kerber ER. Resistance to leaf rust in hexaploid wheat: lr32, a third gene derived from Triticum tauschii. Crop Sci. 1987;27(2):204–206. [Google Scholar]
- Kerber ER. Telocentric mapping in wheat of the gene Lr32 for resistance to leaf rust. Crop Sci. 1988;28(1):178–179. [Google Scholar]
- Kolodziej MC, Singla J, Sánchez-Martín J, Zbinden H, Šimková H, Karafiátová M, Doležel J, Gronnier J, Poretti M, Glauser G, et al. A membrane-bound ankyrin repeat protein confers race-specific leaf rust disease resistance in wheat. Nat Commun. 2021;12(1):956. 10.1038/s41467-020-20777-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kolmer JA, Anderson JA.. First detection in North America of virulence in wheat leaf rust (Puccinia triticina) to seedling plants of wheat with Lr21. Plant Dis. 2011;95(8):1032–1032. [DOI] [PubMed] [Google Scholar]
- Kosambi DD. The estimation of map distances from recombination values. Ann Eugen. 1943;12(1):172–175. [Google Scholar]
- Krattinger SG, Lagudah ES, Spielmeyer W, Singh RP, Huerta-Espino J, McFadden H, Bossolini E, Selter LL, Keller B.. A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science. 2009;323(5919):1360–1363. [DOI] [PubMed] [Google Scholar]
- Lorieux M. MapDisto: fast and efficient computation of genetic linkage maps. Mol Breeding. 2012;30(2):1231–1235. [Google Scholar]
- Luo M-C, Gu YQ, Puiu D, Wang H, Twardziok SO, Deal KR, Huo N, Zhu T, Wang L, Wang Y, et al. Genome sequence of the progenitor of the wheat D genome Aegilops tauschii. Nature. 2017;551(7681):498–502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maccaferri M, Harris NS, Twardziok SO, Pasam RK, Gundlach H, Spannagl M, Ormanbekova D, Lux T, Prade VM, Milner SG, et al. Durum wheat genome highlights past domestication signatures and future improvement targets. Nat Genet. 2019;51(5):885–895. [DOI] [PubMed] [Google Scholar]
- McCallum BD, Seto-Goh P.. Physiologic specialisation of Puccinia triticina in Canada in 2000. Can J Plant Pathol. 2003;25(1):91–97. [Google Scholar]
- McCallum BD, Seto-Goh P, Xue A.. Physiological specialization of Puccinia triticina, the causal agent of wheat leaf rust, in Canada in 2011. Can J Plant Pathol. 2017;39(4):454–463. [Google Scholar]
- McCallum BD, Hiebert CW.. Interactions between Lr67 or Lr34 and other leaf rust resistance genes in wheat (Triticum aestivum). Front Plant Sci. 2022;13:871970. 10.3389/fpls.2022.871970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McCallum BD, Hiebert CW, Cloutier S, Bakkeren G, Rosa SB, Humphreys DG, Marais GF, McCartney CA, Panwar V, Rampitsch C, et al. A review of wheat leaf rust research and the development of resistant cultivars in Canada. Can J Plant Pathol. 2016;38(1):1–18. 10.1080/07060661.2016.1145598. [DOI] [Google Scholar]
- McCALLUM BD, Reimer E, McNABB W, Foster A, Rosa S, Xue A.. Physiologic specialization of Puccinia triticina, the causal agent of wheat leaf rust, in Canada in 2015–2019. Can J Plant Pathol. 2021;43(Suppl 2):S333–S346. 10.1080/07060661.2021.1888156. [DOI] [Google Scholar]
- McIntosh RA, Dubcovsky J, Rogers WJ, Xia XC, Raupp WJ. 2019. Catalogue of Gene Symbols for Wheat: 2019 Supplement. grainGenes. [accessed 2020 Aug 14], http://wheat.pw.usda.gov/GG2/Triticum/wgc/2008/.
- Md. Hatta MA, Steuernagel B, Wulff BBH.. Chapter 4 - rapid gene cloning in wheat. In: Miedaner T, Korzun V editors. Applications of Genetic and Genomic Research in Cereals. Duxford (UK: ): Woodhead Publishing; 2019. p. 65–95. [Google Scholar]
- Moore JW, Herrera-Foessel S, Lan C, Schnippenkoetter W, Ayliffe M, Huerta-Espino J, Lillemo M, Viccars L, Milne R, Periyannan S, et al. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat Genet. 2015;47(12):1494–1498. [DOI] [PubMed] [Google Scholar]
- Pallotta MA, Warner P, Fox RL, Kuchel H, Jefferies SJ, Langridge P.. Marker assisted wheat breeding in the southern region of Australia. In: Pogna NE, Romano M, Pogna EA, Galerio G, editors. Proc 10th Int Wheat Genet Symp, Instituto Sperimentale per la Cerealcoltura, Rome; 2003. pp. 789–791. [Google Scholar]
- Pretorius ZA, Bender CM.. First report of virulence for the wheat leaf rust (Puccinia triticina) resistance gene Lr32 in South Africa. Plant Dis. 2010;94(3):381. 10.1094/PDIS-94-3-0381A. [DOI] [PubMed] [Google Scholar]
- Rowland GG, Kerber ER.. Telocentric mapping in hexaploid wheat of genes for leaf rust resistance and other characters derived from Aegilops squarrosa. Can J Genet Cytol. 1974;16(1):137–144. [Google Scholar]
- Singh RP, Hodson DP, Jin Y, Lagudah ES, Ayliffe MA, Bhavani S, Rouse MN, Pretorius ZA, Szabo LJ, Huerta-Espino J, et al. Emergence and spread of new races of wheat stem rust fungus: continued threat to food security and prospects of genetic control. Phytopathology. 2015;105(7):872–884. [DOI] [PubMed] [Google Scholar]
- Singh RP, Mujeeb-Kazi A, Huerta-Espino J.. Lr46: a gene conferring slow-rusting resistance to leaf rust in wheat. Phytopathology. 1998;88(9):890–894. [DOI] [PubMed] [Google Scholar]
- Sourdille P, Singh S, Cadalen T, Brown-Guedira GL, Gay G, Qi L, Gill BS, Dufour P, Murigneux A, Bernard M, et al. Microsatellite-based deletion bin system for the establishment of genetic-physical map relationships in wheat (Triticum aestivum L.). Funct Integr Genomics. 2004;4(1):12–25. [DOI] [PubMed] [Google Scholar]
- Thind AK, Wicker T, Šimková H, Fossati D, Moullet O, Brabant C, Vrána J, Doležel J, Krattinger SG.. Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range chromosome assembly. Nat Biotechnol. 2017;35(8):793–796. [DOI] [PubMed] [Google Scholar]
- Thomas J, Chen Q, Howes N.. Chromosome doubling of haploids of common wheat with caffeine. Genome. 1997;40(4):552–558. [DOI] [PubMed] [Google Scholar]
- Thomas J, Nilmalgoda S, Hiebert C, McCallum B, Humphreys G, DePauw R.. Genetic markers and leaf rust resistance of the wheat gene Lr32. Crop Sci. 2010;50(6):2310–2317. [Google Scholar]
- Wang S, Wong D, Forrest K, Allen A, Chao S, Huang BE, Maccaferri M, Salvi S, Milner SG, Cattivelli L, et al. ; International Wheat Genome Sequencing Consortium . Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnol J. 2014;12(6):787–796. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilkinson PA, Winfield MO, Barker GLA, Allen AM, Burridge A, Coghill JA, Edwards KJ. CerealsDB 2.0: an integrated resource for plant breeders and scientists. BMC Bioinform. 2012;13:219. 10.1186/1471-2105-13-219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL.. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012;13:134. 10.1186/1471-2105-13-134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- You FM, Huo N, Gu YQ, Luo MC, Ma Y, Hane D, Lazo GR, Dvorak J, Anderson OD. BatchPrimer3: a high throughput web application for PCR and sequencing primer design. BMC Bioinform. 2008;9:253. 10.1186/1471-2105-9-253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu T, Wang L, Rodriguez JC, Deal KR, Avni R, Distelfeld A, McGuire PE, Dvorak J, Luo M-C.. Improved genome sequence of wild emmer wheat Zavitan with the aid of optical maps. G3 (Bethesda). 2019;9(3):619–624. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Seed is available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables. Genotypic and phenotypic data available in supplementary files.
Supplemental material is available at G3 online.


