Fine mapping and marker development for the wheat leaf rust resistance gene Lr32

Abstract

Wheat leaf rust is caused by the fungal pathogen Puccinia triticina and is one of the wheat diseases of concern globally. Among the known leaf rust resistance genes (Lr) genes, Lr32 is a broadly effective gene derived from the diploid species Aegilops tauschii coss. accession RL5497-1 and has been genetically mapped to chromosome arm 3DS. However, Lr32 resistance has not been utilized in current cultivars in part due to the lack of modern, predictive DNA markers. The goals of this study were to fine map the Lr32 region and develop SNP-based kompetitive allele-specific polymerase chain reaction markers. The genomic analysis was conducted by using doubled haploid and F₂-derived mapping populations. For marker development, a 90K wheat chip array, 35K and 820K Axiom R SNPs, A. tauschii pseudomolecules v4.0 and International Wheat Genome Sequencing Consortium ReqSeq v2.1 reference genomes were used. Total 28 kompetitive allele-specific polymerase chain reaction and 2 simple sequence repeat markers were developed. The Lr32 region was fine mapped between kompetitive allele-specific polymerase chain reaction markers Kwh142 and Kwh355 that flanked 34–35 Mb of the diploid and hexaploid reference genomes. Leaf rust resistance mapped as a Mendelian trait that cosegregated with 20 markers, recombination restriction limited the further resolution of the Lr32 region. A total of 10–11 candidate genes associated with disease resistance were identified between the flanking regions on both reference genomes, with the majority belonging to the nucleotide-binding domain and leucine-rich repeat gene family. The validation analysis selected 2 kompetitive allele-specific polymerase chain reaction markers, Kwh147 and Kwh722, for marker-assisted selection. The presence of Lr32 along with other Lr genes such as Lr67 and Lr34 would increase the resistance in future wheat breeding lines and have a high impact on controlling wheat leaf rust.

Introduction

Leaf rust is the most common and widely occurring wheat rust disease (Triticum aestivum L. 2n = 6x = 42, AABBDD) and is caused by a biotrophic fungal pathogen Puccinia triticina Eriks (Pt) (Bolton et al. 2008). There are presently 79 leaf rust resistance (Lr) genes that have been identified (McIntosh et al. 2019). Among 3 wheat genomes, the D genome progenitor Aegilops tauschii coss. (2n = 2x = 14, DD genome) is known to be a great resource of rust resistance genes compared with other 2 progenitors T. urartu Tumanian ex Gandylian (2n = 2x = 14, AA) and a close relative of Aegilops speltoides ssp. lingustica Tausch (2n = 2x = 14, SS) (see Faris 2014 for review). To date, 5 Lr genes have been transferred to bread wheat from the A. tauschii: Lr21/Lr40 (1DS), Lr22a (2DS), Lr32 (3DS), Lr39/Lr41 (2DS), and Lr42 (1DS) (Dyck and Kerber 1970; Rowland and Kerber 1974; Kerber 1987; Cox et al. 1994).

Plant disease resistance genes have been classified into race-specific and nonrace-specific groups. The race-specific resistance follows the gene-for-gene model described by Flor (1955) that states that for each resistance (R) gene in the plant there will be a corresponding avirulence (AVR) gene in the pathogen. Some of the nonrace-specific resistance type genes are effective against many pathogens and were reported to be associated with a variety of genes encoding receptor kinases, transcription factors, membrane proteins, Kinase-START, and ATP-binding cassette (ABC) transporters (Singh et al. 2015). Many of the race-specific R genes in wheat were associated with the nucleotide-binding domain and leucine-rich repeat (NLR) gene family. To date, only 7 Lr genes have been cloned Lr1 (Cloutier et al. 2007), Lr10 (Feuillet et al. 2003), Lr21 (Huang et al. 2003), Lr22a (Thind et al. 2017), Lr34/Yr18/Sr57/Pm38 (Krattinger et al. 2009), Lr67/Yr46/Sr55/Pm46 (Moore et al. 2015), and Lr14a (Kolodziej et al. 2021). Out of which, race-specific leaf rust genes Lr1, Lr10, and Lr21 belong to the NLR gene family. Lr14a was sequenced and was found to belong to ankyrin (ANK) transmembrane-like gene family, which is a first in wheat (Kolodziej et al. 2021). Genes conditioning race-specific resistance tend to lose their effectiveness as the pathogen population evolves virulence. For example, the P. triticina population in Canada has evolved virulence to Lr1, Lr2a, Lr10, Lr12, Lr13, Lr14a, and Lr21 which were all used in Canadian wheat cultivars to control leaf rust (McCallum et al. 2016). In contrast durable, race nonspecific, slow-rusting leaf rust resistance genes Lr34, Lr46, and Lr67 have proved to be long-lasting and are able to confer resistance against multiple pathogens and races (Singh et al. 1998; Krattinger et al. 2009; Moore et al. 2015; McCallum et al. 2016). High levels of durable leaf rust resistance have been achieved by combining race-specific and race-nonspecific resistance genes in the same cultivar, such as the Canadian cultivar Carberry with Lr2a, Lr16, Lr23, Lr34, and Lr46 (Bokore et al. 2022). Consequently, new gene combinations need to be introduced in the wheat cultivars to achieve the durable resistance and decrease the selection pressure on Pt populations for virulence against R genes. For combining multiple R genes, the availability of gene-based and functional molecular makers is ideal. Within the last few years, high-throughput genetic analysis has become more advanced with the development of single nucleotide polymorphism (SNP) chips (Wang et al. 2014; Allen et al. 2017) and the availability of reference genome resources (Luo et al. 2017; Maccaferri et al. 2019; Zhu et al. 2019) which has led to better markers for a higher number of genes and resources needed for gene cloning experiments.

Among the broadly effective leaf rust resistance genes (Lr21, Lr22a, Lr32, Lr52, and Lr60) identified at the Morden Research and Development Centre, AAFC, Morden (and the former Cereal Research Centre, Winnipeg): Lr32, Lr52, and Lr60 have not been deployed in Canadian commercial cultivars (Thomas et al. 2010) and Lr22a has been deployed in 3 cultivars (AC Minto, 5500HR, and 5600HR) that occupied minimal acreage (Hiebert et al. 2007). The seedling leaf rust resistance gene Lr32 was discovered in A. tauschii coss. (accession number RL5497-1) and was mapped using simple sequence repeat (SSR) markers on chromosome arm 3DS. It was physically located in deletion bin 6 (3DS6–0.55–1.00) which spans ∼75 cM of genetic distance (Kerber 1987, 1988; Sourdille et al. 2004; Thomas et al. 2010). The SSR map was not dense, and while some SSRs were very closely linked to Lr32, markers that reliably flanked the gene had large genetic distances to Lr32. Hence, the objectives of this study were: (1) to develop the new kompetitive allele-specific polymerase chain reaction (PCR) (KASP) markers for Lr32 suitable for marker-assisted selection (MAS) and (2) fine map the Lr32 region.

Materials and methods

Plant material

Wheat line BW196 (=Katepwa*6//RL5713/2*MarquisK) was found to be heterogeneous for Lr32 based on phenotype and molecular marker data (Thomas et al. 2010). Therefore, for the development of mapping populations, a single resistant reselection (BW196R) was used as a resistance parent as explained in Thomas et al. (2010). A double haploid (DH) population (n = 244), an initial F₂ (n = 196) population, and an expanded large F₂ (n ≈ 2,000) population were developed from a cross between the susceptible parent Thatcher and the resistant line BW196R. The initial, smaller F₂ population and the expanded F₂ population were generated from the same cross, but there was no overlap in individuals between the 2 populations. The F₃ families were developed from the large F₂ population lines based on markers flanking the Lr32 region (recombinants were selected, detailed description in the Genotyping section). From these recombinant F₃ progenies, fixed recombinant lines were selected based on the marker genotypes. The DH population was developed using the maize pollination method as described by Thomas et al. (1997). For the validation of the newly developed MAS markers, a panel of 32 wheat lines was used which consisted of material ranging from F₁ progeny to advanced generations (with Lr32 plus additional Lr genes), Lr32-lacking susceptible check Neepawa, and an Lr32 carrier (BW196R).

Leaf rust testing

The leaf rust phenotyping of the parents, Thatcher and BW196R, DH population, F₂ population, F₃ progenies from the initial F₂ population, and fixed recombinants derived from expanded F₂ population was done with the urediospores of Pt race 12-3 MBDS at the seedling stage following the method described by McCallum and Seto-Goh (2003). Briefly, the plants were inoculated at the first leaf stage (∼7 day old) with urediospores of Lr32 avirulent Pt race 12-3 MBDS suspended in light mineral oil (McCallum et al. 2021). After inoculation plants were kept in humidity-maintained chambers for 16 h at 18–20°C and subsequently transferred to the greenhouse which was kept at 20 ± 2°C. After 12–14 days plants were scored in the scale of 0–4 (0, 1, 2, 3, 4) where 0–2 were considered resistant and 3–4 considered susceptible, the symbols “+” and “−” were used to note pustule sizes that were larger or smaller than typically observed for a given infection type (McCallum et al. 2021).

Genotyping and marker development

The DNA extraction of parents and mapping populations (DH, F₂, and fixed recombinants) was done using a modified ammonium acetate method (Pallota et al. 2003). The DH population was genotyped using 90K iSelect SNP array (Wang et al. 2014) and 8 SSR markers, barc128, barc135, barc376, cfd34, gwm2, gwm183, wmc43, and wmc539 reported in the Thomas et al. (2010). A linkage map was constructed using the software MapDisto 1.8.2 (Lorieux 2012) and genetic distances were calculated using the Kosambi mapping function (Kosambi 1943). After locating the Lr32 region on the linkage map, the associated SNPs were converted into KASP markers (Tables 1 and 2). Total 17 KASP were developed from the 90K SNP array and genotyping was done according to the procedure described in Kassa et al. (2016). One SSR marker Swh28 was developed from the A. tauschii pseudomolecules v4.0 gene-based region by using the software package Batchprimer3 (You et al. 2008) (Table 3). In addition, FASTA sequences of NBS-LRR gene regions from International Wheat Genome Sequencing Consortium (IWGSC) ReqSeq v1.0 were also used to develop the SSR markers, and out of which Swh45 is polymorphic between parents (Table 3). The F₂ population (n = 196) was genotyped with the 12 KASP developed in the DH population and 3 SSR markers barc135, Swh28, and Swh45. After that, codominant flanking DNA markers were selected and these markers were used for the screening of ∼2,000 F₂ individuals to identify plants with a recombination event within the interval carrying Lr32. F₃ progeny (minimum 16 progenies/family) from each recombinant F₂ plant was tested with the flanking markers to select progeny fixed for recombination events and were genotyped with the remaining KASP markers.

Table 1.

Lr32 region-associated kompetitive allele-specific (KASP) PCR markers source, SNP name, primer sequence information.

Marker name	SNP name/gene ID	Primer name	Primer A1 (5ʹ–3ʹ)a	Inheritance
Kwh142	RFL_Contig2471_119	kwh142-A1	{Tail-1}GGGTCGAACACGTTGCTCCG	Codominant
		kwh142-A2	{Tail-2}GGGTCGAACACGTTGCTCCA
		kwh142-C	CGAGCGCACAAGCCGAAGCAAT
Kwh147	RAC875_c59977_246	kwh147-A1	{Tail-1}AAGCAACACAGATCTCCACCTCA	Codominant
		kwh147-A2	{Tail-2}AGCAACACAGATCTCCACCTCG
		kwh147-C	GGTCGGTGTTGCCTCCTCGGT
Kwh148	BobWhite_c16071_165	kwh148-A1	{Tail-1}AACGCCAAGATCGAAGCGTATTAC	Codominant
		kwh148-A2	{Tail-2}GAACGCCAAGATCGAAGCGTATTAT
		kwh148-C	TCCAGTCCAGTACCGGTCTCGT
Kwh149	D_contig34048_162	kwh149-A1	{Tail-1}ATTCCACATTGTGGCTTTCCAACCT	Codominant
		kwh149-A2	{Tail-2}CCACATTGTGGCTTTCCAACCC
		kwh149-C	TCGAATACGATGACCCTGATGCCAT
Kwh152	D_GDRF1KQ02F7Y6F_336	kwh152-A1	{Tail-1}CCTGTCGCACCGCAGCCAT	Codominant
		kwh152-A2	{Tail-2}CTGTCGCACCGCAGCCAC
		kwh152-C	CCATTGTTTGATCTCTTTTTGCAGCGTT
Kwh340	BS00093856_51	kwh340-A1	{Tail-1}GTTGAGTGGTATGCCGCCGC	Codominant
		kwh340-A2	{Tail-2}GGTTGAGTGGTATGCCGCCGT
		kwh340-C	CATTTCTGTGGTGCGGCTGTGCAT
Kwh342	D_contig09222_937	kwh342-A1	{Tail-1}CTTTCTGAATGTTACAAAGTATTTACATGTTA	Codominant
		kwh342-A2	{Tail-2}CTTTCTGAATGTTACAAAGTATTTACATGTTG
		kwh342-C	GCTCAACCCTCAGCTGAAGCTGAA
Kwh343	D_contig17344_388	kwh343-A1	{Tail-1}CAAACTGTTCGATGCTATGAATTTAGTG	Codominant
		kwh343-A2	{Tail-2}ATCAAACTGTTCGATGCTATGAATTTAGTA
		kwh343-C	TGCAAAATTAACCCGCAAAACTCACGAT
Kwh345	D_F5XZDLF01EIBB2_65	kwh345-A1	{Tail-1}GAGTTTAAAACAAGAACAGAGCAACAAA	Codominant
		kwh345-A2	{Tail-2}GAGTTTAAAACAAGAACAGAGCAACAAC
		kwh345-C	GACAACATCACTCATGCAGTACTCCTT
Kwh346	D_F5XZDLF02HWOJZ_227	kwh346-A1	{Tail-1}AACAGCAAGCTTTCTCTGGTCACAA	Codominant
		kwh346-A2	{Tail-2}CAGCAAGCTTTCTCTGGTCACAG
		kwh346-C	GAAATATATGGATCAACTGCGAGCACTTT
Kwh349	Excalibur_c11594_181	kwh349-A1	{Tail-1}GGCCCTGCCTATCCAACAAGAA	Codominant
		kwh349-A2	{Tail-2}GCCCTGCCTATCCAACAAGAG
		kwh349-C	CCCACAGGAAAAAGTAAATCCAACGTATT
Kwh353	Kukri_c28730_207	kwh353-A1	{Tail-1}TGCTCAACGGATGATCGCACAT	Codominant
		kwh353-A2	{Tail-2}GCTCAACGGATGATCGCACAC
		kwh353-C	GCAGCTCTCTCTGTTGGATCYTCAA
Kwh355	Kukri_c80364_374	kwh355-A1	{Tail-1}GTGTGTTGTCCAATTGCTGGTTGT	Codominant
		kwh355-A2	{Tail-2}GTGTTGTCCAATTGCTGGTTGC
		kwh355-C	CTGTAGTGGTCTTCAAAGTCCTCCAA
Kwh357	RAC875_c10628_1037	kwh357-A1	{Tail-1}GCCTGTTACTGCTGCCAAGACT	Codominant
		kwh357-A2	{Tail-2}CCTGTTACTGCTGCCAAGACG
		kwh357-C	GCTCACCATTATCAGGTAGCCTTCAT
Kwh360	RAC875_rep_c110663_1499	kwh360-A1	{Tail-1}ATCCCTTTACACCGTATGCTTTCG	Codominant
		kwh360-A2	{Tail-2}ATATCCCTTTACACCGTATGCTTTCA
		kwh360-C	ATCCTCTCCGAAACATTTCTTCATTGCTT
Kwh362	wsnp_Ex_c1602_3055066	kwh362-A1	{Tail-1}CAAACATGACTATGGCACGATAGAC	Codominant
		kwh362-A2	{Tail-2}CCAAACATGACTATGGCACGATAGAA
		kwh362-C	GAACTGTGATATACTTTCCGTATCAGCAA
Kwh364	BobWhite_c17617_133	kwh364-A1	{Tail-1}ACCAACGAGGAAACCATCGACG	Codominant
		kwh364-A2	{Tail-2}CACCAACGAGGAAACCATCGACA
		kwh364-C	AGTTGGCCGCGCAGCCCGA
Kwh489	BS00070468	kwh489-A1	{Tail-1}CCTTGTGGACAATTTCCTCTTTTGG	Dominant
		kwh489-A2	{Tail-2}CCCTTGTGGACAATTTCCTCTTTTGA
		kwh489-C	CGTTGATTATTCAACAGCAGATGGGATTT
Kwh491	BS00072718	kwh491-A1	{Tail-1}CCTTGTGGACAATTTCCTCTTTTGG	Dominant
		kwh491-A2	{Tail-2}CCCTTGTGGACAATTTCCTCTTTTGA
		kwh491-C	CGTTGATTATTCAACAGCAGATGGGATTT
Kwh605	BA00271713	kwh605-A1	{Tail-1}CACCAGAGTCATAATTTAAGTTGGAG	Codominant
		kwh605-A2	{Tail-2}CCACCAGAGTCATAATTTAAGTTGGAA
		kwh605-C	CCTCAGAAAATGCACCTGGCAGTA
Kwh617	BA00169625	kwh617-A1	{Tail-1}AGGCAAATGATACAGGTGCAGCT	Codominant
		kwh617-A2	{Tail-2}GGCAAATGATACAGGTGCAGCC
		kwh617-C	CATTCCTCAGTTCTTGTTCTTGCAG
Kwh628	BA00575742	kwh628-A1	{Tail-1}CGGGACGAGACTTGAGGAACC	Codominant
		kwh628-A2	{Tail-2}CGGGACGAGACTTGAGGAACT
		kwh628-C	ACGTGGAGTATCTCCGCCGGA
Kwh645	>AET3Gv20190400.18	kwh645-A1	{Tail-1}GCACAGAACAACTTGACTGGGC	Codominant
		kwh645-A2	{Tail-2}GGCACAGAACAACTTGACTGGGT
		kwh645-C	CACCGACAGCAATGTCAAATTTTGTAGAA
Kwh646	>AET3Gv20190400.18	kwh646-A1	{Tail-1}CAGGGTCACTCATGCTACTAGTG	Codominant
		kwh646-A2	{Tail-2}AACAGGGTCACTCATGCTACTAGTT
		kwh646-C	CTTTGAGCTTCCTGTGGAGTAACCAA
Kwh662	>AET3Gv20200600.2	kwh662-A1	{Tail-1}GCGTGCGAGATCGGCGTC	Codominant
		kwh662-A2	{Tail-2}GCGTGCGAGATCGGCGTG
		kwh662-C	GCACGATGTTGCGGTGGCGCA
Kwh721	BA00024318	kwh721-A1	{Tail-1}CGTCTGTAGAATACAAGGTTCTC	Dominant
		kwh721-A2	{Tail-2}CTCGTCTGTAGAATACAAGGTTCTG
		kwh721-C	CCTCCACATGTGTGTTACAAAATTACAAAT
Kwh722	BA00186143	kwh722-A1	{Tail-1}ACCATGGATCCTACCAAAGAGGA	Codominant
		kwh722-A2	{Tail-2}CCATGGATCCTACCAAAGAGGG
		kwh722-C	GCGGCTATTGTTCGACAACTGCTAA
Kwh727	BA00078867	kwh727-A1	{Tail-1}CTTCCCCTTCCTTTCTGTTT	Dominant
		kwh727-A2	{Tail-2}GCTCTTCCCCTTCCTTTCTGTTC
		kwh727-C	CAGAGGTGTGTATGTGGTGATGGAT

^aTail-1 (FAM tail-GAAGGTGACCAAGTTCATGCT), Tail-2 (VIC tail-GAAGGTCGGAGTCAACGGATT)

Table 2.

Sequence information for the SSR markers developed from the Chinese spring RefSeq v2.1 and A. tauschii pseudomolecules v5.0.

Marker name	Forward	Reverse
Swh28	AGTCGTCCTGGCTTACGTGT	CGAAACGCACCTTGCTTTAT
Swh45	AGCGGCTGTAGCTTTTGTTC	TGCATGAATGTTTGGTCCAG

Table 3.

Coordinates of Kompetitive allele-specific (KASP) PCR and the SSR markers source sequences on the Chinese spring RefSeq v2.1 and A. tauschii pseudomolecules v5.0.

Marker name	SNP name/gene ID	Source	IWGSC RefSeq v2.1	Aegilops tauschii pseudomolecules v5.0
Kwh142	RFL_Contig2471_119	90K Wheat SNPa	17416838–17416738	17822798–17822698
Kwh489	BS00070468	CerealsDB-KASPb	18794498–18794398	19599880–19599780
Kwh491	BS00072718	CerealsDB-KASP	18794498–18794398	19599880–19599780
Kwh721	BA00024318	Axiom 35K and 820Kc	19907918–19907818	20595051–20594951
Kwh722	BA00186143	Axiom 35K and 820K	19960762–19960862	20647473–20647573
				20640902–20641002
				20656768–20656868
Kwh727	BA00078867	Axiom 35K and 820K	21829292–21829390	23302561–23302659
Kwh340	BS00093856_51	90K Wheat SNP	22049657–22049557	23435820–23435720
Kwh149	D_contig34048_162	90K Wheat SNP	24039549–24039298	25780968–25781219
				26231058–26230808
Swh28		Aegilops tauschii pseudomolecules v5.0	—	27076467–27076484
		gene region
Swh45		IWGSC RefSeq_NB-LRR region	26290206–26294113	—
Kwh147	RAC875_c59977_246	90K Wheat SNP	28724554–28724454	30772352–30772252
				30783260–30783160
Kwh346	D_F5XZDLF02HWOJZ_227	90K Wheat SNP	31777459–31777708	34568768–34569017
Kwh360	RAC875_rep_c110663_1499	90K Wheat SNP	32277430–32277331	—
Kwh364	BobWhite_c17617_133	90K Wheat SNP	33167119–33167035	36372653–36372569
Kwh357	RAC875_c10628_1037	90K Wheat SNP	36693579–36693479	38119477–38119377
Kwh148	BobWhite_c16071_165	90K Wheat SNP	36693749–36693849	38119647–38119747
Kwh342	D_contig09222_937	90K Wheat SNP	37167341–37167092	38613914–38613665
Kwh349	Excalibur_c11594_181	90K Wheat SNP	37846513–37846613	39264726–39264823
Kwh345	D_F5XZDLF01EIBB2_65	90K Wheat SNP	39445515–39445330	40921768–40921582
Kwh353	Kukri_c28730_207	90K Wheat SNP	43918204–43918108	45744256–45744160
Kwh605	BA00271713	Axiom 35K and 820K	44114802–44114732	46068489–46068419
Kwh645	>AET3Gv20190400.18	Aegilops tauschii pseudomolecules v4.0d	45121378–45121531	47128503–47128656
Kwh646	>AET3Gv20190400.18	Aegilops tauschii pseudomolecules v4.0	45121532–45121779	47128657–47128904
Kwh617	BA00169625	Axiom 35K and 820K	45122722–45122652	47129847–47129777
Kwh362	wsnp_Ex_c1602_3055066	90K Wheat SNP	—	480327588–480327388
Kwh628	BA00575742	Axiom 35K and 820K	46020254–46020324	49080031–49080101
Kwh662	>AET3Gv20200600.2	Aegilops tauschii pseudomolecules v4.0	46675509–46675694	49760125–49760310
Kwh152	D_GDRF1KQ02F7Y6F_336	90K Wheat SNP	47438552–47438794	50412774–50413021
Kwh343	D_contig17344_388	90K Wheat SNP	47742563–47742314	50841817–50841568
Kwh355	Kukri_c80364_374	90K Wheat SNP	47743405–47743326	50842656–50842580

^a Wang et al. (2014).

^b Wilkinson et al. (2012).

^c Allen et al. (2017).

^d Luo et al. (2017).

^eNo hit.

To increase the resolution of the Lr32 spanning genetic region, an additional 11 KASP markers were developed or selected from the CerealsDB database, 35K and 820K Axiom R SNPs, and A. tauschii (accession AL8/78) pseudomolecules v4.0 (Tables 1 and 2). First, the flanking KASP markers source sequences were aligned against the IWGSC ReqSeq v1.0 via using the basic local alignment search tool (BLAST) (Altschul et al. 1997) and the Jbrowse portal was used to explore the region. Within that region, 2 SNPs (BS00070468 and BS00072718) were selected and associated KASP markers Kwh489 and Kwh491 (Tables 1 and 2) were used for genotyping the fixed recombinant lines (CerealsDB database; Wilkinson et al. 2012). Within that region, additional 35K and 820K Axiom R SNPs were also selected to develop KASP markers (Allen et al. 2017). Total 6 KASP markers, Kwh605, Kwh617, Kwh628, Kwh721. Kwh722, and Kwh727, were developed from the Axiom SNPs and used to genotype the fixed recombinants (Tables 1 and 2). Moreover, the flanking KASP markers source sequences were also used to select the A. tauschii (accession AL8/78) pseudomolecules v4.0 (Luo et al. 2017) gene regions. Out of which, LRR motif-containing gene regions were selected and BLASTed against the IWGSC RefSeq v1.0 assembly. After aligning the FASTA sequence from both assemblies, SNPs were identified and 3 KASP markers, Kwh645, Kwh646, and Kwh662, were manually developed by using the Primer3 software package (Ye et al. 2012). The source sequences of KASP and SSR markers were used to determine the physical coordinates on the A. tauschii pseudomolecules v4.0 and IWGSC ReqSeq v2.1. The mode of inheritance (dominant/codominant) of the markers developed in the current study was determined on the F₂ population. To validate these markers a genetic analysis was conducted with F₁ and prebreeding germplasm carrying Lr32 (Supplementary Table 1). The Aet_v4.0 and IWGSC ReqSeq v2.1 reference genomes data were used to extract the disease resistance candidate genes between flanking markers Kwh142 and Kwh355.

Results

The leaf rust screening showed that the susceptible parent Thatcher had IT 3 and the resistant parental line BW196R had IT 1− (Fig. 1). The DH population phenotypic ratio fitted that expected for a single gene (109R:134S; χ² = 2.25, P = 0.11). The initial F_2:3 population had 51 resistant (HR), 96 segregating (hetero), and 49 susceptible (HS) families which also fitted a single gene ratio (χ² = 0.12, P = 0.94). The DH and F_2:3 population IT scores ranged between 1− and 3 (HR = 1−/12/12, hetero = 2− to 3−, HS = 3/3+) (Supplementary Files 1 and 2). Linkage mapping in the DH population using 90K SNP markers and SSR markers developed for the Lr32 region resulted in a genetic map of chromosome arm 3DS that spanned 37.4 cM and consisted of 39 SNP and 8 SSR markers (Fig. 2 and Supplementary Files 1 and 2). Lr32 was mapped at position 17.8 cM and cosegregated with SSRs wmc43 and barc135. In addition, a total of 24 SNP markers cosegregated with Lr32 (Supplementary Files 1 and 2). This region was flanked by SNPs IWB32645 and IWB18374 (Fig. 2). Genetic analysis conducted on the F₂ population with 12 KASP and 3 SSR markers developed a chromosome arm 3DS linkage map of 6.73 cM (Fig. 2).

Fig. 1.

Seedling stage leaf rust infection type (IT) on the Lr32 DH mapping populations parents Thatcher (IT = 3) and BW196R (IT =; 1−) 14th day postinoculation of the Pt race MBDS.

Fig. 2.

a) The chromosome 3DS deletion Bin6. b) The SSR markers based chromosome arm 3DS linkage map spanning Lr32 developed in the DH population (Thomas et al. 2010). c) The Lr32 associated chromosome arm 3DS 90K SNP’s linkage map developed in the Thatcher × BW196R DH population. d) The 3DS linkage map developed in the Thatcher × BW196R F₂ population (n = 196) by using 12 KASP and 3 SSR markers. Common SSR markers between 3DS map developed by Thomas et al. (2010) and current study were shown in Blue fonts and KASP markers developed from the 90K SNPs were represented with the green fonts.

The KASP markers Kwh142 and Kwh355 positioned at 14.5 and 22.1 cM on the chromosome 3DS DH linkage map were selected as the flanking markers and used for screening the ∼2,000 F₂ progenies (Fig. 2). Selected F₂ progeny were used to generate F₃ progeny. Based on genotypic and phenotypic screening of these F₃ progenies, 106 fixed recombinants (i.e. both homologs carried the same recombination event between the flanking markers with no heterozygous alleles for the flanking markers) were identified (Fig. 3). Further genetic analysis was done on these 106 fixed recombinants with the remaining 26 KASP and 2 SSR markers were developed from 90K SNP chip, Axiom SNPs, A. tauschii gene-based regions and CerealsDB database (Fig. 3 and Tables 1 and 2). The overall genomic analysis conducted on the fixed recombinants fine-mapped Lr32 to a region spanning 2.57 cM between the flanking markers. In the fine mapping population, a total of 18 KASP and 2 SSR markers cosegregated with Lr32 and were flanked by KASP markers Kwh 722 and Kwh 638 (Supplementary File 3). Mapping of KASP markers source sequences on reference genomes showed that the Lr32 region is collinear in both diploid and hexaploid genome assemblies. Total 11 and 10 candidate genes belonging to the gene’s classes typical of disease resistance genes were identified between the flanking markers Kwh142 and Kwh355 in the IWGSC RefSeq v2.1 and A. tauschii pseudomolecules v4.0. reference genomes, respectively (Table 4).

Fig. 3.

Collinearity of Lr32 high resolution genetic region-associated KASP markers (b) on the Aegilops tauschii (Aet v 5.0) (a) and 3DS Chinese spring reference (Refseq v2.1) genomes. The high-resolution mapping was done by using 106 fixed recombinants.

Table 4.

Candidate genes between flanking markers Kwh142 and Kwh355 identified in reference genome assemblies of A. tauschii pseudomolecules v4.0 and International Wheat Genome Sequencing Consortium (IWGSC) RefSeq v2.1.

Gene list	Aegilops tauschii pseudomolecules v4.0 coordinates	IWGSC RefSeq v2.1 coordinates	Gene function
LOC109770626	371107079–371130152	—	Leaf rust 10 disease resistance locus receptor-like PROTEIN KINASE-like 2.8% 2C transcript variant ×1
LOC109770629	371186179–371191403	—	Leaf rust 10 disease resistance locus receptor-like PROTEIN KINASE-like 2.7
LOC109770630	371356207–371376463	—	Leaf rust 10 disease resistance locus receptor-like PROTEIN KINASE-like 1.2% 2C transcript variant ×2
LOC109786043	403287941–403288597	—	Putative disease resistance protein RGA3
LOC109786041	403289550–403292234	—	Disease resistance protein RGA2
LOC109786040	403294816–403296642	—	Disease resistance protein RGA2
LOC109757481	431756637–431759708	—	Disease resistance protein RPM1-like
LOC109749583	439761646–439765270	—	Disease resistance protein RPS2
LOC109779823	442696038–442705114	—	Disease resistance RPP13-like protein 4%2C transcript variant ×4
LOC109779825	442700026–442701359	—	Probable disease resistance protein At5g45440
TraesCS3D03G0659400.1	—	396867186–396868224	NBS–LRR-like resistance protein
TraesCS3D03G0659900.1	—	396875344–396875847	Disease resistance protein RGA2
TraesCS3D03G0683400.1	—	413254998–413257949	Disease resistance protein (TIR–NBS class)
TraesCS3D03G0697900.1	—	421489316–421489550	Disease resistance protein (TIR–NBS–LRR class) family
TraesCS3D03G0705600.1	—	425470383–425473025	NBS–LRR disease resistance protein
TraesCS3D03G0721700.1	—	433489667–433492396	CC–NBS–LRR family disease resistance protein
TraesCS3D03G0728800.1	—	436220239–436221414	NBS–LRR disease resistance protein
TraesCS3D03G0728900.1	—	436222190–436223924	Disease resistance protein
TraesCS3D03G0737800.1	—	440586174–440589527	NBS–LRR resistance protein, putative
TraesCS3D03G0790700.1	—	469421914–469422111	Disease resistance protein (TIR–NBS–LRR class) family
TraesCS3D03G0801200.1	—	476629268–476630671	Nematode resistance protein-like HSPRO2

Discussion

The phenotyping results showed that the DH and initial F₂ populations segregated for 1 gene. The collinearity of SSR and KASP markers in the DH and F₂ mapping populations and their corresponding physical order on reference genomes demonstrate the marker order was robust (Figs. 1 and 3). In addition, large numbers of 90K SNP/KASP markers cosegregating with the Lr32 resistance phenotype in the 3 populations (DH, F₂, and fixed recombinants) analyzed in the current study indicates that Lr32 region is associated with a linkage block with recombination restriction. Physical mapping of the SNP source sequences on the A. tauschii pseudomolecules v4.0 and IWGSC ReqSeq v2.1 reference genomes showed that the Lr32 region spanned about 34–36 Mb between the flanking markers Kwh142 and Kwh355, which clearly showed that the physical size of these segments is large (11–13 Mb/cM) (Fig. 3). The cosegregating markers with Lr32 phenotype represent 26–28 Mb on both reference genomes (Fig. 3). These results explained the limitation to further increase the resolution of the Lr32 region. In addition, it also indicates a lower recombination frequency associated with alien R genes. Among the candidate genes identified from the reference genomes, NLR is the most abundant one. Besides that Protein Kinase and RGA types genes were also identified. Both classes of NLR genes, Toll-interleukin receptor type (TIR) and N-terminal coiled-coil (CC) were identified. Whereas, to date only CC–NBS–LRR has been identified in wheat for disease resistance (reviewed in Md. Hatta et al. 2019).

The validation analysis done with the F₁ and advanced prebreeding lines showed that the 2 KASP markers Kwh147 and Kwh722 are codominant and able to differentiate between plants carrying Lr32 in the heterozygous/homozygous states (Fig. 4). Marker Kwh340 also detects the presence of the Lr32-resistant allele; however, clusters are not well differentiated. These markers should be useful for the selection of Lr32 in wheat breeding programs. Pyramiding Lr32 with other effective genes such as adult–plant resistance genes Lr34, Lr46 or Lr67 should help to delay the evolution of Lr32 virulent P. triticina isolates. To date virulence to Lr32 has not been detected in Canada (McCallum et al. 2021), although there is a report for virulence in South Africa (Pretorius and Bender 2010). The absence of virulence to Lr32 in Canada may be due to the fact that this gene has not been deployed in a commercial wheat cultivar to drive evolution of virulence in the pathogen population. The resistance gene Lr67 was recently shown to have a significant interaction with Lr32 when the 2 genes were in combination in a population that segregated for these 2 genes in the Thatcher background (McCallum and Hiebert 2022). The interaction between Lr34 and Lr32 was not significant in a population that segregated for both these genes; however, lines with both genes were more resistant than lines with either-gene alone. Using the molecular markers developed in this study Lr32 can be successfully incorporated into wheat lines, such as Carberry with Lr34, Lr46, and other resistance genes, that already have a good base of genetic resistance (Bokore et al. 2022). Deploying Lr32 in isolation would likely lead to the evolution of virulence on Lr32 as was seen for Lr21, a similar resistance gene also derived from A. tauschii, both in the USA (Kolmer and Anderson 2011) and Canada (McCallum et al. 2017). In conclusion, the development of these new functional markers will accelerate integration of Lr32 into the breeding lines and will be helpful in MAS to develop the future wheat cultivars with durable resistance.

Fig. 4.

The validation analysis done on the F₁ and advanced multigene lines with Lr32-region functional molecular markers Kwh 147 and Kwh 722.

Data Availability

Seed is available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables. Genotypic and phenotypic data available in supplementary files.

Supplemental material is available at G3 online.