Abstract
Simple Summary
Due to consumer demand for safe aquatic foods and environmental concerns in aquaculture, aquaculture production can benefit from investigating the use of immunostimulant b-glucans as feed additives. In this study, we selected laminarin as a feed additive for juvenile largemouth bass (Micropterus salmoides), and investigated the appropriate dose of supplemented laminarin in the diet based on the analysis of the growth performance, antioxidant capacity, immune response and intestinal microbiota of fish. The results indicated that supplemented laminarin in diet at a low level is suggested as a promising immunopotentiator without negative effects on growth performance for juvenile largemouth bass.
Abstract
A 28 day feeding trial was conducted to investigate the growth performance, immune response and intestinal microbiota of laminarin (LAM) supplemented diets in juvenile largemouth bass (Micropterus salmoides). Four hundred and eighty fish (initial average weight: 0.72 ± 0.04 g) were randomly divided into four groups (40 fish per tank with three replicates in each group) Four diets were prepared with LAM supplementation at the doses of 0 (control), 5 g Kg−1 (LL), 10 g Kg−1 (ML) and 15 g Kg−1 (HL), respectively. No significant difference in the specific growth rate (SGR) and hepatosomatic index (HSI) was observed in fish among the four groups, or in the lipid and ash content of fish flesh. In addition, fish in the LL group exhibited much higher antioxidant capacity (p < 0.05), while the diets with the inclusion of 5 and 10 g Kg−1 LAM remarkably decreased the antioxidant capacity of fish (p > 0.05). Dietary LAM at the dose of 5 g Kg−1 inhibited the transcription of interleukin-1β (il-1β) and tumor necrosis factor-α (tnf-α), while promoting the expression of transforming growth factor-β (tgf-β) in fish intestine. Moreover, the beneficial intestinal bacteria Bacteroide, Comamonas and Mycoplasma abundance significantly increased in fish from the LL group, while the content of opportunistic pathogens Plesiomonas, Aeromonas and Brevinema in fish of the HL group was substantially higher than the control group. Overall, the appropriate dose of supplemented LAM in the diet was 5 g Kg−1, while an excessive supplementation of LAM in the diet led to microbial community instability in largemouth bass.
Keywords: Micropterus salmoides, laminarin, antioxidant capacity, intestinal microbiota, immune response
1. Introduction
In the last decades, largemouth bass (Micropterus salmoides) has been an important economic fish and is widely accepted by consumers all over the world [1,2,3]. The frequent outbreaks of diseases caused by various pathogens have become a limiting factor for the development of largemouth bass farming [3]. The application of antibiotics effectively decreases the outbreaks of diseases, while it presents harmful effects, such as the development of resistant bacteria and the accumulation in the natural environment [4]. With the demand of consumers for safe aquatic food, as well as the requirement of environmental security, there is a prerequisite to develop safe and efficient dietary additives that can promote the physiology and health of the farmed aquatic animals.
Laminarin (LAM) is a β-glucan extracted from brown algae, and is composed of β-1, 3-glucan with β-1, 6-linkages [5]. Lines of evidence have reported that specific physicochemical properties play a vital role in determining the magnitude of β-glucan binding to macrophage receptor(s) and how it modulates the immune responses [6]. Moreover, published reports have demonstrated that LAM features antioxidant, immunopotentiator, antitumor and antivirus properties [7]. In addition, a large number of research works revealed that LAM displayed immune-modulatory effects in fish because of its binding capacity to different receptors on leukocytes, leading to the stimulation of immune responses including bactericidal activity, cytokine productivity, and survival fit ability at cellular levels [7,8,9,10,11]. For example, dietary LAM significantly increased the alkaline phosphatase activity, as well as enhanced the superoxide dismutase (SOD) activity of the Pearl gentian grouper [7]. Similarly, the supplementation of LAM in the diet significantly improved the SGR, as well as the lysozyme (LZM), catalase and superoxide dismutase activities of the grouper (Epinephelus coioides) [9]. More recently, Jiang et al. demonstrated that the expression levels of Toll-like receptor 5 and insulin-like growth factor 2 were remarkably promoted in Channel Catfish (Ictalurus punctatus) fed laminarin at a dose of 4 g kg−1 [11]. The above findings suggested that LAM could act as a beneficial supplement in the fish diet. However, little information is currently available about the impact of dietary LAM on the physiology and immune response of juvenile largemouth bass.
Furthermore, growing evidence revealed that dietary β-glucan could affect the intestinal flora of fish [12,13,14,15,16]. Meanwhile, the diversity and richness of intestinal microbiota affect a wide range of host physiological states including growth performance and immune response of the aquatic host [17,18,19]. For instance, Jung et al. stated that dietary β-glucan increased the diversity of the intestinal microbial community, which helps common carp (Cyprinus carpio) to prevent pathogenic microbes invasion [13]. Similarly, metagenomic analysis revealed that dietary β-glucan water (0.1 mg L−1) sharply increased the Chao richness value (p < 0.05), with a larger content of the Vibrionaceae family in Nile tilapia (Oreochromis niloticus) [15]. By contrast, a reduction of the intestinal microbiota richness was observed in common carp fed a β-glucan inclusion diet [12]. Therefore, the effect of dietary LAM on juvenile largemouth bass may also be associated with the intestinal microbiota variation.
In this study, four experimental diets were prepared with LAM supplementation levels of 0 (control), 5 g Kg−1 (LL), 10 g Kg−1 (ML) and 15 g Kg−1 (HL). A 28 day feeding trial was conducted to evaluate the effect of LAM on growth performance, antioxidant capacity and immune response, and explore how LAM influences the intestinal microbiota of juvenile largemouth bass.
2. Materials and Methods
2.1. Experimental Diets
Laminarin was purchased from Xiya Reagent (Xiya Reagent Co., Ltd., Linyi, China) with a purity of at least 99.5%, and laminarin was extracted from Laminaria digitateusing using the warm-water extraction method. Four diets were prepared with the supplementation of LAM: 0 (control), 5 g Kg−1 (LL group), 10 g Kg−1 (ML group) and 15 g Kg−1 (HL group). According to the formulation (Table 1), all ingredients were crushed through a 200 μm mesh and then blended with the fish oil and water through a mixing device [3]. Subsequently, pellets with a size of 1.0–2.0 mm were produced by using the pelletizer (KCHL-10, Kcth Group, Beijing, China) [19]. Then, the particle feed was dried in the air thermal dryer (50 ℃) (Longhe Machinery, Chaozhou, China) for further use.
Table 1.
Formulation and proximate composition of the experimental diets *.
| Ingredients (g kg−1) | Diets | |||
|---|---|---|---|---|
| Con | LL | ML | HL | |
| Fishmeal | 550 | 550 | 550 | 550 |
| Shrimp meal | 100 | 100 | 100 | 100 |
| Laminarin | 0 | 5 | 10 | 15 |
| Corn protein | 130 | 130 | 130 | 130 |
| Soybean meal | 60 | 60 | 60 | 60 |
| Soluble starch | 40 | 40 | 40 | 40 |
| Fish oil | 80 | 80 | 80 | 80 |
| Ca(H2PO4)2 | 10 | 10 | 10 | 10 |
| Mineral premix 1 | 10 | 10 | 10 | 10 |
| Vitamin premix 2 | 8 | 8 | 8 | 8 |
| Cr2O3 | 4 | 4 | 4 | 4 |
| Choline chloride | 3 | 3 | 3 | 3 |
| Threonine | 3 | 3 | 3 | 3 |
| Methionine | 2 | 2 | 2 | 2 |
| Proximate composition (%) | ||||
| Dry matter | 94.11 | 94.17 | 94.03 | 94.18 |
| Crude protein | 49.77 | 49.43 | 49.21 | 49.09 |
| Crude lipid | 9.53 | 9.50 | 9.44 | 9.39 |
| Ash | 10.78 | 10.62 | 10.72 | 10.69 |
* Con means control diet. LL, ML, and HL means 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively. 1 One kilogram of vitamin premix provided: zeolite, 638 mg; FeSO4·H2O, 300 mg; ZnSO4·H2O, 200 mg; MnSO4·H2O, 100 mg; NaCl, 100 mg; KIO3 (10%), 80 mg; Na2SeO3 (10% Se), 67 mg; CuSO4·5H2O, 10 mg; CoCl2·6H2O, 5 mg. 2 One kilogram of vitamin premix provided: vitamin C, 400 mg; vitamin E, 200 mg; inositol, 200 mg; niacinamide, 100 mg; calcium pantothenate, 40 mg; vitamin A, 20 mg; vitamin B6, 15 mg; vitamin B1, 12 mg; vitamin B2, 10 mg; folic acid, 10 mg; vitamin K3, 10 mg; vitamin D3, 10 mg; vitamin B12 (1%), 8 mg; biotin (2%), 2 mg.
2.2. Experimental Design
Juvenile largemouth bass (initial average weight: 0.72 ± 0.04 g) were obtained from Huzhou Baijiayu Biotech Co., Ltd. (Huzhou, China). The fish were cultured in circulating resin tanks with a constant water flow (100 L h−1) during the experimental period. Juvenile fish were fed with a commercial diet (Tianma Co., Ltd., Fuzhou, China) for a week before being fed experimental diets. A total of 480 juvenile fish were randomly assigned to four groups (40 fish per tank with 3 replicates in each group). They were fed regularly thrice daily (8:00 a.m., 14:00 p.m. and 20:00 p.m.) until apparent satiation. The feeding trial lasted 28 days, with the water temperature at 27.0 ± 1.0 ℃, pH = 7.2–7.5 and dissolved oxygen < 5.0 mg L−1.
2.3. Sampling
Before sampling, all juvenile largemouth bass were fasted for 24 h, and then anesthetized with tricaine methanesulfonate (MS-222) at a dose of 55 mg/L. Subsequently, all fish were sampled and sacrificed to measure the individual physiology. Twenty-four fish per replicate were dissected under sterile conditions to pull out the intestine, and then the mid intestine was cut into small pieces and washed with phosphate-buffered saline (PBS) (pH 7.5) to harvest the intestinal tissues and contents (four samples (each sample contains 6 fish) in each tank). Then, both of them were immediately stored at −80 °C in TRIzol reagent (Tiangen, Beijing, China) for RNA extraction. Nine fish per replicate were sampled and frozen by liquid nitrogen, and was stored in a −80 °C refrigerator for the analysis of flesh composition and antioxidant capacity, respectively.
2.4. Flesh Composition and Antioxidant Capacity Analysis
The AOAC method (AOAC, 2000) was used to analyze the proximate composition of flesh following our previous report [3]. The antioxidant indices of intestine, including superoxide dismutase (SOD), catalase (CAT), glutathione (GSH) and total antioxidant capacity (T-AOC), were measured by using commercial kits obtained from Jian Cheng Bioengineering Institute, (Nanjing, China) [20].
2.5. Relative Gene Expression Analysis
The relative expression of genes related to immune response in intestine was measured as described in our previous report [19]. Briefly, the primer sequences of tgf-β, tnf-α, il-1β and β-actin were designed as listed in Table 2. Total RNA was extracted from the intestinal tissues using Trizol reagent (Tiangen, Beijing, China). The final RNA was eluted in an appropriate amount of 0.1% diethyl pyrocarbonate (DEPC) treated water (Sigma-Aldrich, St. Louis, MO, USA). The RNA amount was determined using a Nanodrop 2000. Then, the cDNA was synthesized with the reverse transcription [19]. Subsequently, RT-qPCR was operated with following steps: 95 °C for 30 s; 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and 72 °C for 30 s. Expression of the selected genes was normalized to β-actin (internal reference) and reported as 2−ΔΔCt [21].
Table 2.
Real-time PCR primers sequences *.
| Gene | Sequence (5′-3′) | Tm (℃) | Product Size (bp) | Accession Number |
|---|---|---|---|---|
| il-1β | F: CGTGACTGACAGCAAAAAGAGG | 60 | 166 | XM_038733429.1 |
| R: GATGCCCAGAGCCACAGTTC | 61 | |||
| tnf-α | F: CTTCGTCTACAGCCAGGCATCG | 63 | 162 | XM_038710731.1 |
| R: TTTGGCCACACCGACCTCACC | 65 | |||
| tgf-β | F: GCTCAAAGAGAGCGAGGATG | 58 | 118 | XM_038693206.1 |
| R: TCCTCTACCATTCGCAATCC | 57 | |||
| β-actin | F: TGGAAGGGACCTCACAGACTAC | 61 | 231 | MH018565 |
| R: GGGCAACGGAACCTCTCAT | 60 |
* il-1β, interleukin-1β; tnf-α, tumor necrosis factor-α; tgf-β, transforming growth factor-β.
2.6. Sequencing of Intestinal Microorganisms
The intestinal contents were prepared for 16S rRNA sequence [19]. Briefly, the primers 338F 5′-ACTCCTACGGGAGGCAGCAG-3′ and 806R 5′-GGACTACHVGGTW TTAAT-3′ were used to amplify the V3-V4 region of the 16S ribosomal RNA gene. After purifying the amplicon DNA, the SMRTbell libraries were established by blunt-end ligation, which were then sequenced by Biomarker Technologies (Beijing, China). Finally, the intestinal microbiota analysis, including Principal component analysis (PCA), Venn diagram, Microbial community bar plots (MCBP) and Linear discriminant analysis Effect Size (LEfSe) were performed using the BMKCloud software (www.biocloud.net) (accessed on 8 November 2022).
2.7. Statistics Analysis
The data were shown as the mean ± standard deviations. Statistical analysis was performed by one-way ANOVA and Duncan’s multiple range test (DMRT), using the SPSS software (Version 20.0; SPSS, Inc). Differences with p < 0.05 were regarded to be statistically significant.
3. Results
3.1. Growth Performance
At the end of the feeding trial, the SGR of juvenile largemouth bass in the LL group was slightly higher than that of control, while dietary LAM inclusion at a dose of 15 g Kg−1 (HL group) remarkably increased the feed conversation rate (FCR) (p < 0.05), as well as marginally decreasing the SGR (p > 0.05). Moreover, juvenile fish in the LL group exhibited a considerably higher condition factor (CF) than that of fish in the ML and HL groups (p < 0.05). Meanwhile, no remarkable difference in HSI was observed among the four groups (p > 0.05) (Table 3).
Table 3.
Growth performance of juvenile largemouth bass fed the experimental diets for 28 days *.
| Item | Con | LL | ML | HL |
|---|---|---|---|---|
| IBW(g) | 0.72 ± 0.04 | 0.73 ± 0.02 | 0.72 ± 0.04 | 0.71 ± 0.04 |
| FBW(g) | 2.88 ± 0.21 | 3.00 ± 0.15 | 2.84 ± 0.30 | 2.75 ± 0.30 |
| WGR(%) | 297.38 ± 29.58 | 311.81 ± 19.85 | 296.37 ± 42.18 | 285.15 ± 42.30 |
| SGR(%/day) | 4.92 ± 0.56 | 5.05 ± 0.17 | 4.90 ± 0.37 | 4.80 ± 0.40 |
| Total feed intake (g) | 90.72 ± 2.12 | 92.62 ± 1.34 | 88. 19 ± 1.71 | 90.58 ± 1.86 |
| FCR | 1.05 ± 0.02 b | 1.02 ± 0.04 b | 1.04 ± 0.03 b | 1.11 ± 0.02 a |
| CF(g/cm³) | 1.04 ± 0.07 ab | 1.07 ± 0.07 a | 0.98 ± 0.06 b | 1.00 ± 0.05 b |
| HSI(%) | 1.76 ± 0.28 | 1.64 ± 0.04 | 1.67 ± 0.19 | 1.69 ± 0.14 |
* Data are shown as mean ± standard error (SEM; n = 3). Values in the same row with different superscripts are significantly different (p < 0.05). IBW means the initial body weight; FBW means the final body weight; WGR means the weight gain rate; SGR means the specific growth rate; FCR means the feed conversation rate; HSI means the hepatosomatic index; CF means the condition factor. Con means control diet. LL, ML, and HL mean 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively.
3.2. Flesh Composition
In this study, no significance of moisture and crude lipid content in fish flesh among four groups was observed (p > 0.05). Nevertheless, the minimum of flesh crude protein content was observed in the HL group (p < 0.05) (Table 4).
Table 4.
Effects of dietary laminarin inclusion on flesh composition of juvenile largemouth bass fed the experimental diets for 28 days *.
| Item | Con | LL | ML | HL |
|---|---|---|---|---|
| Moisture (%) | 73.54 ± 0.36 | 73.97 ± 0.17 | 73.86 ± 0.22 | 73.50 ± 0.31 |
| Crude protein (%) | 15.74 ± 0.45 a | 16.41 ± 0.38 a | 15.72 ± 0.33 ab | 15.42 ± 0.29 b |
| Crude lipid (%) | 3.76 ± 0.14 | 3.84 ± 0.07 | 3.75 ± 0.07 | 3.72 ± 0.09 |
* Data are shown as mean ± standard error (SEM; n = 3). Values in the same row with different superscripts are significantly different (p < 0.05). Con means control diet. LL, ML, and HL mean 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively.
3.3. Antioxidant-related Enzyme Activities
Compared with the control group, juvenile largemouth bass in the LL group exhibited considerably higher SOD, GSH and T-AOC activity, while fish in the ML and HL groups displayed significantly lower SOD and CAT activity (p < 0.05) (Figure 1).
Figure 1.
Antioxidant enzyme activities of the intestine in juvenile largemouth bass. (A) Superoxide dismutase; (B) Catalase; (C) Glutathione; (D) Total antioxidant capacity. Con means control diet. LL, ML, and HL mean 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively. Results are expressed as mean ± SEM (n = 3). Means in the same row with different letters were significantly different among groups (p < 0.05).
3.4. Relative Expression Levels of Immune Response Related Genes
The expression of il-1β and tnf-α was dramatically down-regulated in fish of the LL group, while it sharply increased in fish of the ML and HL groups (p < 0.05). Meanwhile, dietary LAM inclusion substantially increased the expression of tgf-β in fish of the LL group (p < 0.05) (Figure 2).
Figure 2.
Effects of dietary laminarin inclusion on transcriptional expression of juvenile largemouth bass intestine. Results are expressed as mean ± SEM (n = 3). Con means control diet. LL, ML, and HL mean 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively. Results are expressed as mean ± SEM (n = 3). Means in the same row with different letters were significantly different among groups (p < 0.05).
3.5. Intestinal Microbiota Changes
The 16 sRNA sequence analysis showed that 1,320,788 raw reads and 1,316,678 clean reads were obtained from 16 samples, with an average of 82,292 clean reads for each sample (Table S1). The microbiota diversity was calculated from the OTUs (Table 5), which revealed that these four indexes were significantly affected in LAM supplemented groups, where fish in the HL group exhibited the minimum values (p < 0.05). The heat map showed that the dominant genera were altered in LAM inclusion groups and the intra group differences are acceptable (Figure 3). Additionally, the PCA showed that the intestinal microbiota of fish in four experimental groups was grouped separately (Figure 4A).
Table 5.
Alpha diversity of intestinal microbiota of juvenile largemouth bass fed the experimental diets for 28 days *.
| Item | Con | LL | ML | HL |
|---|---|---|---|---|
| ACE | 3931.84 ± 735.78 a | 1722.66 ± 130.31 c | 2976.99 ± 137.85 b | 221.94 ± 43.89 d |
| Shannon | 10.74 ± 0.16 a | 8.00 ± 0.27 c | 9.03 ± 0.04 b | 2.91 ± 0.14 d |
| Simpson | 1.00 ± 0.00 a | 0.97 ± 0.02 b | 0.99 ± 0.00 a | 0.78 ± 0.01 c |
| Chao1 | 3927.94 ± 732.99 a | 1720.83 ± 130.43 c | 2966.06 ± 138.33 b | 220.46 ± 44.03 d |
* Con means control diet. LL, ML, and HL mean 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively. Different letters on the bars indicate statistically significant differences (p < 0.05).
Figure 3.
The heat map of intestinal microbiota of largemouth bass fed with four experimental diets. Con means control diet. LL, ML, and HL mean 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively.
Figure 4.
The principal component analysis and Venn diagram of intestinal microbiota of largemouth bass. (A) The principal component analysis. (B) The Venn diagram. Con means control diet. LL, ML, and HL mean 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively.
Moreover, the Venn diagram showed that fish in the control group had the largest number of OTU, while fish in the LL group exhibited the minimum OTU (Figure 4B). MCBP displayed that Proteobacteria was the dominant phyla in the control and LL groups, followed by Firmicutes and Bacteroidetes at phylum level (Figure 5A). The Firmicutes/Bacteroidetes ratio in the control, LL, ML and HL groups was 1.40, 4.00, 0.88 and 19.05, respectively (Table S2). Moreover, unclassified_Bacteria was the major taxon, followed by unclassified_Cyanobacteriales and Bacteroides in the control group. Mycoplasma was the main taxon in the LL group, followed by Comamonas and Plesiomonas. Plesiomonas was the dominate taxon in the ML group, followed by unclassified_Cyanobacteriales and Cyanobium. In the HL group, Aeromonas was the primary taxon, followed by Plesiomonas and Mycoplasma at genus level (Figure 5B). The LEfSe analysis showed that the Bacteroide, Comamonas and Mycoplasma content in the LL group, and the Aeromonas, Brevinama and Plesiomona content in the HL groups, was remarkably higher than that of the control at genus level (p < 0.05) (Figure 5C–E).
Figure 5.
Intestinal microbiota changes between control and laminarin supplemented groups of juvenile largemouth bass. (A) The bar plots at phylum level. (B) The bar plots at genus level. (C) The Lefse analysis of differential flora between control and laminarin Scheme 4. 0. (D) The LDA scores of different microbes between control and laminarin supplemented groups. (E) The relative abundance of microbes with significant difference. Values in rows with different superscript letters have significant differences (p < 0.05). Con means control diet. LL, ML, and HL mean 5 g Kg−1, 10 g Kg−1 and 15 g Kg−1 laminarin was supplemented into diets, respectively.
4. Discussion
LAM supplementation has been shown to improve growth in a variety of animals, including weaned piglets [22,23,24], grouper (E. coioides) [9], Channel Catfish (I. punctatus) [11], and Pearl gentian grouper (Epinephelus lanceolatus ♀ × Epinephelus fuscoguttatuss ♂) [6]. In aquatic animals, previous study has demonstrated that dietary LAM inclusion at 5 and 10 g kg−1 dramatically increased the WGR of grouper (mean weight 90 ± 2.6 g) compared to that of fish in the 15 g kg−1 inclusion group and control group for 48 days [9]. Similar results have been determined in studies of Channel Catfish (average weight is 1.3 ± 0.3 g), with a significant increase of WGR and SGR in fish fed LAM at 4 and 8 g kg−1 for 45 days [11]. In our study, no significant differences of WGR and SGR were observed in juvenile largemouth bass fed with LAM (p > 0.05), while dietary LAM inclusion at 15 g kg−1 considerably increased the FCR (p < 0.05) for 28 days. These discrepancies may be attributable to the fish species and developmental stages difference, as well as the short period of the feeding trial in this study, so the effect of LAM on juvenile largemouth bass in a longer feeding trail (8 weeks or more) should be investigated in further research. Meanwhile, the results also indicated that a high level of LAM additive in the diet may negatively affect fish growth and other physiological functions. In addition, juvenile fish in the LL group exhibited significantly higher CF than that of fish in the ML and HL groups (p < 0.05), which might be due to the higher concentration of crude protein and lipids in the diet of the LL group.
β-glucan has been previously assessed as an immunopotentiating agent for enhancing fish immunity to stress and disease [24,25,26,27,28]. Antioxidant capacity is the fundamental cytoprotective mechanism against oxidative stress in fish tissues [29,30]. Previous reports have demonstrated that a higher level of activities of SOD and CAT was determined in common carp after intraperitoneal injection with β-glucan for 15 days [26]. As an oral additive, fucoidan (10 g kg−1) and Halymenia 9ilatate-derived polysaccharide (1.0 and 2.0 g kg−1) supplemented in diet enhanced the antioxidant capacity of O. niloticus, respectively [31,32]. Similarly, dietary chitosan (5.0 g kg−1 feed) also significantly increased the antioxidant enzyme activity in loach fish (Misgurnus anguillicadatus) [33]. Consistently, in our work, dietary LAM at a dose of 5.0 g kg−1 remarkably enhanced the T-AOC, SOD and GSH activity, while high dose supplementation (10 and 15 g kg−1) significantly decreased the CAT and SOD activity. This tendency of the low concentration to promote antioxidant capacity and high concentration inhibition antioxidant capacity was similar to that of the experiment in red swamp crayfish [34]. The reason that higher levels of LAM supplementation in the diet decreased the CAT and SOD activity might be that the feed composition greatly changed, which should be investigated in further research.
Receptor-bound β-glucan may mediate the production of inflammatory cytokines (interleukins, interferons and tumor necrosis factor). These signaling proteins are believed to aggravate the phagocytic activity of immune cells through oxidative burst and natural cytotoxic liquidation [6]. tnf-α is a key pro-inflammatory cytokine, which acts as an important mediator in the regulation of inflammatory response, and induces the gene expression of some pro-inflammatory factors, such as il-1β [35]. A published report demonstrated that lower expression patterns of il-1β and tnf-α were found in juvenile carp fed with β-glucan supplements (6 mg kg−1 body weight) for 14 days [36]. Similar depressed expression patterns of il-1β and tnf-α were also determined in turbot (Scophthalmus maximus) fed inclusion with β-glucan for 24 days [13]. Consistently, the expression of tnf-α and il-1β were significantly decreased in largemouth bass fed a diet containing 5 g Kg−1 LAM for 28 days in the present study. Nevertheless, Yin et al. informed that dietary LAM at a low dose (0.5%) for 48 days sharply reduced the mRNA level of il-1β in grouper [8]. Collectively, the above finds suggested that the effect of LAM on fish immune related gene expression might rely on the fish species and administration period. Moreover, dietary LAM at a low dose (5 g Kg−1) remarkably increased the expression of tgf-β in this work. It was well demonstrated that tgf-β could depress the production of pro-inflammatory cytokine, and further inhibit the inflammatory response in teleost [37]. This opposite change trend of il-1β and tgf-β expression was similar to the result in some other fish species [38,39]. Overall, the down-regulated expression of il-1β and tnf-α, up-regulated expression of tgf-β, as well as the elevated antioxidant enzyme activity, confirmed the contribution of dietary LAM inclusion at the concentration of 5 g Kg−1 in enhancing the immune response and antioxidant capacity of juvenile largemouth bass.
Notably, dietary LAM inclusion can modify intestinal microbiota in the present study. Our microbiota analysis displayed that Proteobacteria and Firmicutes were the two dominant taxon in the control and LL groups at phylum level, which is consistent with published reports on juvenile largemouth bass [20,40,41]. However, with the increase of LAM addition, the Proteobacteria content remarkably increased in ML and LL groups. Published reports have confirmed that an increase in Proteobacteria is often considered an important symbol of intestinal microbiota instability, which may give rise to nutritional and metabolic disorders of the host [41,42]. Moreover, the Firmicutes/Bacteroidetes ratio was 1.40, 4.00, 0.88 and 19.05 in the Con, LL, ML and HL groups, respectively. It was reported that the Firmicutes/Bacteroidetes ration reflected the ability of nutrient transportation and utilization [43,44], while in the HL group most of the identified species of Proteobacteria were Plesiomonas, Aeromonas and Brevinema, which usually exist in intestines of aquatic animals, and are recognized as potential pathogens of fishes [45,46,47]. Moreover, our data also revealed that the Mycoplasma, Bacteroide and Comamonas abundance in LL groups was remarkably higher than that of the control. Growing evidence showed that Mycoplasma was the major species existing in healthy largemouth bass intestine [3,40,48,49,50,51], which might play a certain role in the growth and reproduction of fish [52,53]. Bacteroides can generate many organic acids [54,55], which have been evidenced successfully in alleviating intestinal inflammation in fish [56]. Comamonas is extensively distributed in soil and contributes to organic biodegradation by reducing Fe3+/HS, which is considered a beneficial intestinal bacteria [57] and can be employed as a probiotic additive [58]. Overall, these results suggested that dietary LAM (5 g Kg−1) can increase the beneficial bacteria abundance in the intestine and, further, may positively affect the physiological performance, while an excessive addition of LAM led to an increase of pathogenic bacteria in the juvenile largemouth bass intestine.
5. Conclusions
The present complementary analysis of growth performance, immune response and intestinal microbiota in LAM supplemented diets in juvenile largemouth bass indicated that the supplementation of the LAM at the dose of 5 g Kg−1 is suggested as a promising immunopotentiator without negative effects on the growth performance for juvenile largemouth bass.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani13030459/s1, Table S1: Raw reads and clean reads of 16 sRNA sequence; Table S2: The Firmicutes/Bacteroidetes ratio.
Author Contributions
Conceptualization, H.F.; Methodology, H.F. and S.Y.; Investigation, Y.C., Y.W. and S.Q.; Writing—Original draft, Y.C. and Y.W.; Data curation, Y.W., Y.C. and S.Y.; Resources, W.Z. and S.Q.; Supervision, H.F.; Funding acquisition, H.F. and S.Y.; Writing—Review and Editing, H.F., M.H. and S.Y. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
All experimental protocols were conducted in compliance with the relevant provisions for welfare ethics and the protection of experimental animals in the state and Zhejiang Province.
Informed Consent Statement
Not applicable.
Data Availability Statement
All 16s amplicon sequencing data have been submitted to NCBI with the accession number PRJNA904939. Other data not presented in article are available upon reasonable request.
Conflicts of Interest
All authors declare that they have no conflict of interest.
Funding Statement
This research was funded by the National Natural Science Foundation of China (No. 81973233) and Fundamental Research Funds of Zhejiang Sci-Tech University (No. 11612831632231).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Zhong Y.F., Shi C.M., Zhou Y.L., Chen Y.J., Lin S.M., Tang R.J. Optimum dietary fiber level could improve growth, plasma biochemical indexes and liver function of largemouth bass, Micropterus salmoides. Aquaculture. 2020;518:734661. doi: 10.1016/j.aquaculture.2019.734661. [DOI] [Google Scholar]
- 2.Rossi W., Jr., Allen K.M., Habte-Tsion H.-M., Meesala K.-M. Supplementation of glycine, prebiotic, and nucleotides in soybean mealbased diets for largemouth bass (Micropterus salmoides): Effects on production performance, whole-body nutrient composition and retention, and intestinal histopathology. Aquaculture. 2021;532:736031. doi: 10.1016/j.aquaculture.2020.736031. [DOI] [Google Scholar]
- 3.Fei H., Cheng Y., Zhang H., Yu X., Yi S., Huang M., Yang S. Effect of Autolyzed Yarrowia lipolytica on the Growth Performance, Antioxidant Capacity, Intestinal Histology, Microbiota, and Transcriptome Profile of Juvenile Largemouth Bass (Micropterus salmoides) Int. J. Mol. Sci. 2022;23:10780. doi: 10.3390/ijms231810780. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Khanjani M., Sharifinia M., Ghaedi G. β-glucan as a promising food additive and immunostimulant in aquaculture industry. Ann. Anim. Sci. 2021;22:817–827. doi: 10.2478/aoas-2021-0083. [DOI] [Google Scholar]
- 5.Rioux L.E., Turgeon S.L., Beaulieu M. Structural characterization of laminaran and galactofucan extracted from the brown seaweed Saccharina longicruris. Phytochemistry. 2010;71:1586–1595. doi: 10.1016/j.phytochem.2010.05.021. [DOI] [PubMed] [Google Scholar]
- 6.Hadiuzzaman M., Moniruzzaman M., Shahjahan M., Bai S.C., Min T., Hossain Z. β-Glucan: Mode of Action and Its Uses in Fish Immunomodulation. Front. Mar. Sci. 2022;9:905986. doi: 10.3389/fmars.2022.905986. [DOI] [Google Scholar]
- 7.Lin J.B., Liang P., Zhu Q.G., Qiu M.L. Effect of Laminarin on Growth and Immunity of Pearl Gentian Grouper. Anim. Husb. Feed Sci. 2017;9:259–262. [Google Scholar]
- 8.Schmitt P., Morales-Lange B., Bethke J., Mercado L. Immunostimulatory effect of beta-glucans in rainbow trout (Oncorhynchus mykiss) Fish Shellfish Immun. 2013;34:1736–1737. doi: 10.1016/j.fsi.2013.03.308. [DOI] [Google Scholar]
- 9.Yin G.W., Li W.W., Lin Q., Lin X., Lin J.B. Dietary administration of laminarin improves the growth performance and immune responses in Epinephelus coioides. Fish Shellfish Immun. 2014;41:402–406. doi: 10.1016/j.fsi.2014.09.027. [DOI] [PubMed] [Google Scholar]
- 10.Carballo C., Chronopoulou E.G., Letsiou S., Maya C., Labrou N.E., Infante C., Power D., Manchado M. Antioxidant capacity and immunomodulatory effects of a chrysolaminarin-enriched extract in Senegalese sole. Fish Shellfish Immun. 2018;82:1–8. doi: 10.1016/j.fsi.2018.07.052. [DOI] [PubMed] [Google Scholar]
- 11.Jiang H., Wang M., Zheng Y., Chen F.W., Fu L.L., Zhong L., Chen X., Bian W. Dietary laminarin administration to enhance the immune responses, promote growing and strengthen physique in Ictalurus punctatus. Aquacul. Nutr. 2021;27:1181–1191. doi: 10.1111/anu.13258. [DOI] [Google Scholar]
- 12.Kuhlwein H., Emery M.J., Rawling M.D., Harper G.M., Merrifield D.L., Davies S.J. Effects of a dietary beta-(1,3)(1,6)-D-glucan supplementation on intestinal microbial communities and intestinal ultrastructure of mirror carp (Cyprinus carpio L.) J. Appl. Microbiol. 2013;115:1091–1106. doi: 10.1111/jam.12313. [DOI] [PubMed] [Google Scholar]
- 13.Jung-Schroers V., Adamek M., Jung A., Harris S., Doza O.S., Baumer A., Steinhagen D. Feeding of beta-1,3/1,6-glucan increases the diversity of the intestinal microflora of carp (Cyprinus carpio) Aquacul. Nutr. 2016;22:1026–1039. doi: 10.1111/anu.12320. [DOI] [Google Scholar]
- 14.Miest J.J., Arndt C., Adamek M., Steinhagen D., Reusch T.B. Dietary beta-glucan (MacroGard) enhances survival of first feeding turbot (Scophthalmus maximus) larvae by altering immunity, metabolism and microbiota. Fish Shellfish Immun. 2016;48:94–104. doi: 10.1016/j.fsi.2015.11.013. [DOI] [PubMed] [Google Scholar]
- 15.de Souza F.P., de Lima E., Pandolfi V., Leite N., Furlan-Murari P., Leal C.N.S., Mainardi R.M., Suphoronski S.A., Favero L.M., Koch J.F.A., et al. Effect of beta-glucan in water on growth performance, blood status and intestinal microbiota in tilapia under hypoxia. Aquacult. Rep. 2020;17:100369. doi: 10.1016/j.aqrep.2020.100369. [DOI] [Google Scholar]
- 16.Liang H., Li Y., Li M., Zhou W., Chen J., Zhang Z., Yang Y., Ran C., Zhou Z. The effect and underlying mechanism of yeast β-glucan on antiviral resistance of zebrafish against spring viremia of carp virus infection. Front. Immunol. 2022;13:1031962. doi: 10.3389/fimmu.2022.1031962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Baldridge M.T., Nice T.J., McCune B.T., Yokoyama C.C., Kambal A., Wheadon M., Diamond M.S., Ivanova Y., Artyomov M., Virgin H.W. Commensal microbes and interferon-λ determine persistence of enteric murine norovirus infection. Science. 2015;347:266–269. doi: 10.1126/science.1258025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Su S., Jing X., Zhang C., Hou Y., Li Z., Yang X., Zhou X., Xu P., Tang Y., Zhu J. Interaction Between the Intestinal Microbial Community and Transcriptome Profile in Common Carp (Cyprinus carpio L.) Front. Microbiol. 2021;12:659602. doi: 10.3389/fmicb.2021.659602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Fei H., Yi S.F., Zhang H.M., Cheng Y., Zhang Y.Q., Yu X., Qian S.C., Huang M.M., Yang S. Transcriptome and 16S rRNA analysis revealed the response of largemouth bass (Micropterus salmoides) to Rhabdovirus infection. Front. Immunol. 2022;13:973422. doi: 10.3389/fimmu.2022.973422. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Liu Y., Lu Q., Xi L., Gong Y., Su J., Han D., Zhang Z., Liu H., Jin J., Yang Y., et al. Effects of Replacement of Dietary Fishmeal by Cottonseed Protein Concentrate on Growth Performance, Liver Health, and Intestinal Histology of Largemouth Bass (Micropterus salmoides) Front. Physiol. 2021;12:764987. doi: 10.3389/fphys.2021.764987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wang S., Han Z., Turchini G.M., Wang X., Fang Z., Chen N., Xie R., Zhang H., Li S. Effects of Dietary Phospholipids on Growth Performance, Digestive Enzymes Activity and Intestinal Health of Largemouth Bass (Micropterus salmoides) Larvae. Front. Immunol. 2022;12:827946. doi: 10.3389/fimmu.2021.827946. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.O’Doherty J.V., McDonnell P., Figat S. The effect of dietary laminarin and fucoidan in the diet of the weanling piglet on performance and selected faecal microbial populations. Livest. Sci. 2020;134:208–210. doi: 10.1016/j.livsci.2010.06.143. [DOI] [PubMed] [Google Scholar]
- 23.Rattigan R., Sweeney T., Maher S., Thornton K., Rajauria G., O’Doherty J.V. Laminarin-rich extract improves growth performance, small intestinal morphology, gene expression of nutrient transporters and the large intestinal microbial composition of piglets during the critical post-weaning period. Br. J. Nutr. 2020;123:255–263. doi: 10.1017/S0007114519002678. [DOI] [PubMed] [Google Scholar]
- 24.Rattigan R., Sweeney T., Maher S., Ryan M.T., Thornton K., O’Doherty J.V. Effects of reducing dietary crude protein concentration and supplementation with either laminarin or zinc oxide on the growth performance and intestinal health of newly weaned pigs. Anim. Feed Sci. Technol. 2021;270:114693. doi: 10.1016/j.anifeedsci.2020.114693. [DOI] [Google Scholar]
- 25.Kim Y.S., Ke F., Zhang Q.Y. Effect of beta-glucan on activity of antioxidant enzymes and Mx gene expression in virus infected grass carp. Fish Shellfish Immun. 2009;27:336–340. doi: 10.1016/j.fsi.2009.06.006. [DOI] [PubMed] [Google Scholar]
- 26.Yamamoto F.Y., Castillo S., de Cruz C.R., Chen K., Hume M.E., Gatlin D.M., III. Synergistic Effects of the β-1,3 Glucan Paramylon and Vitamin C on Immunological Responses of Hybrid Striped Bass (Morone Chrysops × M. Saxatilis) Were Pronounced In Vitro But More Moderate In Vivo. Aquaculture. 2020;526:735394. doi: 10.1016/j.aquaculture.2020.735394. [DOI] [Google Scholar]
- 27.Yamamoto F.Y., Yin F., Rossi W., Jr., Hume M., Gatlin D.M., III. β-1,3 Glucan Derived from Euglena Gracilis and Algamune™ Enhances Innate Immune Responses of Red Drum (Sciaenops Ocellatus L.) Fish Shellfish Immun. 2018;77:273–279. doi: 10.1016/j.fsi.2018.04.003. [DOI] [PubMed] [Google Scholar]
- 28.El-Murr A.I., Abd El Hakim Y., Neamat-Allah A.N.F., Baeshen M., Ali H.A. Immune-protective, antioxidant and relative genes expression impacts of beta-glucan against fipronil toxicity in Nile tilapia, Oreochromis niloticus. Fish Shellfish Immun. 2019;94:427–433. doi: 10.1016/j.fsi.2019.09.033. [DOI] [PubMed] [Google Scholar]
- 29.Ozcan O., Sevgiler N. Tissue-specific oxidative stress responses in fish exposed to 2,4-D and azinphosmethyl. Comp. Biochem. Physiol. Part C. 2004;137:43–51. doi: 10.1016/j.cca.2003.11.006. [DOI] [PubMed] [Google Scholar]
- 30.Olsvika P.A., Kristensen T., Waagbø R., Rosseland B.O., Tollefsen K.-E. mRNA expression of antioxidant enzymes (SOD, CAT and GSH-Px) and lipid peroxidative stress in liver of Atlantic salmon (Salmo salar) exposed to hyperoxic water during smoltification. Comp. Biochem. Physiol. Part C. 2005;141:314–323. doi: 10.1016/j.cbpc.2005.07.009. [DOI] [PubMed] [Google Scholar]
- 31.Abdel-Daim M.M., Dawood M.A.O., Aleya L., Alkahtani S. Effects of fucoidan on the hematic indicators and antioxidative responses of Nile tilapia (Oreochromis niloticus) fed diets contaminated with aflatoxin B(1) Environ. Sci. Pollut. R. 2020;27:12579–12586. doi: 10.1007/s11356-020-07854-w. [DOI] [PubMed] [Google Scholar]
- 32.Vinosha M., Palanisamy S., Anjali R., Li C., Yelithao K. Sulphated galactan from Halymenia dilatata enhance the antioxidant properties and prevents Aeromonas hydrophila infection in tilapia fish: In vitro and in vivo study. Int. J. Biol. Macromol. 2020;158:569–579. doi: 10.1016/j.ijbiomac.2020.04.212. [DOI] [PubMed] [Google Scholar]
- 33.Chen J., Chen L. Effects of chitosan-supplemented diets on the growth performance, nonspecific immunity and health of loach fish (Misgurnus anguillicadatus) Carbohyd. Polym. 2019;225:115227. doi: 10.1016/j.carbpol.2019.115227. [DOI] [PubMed] [Google Scholar]
- 34.Huang Q., Zhu Y.L., Yu J., Fang L., Li Y.A. Effects of sulfated beta-glucan from Saccharomyces cerevisiae on growth performance, antioxidant ability, nonspecific immunity, and intestinal flora of the red swamp crayfish (Procambarus clarkii) Fish Shellfish Immun. 2022;127:891–900. doi: 10.1016/j.fsi.2022.06.056. [DOI] [PubMed] [Google Scholar]
- 35.Zou J., Peddie S., Scapigliati G., Zhang Y., Bols N.C., Ellis A.E. Functional Characterisation of the Recombinant Tumor Necrosis Factors in Rainbow Trout, Oncorhynchus mykiss. Dev. Comp. Immunol. 2013;27:813–822. doi: 10.1016/S0145-305X(03)00077-6. [DOI] [PubMed] [Google Scholar]
- 36.Falco A., Frost P., Miest J., Pionnier N., Irnazarow I., Hoole D. Reduced inflammatoryb response to Aeromonas salmonicida infection in common carp (Cyprinus carpio L.) fed with β-glucan supplements. Fish Shellfish Immun. 2012;32:1051–1057. doi: 10.1016/j.fsi.2012.02.028. [DOI] [PubMed] [Google Scholar]
- 37.Yang X., Wei H., Qin L., Zhang S., Wang X., Zhang A. Reciprocal interaction between fish tgf-β1 and il-1β is responsible for restraining il-1β signaling activity in grass carp head kidney leukocytes. Dev. Comp. Immunol. 2014;47:197–204. doi: 10.1016/j.dci.2014.07.023. [DOI] [PubMed] [Google Scholar]
- 38.Feng L., Chen Y.P., Jiang W.D., Liu Y., Jiang J., Wu P. Modulation of Immune Response, Physical Barrier and Related Signaling Factors in the Gills of Juvenile Grass Carp (Ctenopharyngodon Idella) Fed Supplemented Diet with Phospholipids. Fish Shellfish Immun. 2016;48:79–93. doi: 10.1016/j.fsi.2015.11.020. [DOI] [PubMed] [Google Scholar]
- 39.Tan P., Dong X., Mai K., Xu W., Ai Q. Vegetable Oil Induced Inflammatory Response by Altering TLR-NF-kb Signalling, Macrophages Infiltration and Polarization in Adipose Tissue of Large Yellow Croaker (Larimichthys Crocea) Fish Shellfish Immun. 2016;59:398–405. doi: 10.1016/j.fsi.2016.11.009. [DOI] [PubMed] [Google Scholar]
- 40.Zhou M., Liang R., Mo J., Yang S., Gu N., Wu Z., Babu V.S., Li J., Huang Y., Lin L. Effects of brewer’s yeast hydrolysate on the growth performance and the intestinal bacterial diversity of largemouth bass (Micropterus salmoides) Aquaculture. 2018;484:139–144. doi: 10.1016/j.aquaculture.2017.11.006. [DOI] [Google Scholar]
- 41.Xv Z., Zhong Y., Wei Y., Zhang T., Zhou W., Jiang Y., Chen Y., Lin S. Yeast culture supplementation alters the performance and health status of juvenile largemouth bass (Micropterus salmoides) fed a high-plant protein diet. Aquacul. Nutr. 2021;27:2637–2650. doi: 10.1111/anu.13391. [DOI] [Google Scholar]
- 42.Shin N.R., Whon T.W., Bae J.W. Proteobacteria: Microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015;33:496–503. doi: 10.1016/j.tibtech.2015.06.011. [DOI] [PubMed] [Google Scholar]
- 43.Feng Z., Zhong Y., He G., Sun H., Chen Y., Zhou W., Lin S. Yeast culture improved the growth performance, liver function, intestinal barrier and microbiota of juvenile largemouth bass (Micropterus salmoides) fed high-starch diet. Fish Shellfish Immun. 2022;120:706–715. doi: 10.1016/j.fsi.2021.12.034. [DOI] [PubMed] [Google Scholar]
- 44.Stojanov S., Berlec A., Štrukelj B. The Influence of Probiotics on the Firmicutes/Bacteroidetes Ratio in the Treatment of Obesity and Inflammatory Bowel disease. Microorganisms. 2020;8:1715. doi: 10.3390/microorganisms8111715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Behera B.K., Bera A.K., Paria P., Das A., Parida P.K., Kumari S., Bhowmick S., Das B.K. Identification and pathogenicity of Plesiomonas shigelloides in Silver Carp. Aquaculture. 2018;493:314–318. doi: 10.1016/j.aquaculture.2018.04.063. [DOI] [Google Scholar]
- 46.Wang R., Pan X., Xu Y. Altered Intestinal Microbiota Composition Associated with Enteritis in Yellow Seahorses Hippocampus kuda (Bleeker, 1852) Curr. Microbiol. 2020;77:730–737. doi: 10.1007/s00284-019-01859-6. [DOI] [PubMed] [Google Scholar]
- 47.Yuan X.Y., Zhang X.T., Xia Y.T., Zhang Y.Q., Wang B., Ye W.W., Ye Z.F., Qian S.C., Huang M.M., Yang S., et al. Transcriptome and 16S rRNA analyses revealed differences in the responses of largemouth bass (Micropterus salmoides) to early Aeromonas hydrophila infection and immunization. Aquaculture. 2021;541:736759. doi: 10.1016/j.aquaculture.2021.736759. [DOI] [Google Scholar]
- 48.Chen W., Chang K., Chen J., Zhao X., Gao S. Dietary sodium butyrate supplementation attenuates intestinal inflammatory response and improves gut microbiota composition in largemouth bass (Micropterus salmoides) fed with a high soybean meal diet. Fish Physiol. Biochem. 2021;47:1805–1819. doi: 10.1007/s10695-021-01004-w. [DOI] [PubMed] [Google Scholar]
- 49.Xu F.M., Hou S.W., Wang G.X., Gong J.Y., Zhou L., Gao S. Effects of zymolytic black soldier fly (Hermetia illucens) pulp as dietary supplementation in largemouth bass (Micropterus salmoides) Aquacul. Rep. 2021;21:100823. doi: 10.1016/j.aqrep.2021.100823. [DOI] [Google Scholar]
- 50.Yang H., Bian Y., Huang L., Lan Q., Ma L., Li X., Leng X. Effects of replacing fish meal with fermented soybean meal on the growth performance, intestinal microbiota, morphology and disease resistance of largemouth bass (Micropterus salmoides) Aquacul. Rep. 2022;22:100954. doi: 10.1016/j.aqrep.2021.100954. [DOI] [Google Scholar]
- 51.Xie X., Wang J., Guan Y., Xing S., Liang X., Xue M., Wang J., Chang Y., Leclercq E. Cottonseed protein concentrate as fishmeal alternative for largemouth bass (Micropterus salmoides) supplemented a yeast-based paraprobiotic: Effects on growth performance, gut health and microbiome. Aquaculture. 2022;551:737898. doi: 10.1016/j.aquaculture.2022.737898. [DOI] [Google Scholar]
- 52.Lian C.-A., Yan G.-Y., Huang J.-M., Danchin A., Wang Y., He L.-S. Genomic Characterization of a Novel Gut Symbiont from the Hadal Snailfish. Front. Microbiol. 2020;10:2978. doi: 10.3389/fmicb.2019.02978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Cheaib B., Yang P., Kazlauskaite R., Lindsay E., Heys C., Dwyer T., De Noia M., Schaal P., Sloan W., Ijaz U., et al. Genome erosion and evidence for an intracellular niche-Exploring the biology of mycoplasmas in Atlantic salmon. Aquaculture. 2021;541:736772. doi: 10.1016/j.aquaculture.2021.736772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Macfarlane G.T., Macfarlane S. Bacteria, colonic fermentation, and gastrointestinal health. J. AOAC Int. 2012;95:50–60. doi: 10.5740/jaoacint.SGE_Macfarlane. [DOI] [PubMed] [Google Scholar]
- 55.Zhang J., Song L., Wang Y., Liu C., Zhang L., Zhu S., Liu S., Duan L. Beneficial effect of butyrate-producing Lachnospiraceae on stress-induced visceral hypersensitivity in rats. J. Gastroen. Hepatol. 2019;34:1368–1376. doi: 10.1111/jgh.14536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Ng W.-K., Koh C.-B. The utilization and mode of action of organic acids in the feeds of cultured aquatic animals. Rev. Aquacult. 2017;9:342–368. doi: 10.1111/raq.12141. [DOI] [Google Scholar]
- 57.Zhang Q.-L., Li H.-W., Wu W., Zhang M., Guo J., Deng X.-Y., Wang F., Lin L.-B. The Response of Microbiota Community to Streptococcus agalactiae Infection in Zebrafish Intestine. Front. Microbiol. 2019;10:2848. doi: 10.3389/fmicb.2019.02848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Wang Y., Wu C., Zhou S. Isolation and identification of a humic substance and Fe(III)-reducing bacterial strain. J. Lanzhou Univ. 2010;46:56–65. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All 16s amplicon sequencing data have been submitted to NCBI with the accession number PRJNA904939. Other data not presented in article are available upon reasonable request.





