Skip to main content
NCBI home page
Open Life Sciences logoLink to Open Life Sciences
. 2023 Feb 9;18(1):20220554. doi: 10.1515/biol-2022-0554

Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1

Jin Shu 1,#, Jue Shi 1,#, Yiwen Gu 1, Lei Deng 1, Chen Zhao 1, Chun Wu 1, Jiachen Zhao 1, Haiya Wang 2,✉, Li Jin 1,✉
PMCID: PMC9922061  PMID: 36816804

Abstract

This study aimed to explore the effects of tissue inhibitor of metalloproteinases‐1 (TIMP‐1) on levocarnitine (LC)-mediated regulation of angiotensin II (AngII)-induced myocardial fibrosis (MF) and its underlying mechanisms. H9C2 cells were treated with AngII for 24 h to induce fibrosis. The cells were then treated with LC or transfected with TIMP‐1-OE plasmid/si‑TIMP‐1. Cell apoptosis, viability, migration, and related gene expression were analyzed. AngII treatment significantly upregulated Axl, α-SMA, and MMP3 expression (P < 0.05) and downregulated STAT4 and TIMP1 expression (P < 0.05) relative to the control levels. After transfection, cells with TIMP-1 overexpression/knockdown were successfully established. Compared with that of the control, AngII significantly inhibited cell viability and cell migration while promoting cell apoptosis (P < 0.05). LC and TIMP-1-OE transfection further suppressed cell viability and migration induced by Ang II and upregulated apoptosis, whereas si-TIMP-1 had the opposite effect. Furthermore, LC and TIMP-1-OE transfection downregulated Axl, AT1R, α-SMA, collagen III, Bcl-2, and MMP3 expression caused by AngII and upregulated caspase 3, p53, and STAT4 expression, whereas si-TIMP-1 had the opposite effect. TIMP-1 is therefore a potential therapeutic target for delaying MF progression.

Keywords: tissue inhibitor of metalloproteinases-1, myocardial fibrosis, levocarnitine, angiotensin II

1. Introduction

Heart failure (HF) is a global threat affecting 23 million people worldwide, and its prevalence continues to increase over time [1]. At a certain stage, myocardial fibrosis (MF) may be the leading cause of vasomotor dysfunction and myocardial disarray in various cardiovascular diseases, characterized by myocardial structural destruction, excessive cardiac interstitial fibroblast proliferation, and deposition [2,3]. Among patients with coronary artery disease, MF is strongly associated with sudden cardiac death [4] and long-term mortality in patients with HF [5]; thus, inhibiting MF progression is highly important. However, current therapeutics, including β-blockers, endothelin antagonists, ATI receptor antagonists, angiotensin-converting enzymes, and statins, usually display significant adverse effects [6,7]. Therefore, there is an urgent need to further explore the pathogenesis of MF and identify novel therapeutic targets to delay MF and improve HF outcomes.

Levocarnitine (LC) has good therapeutic potential for treating cardiovascular disease (HF and myocardial infarction), and a large body of experimental and clinical evidence supports the role of LC in suppressing fibrosis progression [8,9]. LC can improve angiotensin II (AngII)-induced reactive oxygen species (ROS) generation, AT1R expression, and collagen accumulation, thereby inhibiting cardiac fibrosis [10]. Zhao et al. showed that LC could inhibit the expression of proinflammatory and profibrotic cytokines and decrease intracellular production of ROS, followed by a significant reduction in renal tubulointerstitial inflammation and fibrosis [11]. Another study reported that LC protected against cardiac and renal damage by inhibiting oxidative stress and increasing antioxidant enzyme function by inhibiting TNF-α and IL-1β in isoprenaline-treated MI rat models [12]. These reports indicate that LC may affect fibrosis and protect cardiac function; however, the mechanisms of LC in MF progression remain unclear.

Tissue inhibitors of matrix metalloproteinases-1 (TIMP-1), a member of the TIMP family, are glycoproteins expressed in a variety of tissues and organs that can inhibit the activity of matrix metalloproteinase (MMP3) [13]. The role of TIMP-1 in the development of liver fibrosis has been widely reported [14]. Further evidence demonstrated that AngII could reduce TIMP-1 expression via AT1R and phosphokinase C, ultimately affecting collagen deposition [15]. TIMP family members are involved in MF regulation through the alteration of the intercellular matrix via inhibition of the activity of MMP family members [13]. MMP3 is significantly upregulated in AngII-induced MF cells, and its knockdown could delay MF progression by altering the activity of AngII‑induced MF by regulating genes related to oxidative stress and cell apoptosis [16]. These results indicated the importance of TIMP-1 in MF. However, the specific effects of TIMP-1 on the regulation of MF progression by LC remain unclear.

AngII is a cytokine with many biological functions, including growth factor-like effects. By mainly binding to its receptor AT1, AngII can promote the occurrence of MF because it can not only induce cardiomyocyte hypertrophy but also stimulate the proliferation of cardiac fibroblasts and collagen synthesis [17,18]. In the progression of MF, AngII acts as a critical signaling molecule associated with the renin-angiotensin system (RAS) [19]. Cellular changes within fibrosis induced by AngII are similar to those in humans [20]. A previous study by Chen et al. used 100 nM AngII to induce human cardiac fibroblasts to simulate fibrosis for 48 h, and the significant increase in fibrosis-related indicators after Ang II induction suggested the occurrence of fibrosis [21]. Another study applied 100 nM Ang II to stimulate cardiac fibroblasts for 24 h to induce cell fibrosis [22]. These reports demonstrated that AngII-induced MF in H9C2 cells can be used for experiments. Therefore, in this study, AngII was used to treat H9C2 cells for 24 h to induce cellular fibrosis. Next, the cells were treated with LC or transfected with TIMP‐1-OE/si‑TIMP‐1 plasmid to further investigate the roles of TIMP-1 in LC regulation of AngII-induced MF and their related mechanisms. These findings would help to improve our understanding of MF-based cardiovascular diseases and provide new therapeutic strategies for the prevention and delay of MF.

2. Materials and methods

2.1. Cell culture

H9C2 rat myocardial cells were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (Wuhan Boster Biological Technology) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Thermo Fisher Scientific) and then maintained at 37℃ with 5% CO2.

2.2. Cell transfection

H9C2 cells at a density of 5 × 105 cells per well were seeded into six-well plates and cultured overnight. Then, the complete culture medium was replaced with serum-free medium, and H9C2 cells were transfected with 100 nM si-NC/si-TIMP-1 (1/2/3) or NC/TIMP-1-OE plasmid using Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.), according to the manufacturer’s protocols. NC and TIMP-1-OE plasmids and si-NC/si-TIMP-1 (1/2/3) were purchased from Yanzai Biotechnology (Shanghai) Co., Ltd (Shanghai, China). After 6 h of transfection, the serum-free medium was replaced with a complete culture medium. After culturing for another 24 h, total RNA was isolated from the cells with different treatments, and cell transfection efficiency was assessed by determining TIMP-1 expression using quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and western blotting.

2.3. Induction of cellular MF and cell grouping

H9C2 cells (5 × 105 cells per well) were seeded in 12‑well plates and cultured overnight. The next day, cells were treated with 10−8 M AngII for 24 h. After 24 h of AngII treatment, the cells were harvested to extract total RNA for the examination of MF- and fibroblast-related genes.

H9C2 cells were divided into five groups: control, MF, MF + LC, MF + LC + si-TIMP-1, and MF + LC + TIMP-1-OE. The cells in the MF and MF + LC groups were first treated with AngII for 24 h and then treated with equal amounts of PBS and 100 µM LC for another 24 h. The cells in the MF + LC + si-TIMP-1 and MF + LC + TIMP-1-OE groups were transfected with si-TIMP-1 and TIMP-1-OE plasmids, respectively. After transfection, TIMP-1 knockdown and overexpression cells were stimulated with 10−8 M AngII for 24 h and then treated with 100 µM LC. The cells in the control group were not treated. Cells subjected to different treatments were harvested for subsequent experiments.

2.4. Cell viability and apoptosis assays

The Cell Counting Kit-8 (CCK-8) was used to evaluate the effects of TIMP-1 on the viability of fibrotic H9C2 cells. Briefly, cells in the different groups were collected and seeded into a 96-well plate (1 × 104 cells per well). After culturing for 24, 48, 72, and 96 h, 10 µL of CCK-8 reagent was added, and the cells were further incubated for 2.5 h at 37℃. Finally, the absorbance at 450 nm was measured using a microplate reader.

The Annexin V-FITC Apoptosis Detection kit (Beyotime Institute of Biotechnology) was used to assess cell apoptosis, following the manufacturer’s recommendations. Briefly, H9C2 cells with different treatments for 48 h were harvested by centrifugation for 5 min at 1,000×g and resuspended in 195 µL of Annexin V-FITC. Then, 10 µL of PI and 5 µL of Annexin V-FITC were added to the cells, and the cells were incubated in the dark for 20 min at 20℃. Finally, a FACSCalibur flow cytometer (Becton-Dickinson) was used to acquire images of cells, and CellQuest software (version 4, Becton, Dickinson and Company) was used to calculate the apoptosis rate (early plus late apoptosis) in the different groups.

2.5. Cell migration evaluation

The effects of TIMP-1 on cell migration were investigated using transwell chambers (TCS003024, Guangzhou Jet Bio-Filtration Co., Ltd). Briefly, H9C2 cells with different treatments at a density of 6 × 104 cells per well were seeded into the upper chamber of the transwell chambers. In the lower chamber, the complete medium containing 10% FBS was added. After incubation at 37°C for 24 h, the cells were treated with 4% paraformaldehyde for 10 min and stained with 0.5% crystal violet for 10 min. Finally, a microscope was used to observe cell migration, and the cell numbers were analyzed.

2.6. qRT-PCR

Total RNA was isolated from the cells with different treatments using TRIzol® reagent (Thermo Fisher Scientific, Inc.), and the concentration and quality of the isolated RNA were measured using a UV spectrophotometer. Then, using the PrimeScript™ II 1st Strand cDNA Synthesis kit (Takara Bio, Inc.), RNA was reverse-transcribed into cDNA according to the manufacturer’s instructions. Next, SYBR Premix EX Taq (Thermo Fisher Scientific, Inc.) was used to perform qPCR using the ViiA7 real-time PCR system (ABI). The amplification procedure was as follows: 95°C for 3 min and 40 cycles of 95°C for 10 s, 60°C for 30 s, and 60°C for 30 s. mRNA expression levels were calculated using the 2–ΔΔCt method. The primer sequences are listed in Table 1. GAPDH was used as the housekeeping gene.

Table 1.

Sequences of all primers

Primer Sequence (5′–3′)
GAPDH F: AGACAGCCGCATCTTCTTGT
R: CTTGCCGTGGGTAGAGTCAT
MMP3 F: CAGGCATTGGCACAAAGGTG
R: GTGGGTCACTTTCCCTGCAT
Axl F: GCCCAGTGAGTGAACCCC
R: TCTCCTTCAGCTCTTCGCTG
Bcl-2 F: GACTGAGTACCTGAACCGGCATC
R: CTGAGCAGCGTCTTCAGAGACA
Caspase 3 F: GAATCCACGAGCAGAGTC
R: TCAACAAGCCAACCAAGT
p53 F: ACAGTTAGGGGGTACCTGGC
R: GCTGTGGTGGGCAGAATATCAT
α-SMA- F: GGAGATGGCGTGACTCACAA
R: CGCTCAGCAGTAGTCACGAA
TIMP-1 F: TAAAGCCTGTAGCTGTGCCC
R: AGCGTCGAATCCTTTGAGCA
Collagen III (COL3A1) F: CGGAGGAATGGGTGGCTATC
R: ACCAGCTGGGCCTTTGATAC
AT1R F: GGAAACAGCTTGGTGGTGAT
R: CACACTGGCGTAGAGGTTGA
STAT4 F: ACCTGAGTAAGGCTGTCC
R: TCAGTTCCTACCCACTCTAT
COL1A1 F: ACTTAACATCCAAGGCCGCT
R: ACAATATTTGCCTCAGTTTGTGC
FSP1 F: TGTAATAGTGTCCACCTTCC
R: TTCATTGTCCCTGTTGCT
TGF-β1 F: ATGGTGGACCGCAACAAC
R: TGAGCACTGAAGCGAAAGC
Open in a new tab

2.7. Western blotting

The total protein of the cells with different treatments was extracted using RIPA lysis buffer, and a BCA protein assay kit was used to measure the total protein concentrations. After that, the protein samples (20 μg) were separated by 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes. After blocking with 5% skim milk at 37°C for 2 h, the membranes were incubated with anti-Axl antibody (1:1,000; Protein Tech Group, Inc.), anti-α-SMA antibody (1:1,000; Protein Tech Group, Inc.), anti-MMP3 antibody (1:1,000; Protein Tech Group, Inc.), anti-STAT4 antibody (1:1,000; Protein Tech Group, Inc.), anti-TIMP1 antibody (1:200; Santa Cruz, Inc.), anti-p53 antibody (1:2,000; Protein Tech Group, Inc.), anti- Caspase3 antibody (1:1,000; Protein Tech Group, Inc.), and anti-GAPDH antibody (1:10,000; Protein Tech Group, Inc.) at 4°C overnight. On the next day, the secondary antibody (goat anti-mouse IgG (H + L)-HRP [1:10,000; Jackson ImmunoResearch Laboratories, Inc.]) was added, and cells were incubated at 37°C for 2 h. Finally, the membrane was visualized using an ECL assay kit (Beyotime Institute of Biotechnology), and the protein expression levels of the related proteins were quantified using Image-Pro Plus software.

2.8. Statistical analysis

Data are shown as mean ± standard deviation (SD). GraphPad Prism software was used for statistical analysis. The homogeneity of variance test was first performed to analyze the homogeneity of the variance of the data. According to the P-value of the homogeneity of variance test, one-way ANOVA followed by Tukey’s post hoc test was performed if P > 0.05; otherwise, Brown-Forsythe and Welch ANOVA tests followed by Dunnett’s T3 post hoc test were performed. Differences were considered statistically significant at P < 0.05.

3. Results

3.1. Expression of MF markers in AngII-induced cells and cell transfection efficiency

As shown in Figure 1a, after Ang II treatment for 24 h, the mRNA expression of Axl, α-SMA, and MMP3 was significantly upregulated (P < 0.05), while that of STAT4 and TIMP1 was downregulated (P < 0.05) compared with the control cells. Western blotting also showed that the trends of Axl, α-SMA, MMP3, STAT4, and TIMP-1 protein expression in the control and MF groups were similar to that of their mRNA expression (Figure 1b). Additionally, the expression of fibroblast-related markers, such as FSP1, COL1A1, COL3A1, and TGF-β1, was determined using qRT-PCR. The mRNA expression levels of FSP1, COL1A1, COL3A1, and TGF-β1 were significantly higher in the MF group than in the control group (P < 0.05, Figure 2a). These results indicate that AngII successfully induced the formation of fibrotic H9C2 cells.

Figure 1.

Figure 1

Open in a new tab

Expression of MF-related markers in AngII-induced cells using qRT-PCR and western blotting. (a) mRNA expression of Axl, α-SMA, MMP3, STAT4, and TIMP-1 after AngII treatment for 24 h determined using qRT-PCR. (b) Protein expression of Axl, α-SMA, MMP3, STAT4, and TIMP-1 after AngII treatment for 24 h determined using western blotting. *P < 0.05 vs control. MF, myocardial fibrosis.

Figure 2.

Figure 2

Open in a new tab

Expression of fibroblast-related markers in AngII-induced cells and cell transfection efficiency. (a) mRNA expression of FSP1, COL1A1, COL3A1, and TGF-β1 after AngII treatment for 24 h determined using qRT-PCR. *P < 0.05 vs control. (b) mRNA expression of TIMP-1 after transfection with si-TIMP-1. (c) Protein expression of TIMP-1 after transfection with si-TIMP-1. (d) mRNA expression of TIMP-1 after transfection with TIMP-1-OE plasmid. (e) Protein expression of TIMP-1 after transfection with TIMP-1-OE plasmid. *P < 0.05 vs blank, # P < 0.05 vs si-TIMP-1(1). TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; si, small interfering RNA; OE, over-expression.

To investigate the roles of TIMP-1 in LC regulation of MF, H9C2 cells were transfected with TIMP-1-OE plasmid and si-TIMP-1, and cell transfection efficiency was evaluated by measuring TIMP-1 expression using qRT-PCR and western blotting. There was no significant difference in TIMP-1 mRNA and protein expression between the blank and si-NC groups (P > 0.05, Figure 2b and c) or between the blank and NC groups (P > 0.05, Figure 2d and e). Compared with that in the blank group cells, the mRNA and protein expression of TIMP-1 in the cells transfected with si-TIMP-1(1), si-TIMP-1(2), and si-TIMP-1(3) was significantly decreased (P < 0.05). si-TIMP-1(1) had the most significant effect (Figure 2b and c); hence, H9C2 cells with TIMP-1 knockdown were constructed using si-TIMP-1(1). Additionally, the mRNA expression of TIMP-1 in the blank cells and cells transfected with TIMP-1-OE plasmid was 1.01 ± 0.12 and 905.98 ± 24.17, respectively, implying that TIMP-1 expression in the TIMP-1-OE group was approximately 900 times higher than that in the blank group (Figure 1d). TIMP-1 protein and mRNA expression in the blank cells and cells transfected with TIMP-1-OE plasmid was similar (Figure 2e). All the results showed that cells with TIMP-1 overexpression and knockdown were successfully established and could be used for subsequent experiments.

3.2. Effects of LC and TIMP-1 on viability of AngII-induced H9C2 cells

The viability of H9C2 cells with different treatments for 24, 48, 72, and 96 h was measured using CCK-8. There were no significant differences in cell viability among the MF + LC, MF + LC + si-NC, and MF + LC + NC-OE groups (P > 0.05, Figure A1) after culturing for 24, 48, 72, and 96 h, implying that empty plasmids and transfection reagents did not influence cell growth. In addition, AngII treatment for 24, 48, 72, and 96 h significantly inhibited the cell viability relative to the control cells (P < 0.05, Figure 3). After treatment for 24 h, no significant difference in cell viability was observed among the MF, MF + LC, MF + LC + TIMP-1-OE, and MF + LC + si-TIMP-1 groups (P > 0.05, Figure 3a). After 48, 72, and 96 h of treatment, cell viability was further significantly suppressed by LC compared with that of the MF group (P < 0.05) and further decreased after TIMP-1 overexpression compared with that of the MF + LC group (Figure 3b–d). However, compared with that of the MF + LC group, TIMP-1 knockdown increased the viability of AngII-treated cells treated with LC (P < 0.05) and restored it to a level similar to that of the MF group (P > 0.05, Figure 3b–d). The results suggested that TIMP-1 overexpression could further inhibit the viability of MF cells treated with LC, whereas TIMP-1 knockdown had the opposite effect. Cells cultured for 48 h were used for further experiments.

Figure 3.

Figure 3

Open in a new tab

Cell viability of H9C2 cells after si-TIMP-1 and TIMP-1-OE transfection for 24 h (a), 48 h (b), 72 h (c), and 96 h (d). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression; LC, levocarnitine.

3.3. Effects of LC and TIMP-1 on apoptosis and migration of AngII-induced H9C2 cells

The effects of LC and TIMP-1 on the apoptosis of Ang II-induced H9C2 cells were analyzed using flow cytometry. Compared with that in the control group, a significantly increased rate of cell apoptosis was observed in the MF group (P < 0.05, Figure 4a). LC significantly enhanced the apoptosis rate of AngII-induced H9C2 cells compared with the MF group (P < 0.05, Figure 4a). Compared with that of the MF + LC group, TIMP-1 overexpression also markedly increased the cell apoptosis rate (P < 0.05), whereas TIMP-1 knockdown reduced the apoptosis rate of AngII-induced cells treated with LC (P < 0.05, Figure 4a). These results indicated that TIMP-1 overexpression could further promote the apoptosis of MF cells treated with LC, while TIMP-1 knockdown had the opposite effect.

Figure 4.

Figure 4

Open in a new tab

Effects of TIMP-1 on cell apoptosis and migration of H9C2 cells induced by AngII. (a) Cell apoptosis in the different groups determined using flow cytometry. (b) Cell migration in the different groups assessed using tanswell assay. *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression; LC, levocarnitine.

The migration of H9C2 cells with different treatments was examined using the transwell assay. The cell numbers in the control, MF, MF + LC, MF + LC + TIMP-1-OE, and MF + LC + si-TIMP-1 groups were 324.67 ± 18.77, 256.67 ± 32.13, 161.00 ± 3.61, 136.67 ± 7.57, and 217.67 ± 23.44, respectively (Figure 4b). AngII treatment significantly decreased cell numbers compared to that of the control cells (P < 0.05), and LC administration and TIMP-1 overexpression further reduced the number of AngII-induced cells (P < 0.05, Figure 4b). However, the number of cells in the MF + LC + si-TIMP-1 group was significantly higher than that in the MF + LC group (P < 0.05) and reversed to a similar level in the MF group (P > 0.05, Figure 4b). These results implied that TIMP-1 overexpression could further suppress the migration of MF cells with LC treatment, whereas TIMP-1 knockdown had the opposite effect.

3.4. Effects of TIMP-1 on the expression of oxidative stress-, MF-, and apoptosis-related markers

To further understand the molecular mechanisms by which TIMP-1 regulates the growth of MF cells, the expression of oxidative stress-related genes (MMP3 and STAT4), MF-related genes/proteins (TIMP-1, Axl, AT1R, α-SMA, and collagen III), and apoptosis-related genes (p53, caspase 3, and Bcl-2) was determined using qRT-PCR and western blotting. qRT-PCR showed that the mRNA expression levels of MF-related genes (Axl, AT1R, α-SMA, and collagen III) were significantly upregulated in the MF cells compared with that in the control cells (P < 0.05), whereas they were downregulated by LC treatment compared with that in the MF group (P < 0.05, Figure 5a–d). Compared with that in the MF + LC group, TIMP-1 overexpression significantly downregulated Axl, AT1R, α-SMA, and collagen III mRNA expression (P < 0.05), but TIMP-1 knockdown markedly upregulated their expression (P < 0.05, Figure 5a–d). For apoptosis-related genes (p53, caspase 3, and Bcl-2), it was found that AngII treatment significantly upregulated p53 and caspase 3 expression levels and downregulated that of Bcl-2 compared to that in the control cells (P < 0.05). LC and TIMP-1 overexpression significantly upregulated p53 and caspase 3 expression and downregulated that of Bcl-2 compared with that in the MF cells (P < 0.05, Figure 5e–g). However, the effects of TIMP-1 knockdown on p53, caspase 3, and Bcl-2 expression were opposite to those of TIMP-1 overexpression (Figure 5e–g). For oxidative stress-related genes (MMP3 and STAT4), MMP3 expression was significantly higher in the MF group than in the control cells (P < 0.05), whereas it was lower in the MF + LC group than in the MF group (P < 0.05, Figure 5h). Compared to that in the MF + LC group, TIMP-1 overexpression significantly downregulated MMP3 (P < 0.05), whereas TIMP-1 knockdown significantly upregulated its expression (P < 0.05, Figure 5h). The trend of STAT4 expression in the different groups was opposite to that of MMP3 expression (Figure 5i).

Figure 5.

Figure 5

Open in a new tab

Effects of TIMP-1 on the expression of oxidative stress-related genes, MF-related genes, and apoptosis-related genes determined using qRT-PCR. Relative mRNA expression of Axl (a), AT1R (b), α-SMA (c), Collagen III (d), Caspase 3 (e), p53 (f), Bcl2 (g), MMP3 (h), and STAT4 (i). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MMP, matrix metalloproteinase; Axl, AXL receptor tyrosine kinase; AT1R, angiotensin II receptor type 1; α-SMA, α-smooth muscle actin; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression, LC, levocarnitine.

Finally, the protein expression levels of TIMP-1, caspase 3, and p53 were detected using western blotting. The protein expression of TIMP-1 was significantly downregulated after AngII treatment relative to the control cells (P < 0.05), while it was upregulated in the MF cells treated with LC (P < 0.05, Figure 6a and b). Compared with that in the MF + LC group, TIMP-1 was significantly upregulated by the transfection of TIMP-1 overexpression plasmid (P < 0.05), whereas it was downregulated by si-TIMP-1 transfection (P < 0.05, Figure 6a and b). Additionally, the amount of caspase 3 and p53 protein expression in the different groups detected using western blotting was similar to that of their mRNA expression examined using RT-qPCR (Figure 6a–d).

Figure 6.

Figure 6

Open in a new tab

Effects of TIMP-1 on protein expression levels in H9C2 cells determined using western blotting. (a) Representative images of western blotting. The protein expression of TIMP-1 (b), Caspase‑3 (c), and p53 (d). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression, LC, levocarnitine.

4. Discussion

In many patients with heart disease, MF is recognized as a common feature, which might ultimately result in organ failure [23]. Extracellular matrix (ECM) protein accumulation within the myocardium is the main characteristic of fibrosis. TIMP-1, upregulated in liver fibrosis development both in murine experimental models and human samples [14], is a significant contributor to greater morbidity and poor prognosis in HF [24]. Therefore, we investigated the role of TIMP-1 in the LC regulation of MF. Lijnen et al. suggested that in rat adult cardiac fibroblasts, a well-established model for fibrosis, Ang II increased collagen secretion and production [25]. In our study, we successfully established an MF cellular model using Ang II, and LC was used to treat Ang II-induced cells. TIMP-1 overexpression and knockdown cells were successfully constructed. AngII induction could inhibit the viability and migration of H9C2 myocardial cells while facilitating their apoptosis, and LC could further suppress the viability and migration of fibrotic myocardial cells and further induce cell apoptosis caused by AngII. qRT-PCR results showed that Ang II induction significantly upregulated the expression of MF-related genes (Axl, AT1R, α-SMA, and collagen III), MMP3, caspase 3, and p53 and downregulated that of STAT4 and Bcl-2. However, LC reversed the expression of MF-related genes MMP3 and STAT4 caused by AngII, further upregulating that of caspase 3 and p53 and downregulating that of Bcl-2. TIMP-1 overexpression promoted the effects of LC, whereas TIMP-1 knockdown reversed the effects of LC. In light of these findings, TIMP-1 may be a potential therapeutic target for delaying MF progression.

Ang II, a member of the RAS, has been implicated in the development of MF and other fibrotic diseases [26]. A previous study reported that the death of rat myocardial cells triggers an inflammatory response that eventually leads to fibroblast activation and the replacement of dead myocardial cells with fibrous tissue [27]. Wan et al. demonstrated that Ang II treatment induced apoptosis in H9C2 cells, and caspase 3 activity was significantly increased in AngII-induced cells [28]. Our study showed that in MF cells, the viability and migration of myocardial cells were suppressed, whereas their apoptosis was increased. LC is a naturally occurring co-factor involved in fatty acid metabolism, the major biogenesis process in the heart. Therefore, the key role of LC in the pathogenesis of various cardiovascular diseases has been demonstrated [29]. Furthermore, the protective effect of LC on mitochondrial dysfunction and apoptosis has been reported previously [30]. Our study showed that LC could further inhibit the viability and migration of AngII-induced cells while facilitating their apoptosis, in accordance with our previous report. TIMP-1 was upregulated during liver fibrosis and is thought to promote fibrosis in the damaged liver by inhibiting MMP and ECM degradation [31]. However, our study found that TIMP-1 was significantly downregulated in MF cells, which was different from the results reported by a previous study [31]. Therefore, we investigated the role of TIMP-1 in the regulation of MF by LC. Previous evidence also supports the role of TIMPs in various biological processes such as cell differentiation, growth, and apoptosis [32]. Based on the present study, TIMP-1 overexpression could promote the effects of LC, while silencing TIMP-1 could reverse the actions of LC in AngII-induced myocardial cells. Taken together, we speculate that LC combined with TIMP-1 overexpression may be involved in MF progression by further inhibiting the viability and migration of AngII-induced cells while promoting their apoptosis.

To explore the molecular mechanisms of TIMP-1 in the regulation of MF, the expression levels of some molecules associated with oxidative stress (MMP3 and STAT4), apoptosis (Bcl-2, caspase-3, and p53), and MF (TIMP-1, Axl, AT1R, α-SMA, and collagen III) were measured. Our results showed that Ang II exposure significantly upregulated the expression of Axl, AT1R, α-SMA, collagen III, caspase 3, p53, and MMP3 and downregulated that of Bcl-2 and STAT4. LC treatment reversed the action of AngII on the expression of Axl, AT1R, α-SMA, collagen III, MMP3, and STAT4, whereas it further upregulated that of caspase 3 and p53 and downregulated that of Bcl-2. TIMP-1 overexpression promoted the effects of LC on these genes, whereas TIMP-1 knockdown had the opposite effect. Axl, a receptor tyrosine kinase associated with fibrotic pathways, is involved in myofibroblast activation [33]. AT1R can interact with AngII to promote tissue fibrosis and is upregulated in renal fibrosis [34]. α-SMA and collagen III are fibrosis-related markers that are both upregulated in the fibrosis process. Li et al. [35] illustrated that tetrahydrocurcumin treatment could alleviate diabetic cardiomyopathy by reducing the expression of α-SMA, collagen I, and collagen III, which are markers of cardiac fibrosis.

Oxidative stress is defined as an imbalance between the production of ROS and the endogenous antioxidant defense system. It has been reported to participate in fibrosis and has been identified as an important pathophysiological pathway for the development and progression of HF [36]. Excessive ROS may exacerbate inflammation and progression of HF [37]. ROS can contribute to ECM remodeling by mediating apoptosis and MMPs. MMP3, a member of the MMP family, can induce epithelial–mesenchymal transition associated with malignant transformation through a pathway dependent on ROS production [38]. Skacelova et al. [39] observed that MMP3 is highly expressed in patients with rheumatoid arthritis and could serve as a marker of disease activity in rheumatoid arthritis. STAT4 plays an important role in many diseases through the activation of different cytokines via the JAK-STAT signaling pathway [40]. STAT4 absence could reduce the development of atherosclerosis by affecting MΦ activation and CCL2-induced MΦ migration [41]. Additionally, apoptosis is closely associated with fibrosis [42]. Caspase‑3, a member of the caspase family, is a key regulator of extrinsic and intrinsic apoptotic pathways and cell apoptosis [43]. p53 is an essential cell cycle and DNA repair regulator that plays a role in apoptosis-related genes [44]. Bcl-2, an anti-apoptotic gene, is a key downstream effector of the PI3K-Akt signaling pathway that maintains myocardial cell survival and is involved in sudden cardiac death and HF [45]. Combined with our results, it can be inferred that LC together with TIMP-1 overexpression may delay MF by downregulating the expression of MF-related genes (Axl, AT1R, α-SMA, and collagen III), inhibiting oxidative stress (MMP3 and STAT4), and promoting cell apoptosis (Bcl2, caspase 3, and p53).

However, this study has some limitations. First, TIMP-1 levels should be further determined in clinical samples of patients with MF and paired adjacent benign tissues, and additional investigation into the roles of TIMP-1 in MF should be undertaken in vivo. Additionally, the relationship between MF and the growth of Ang II-induced myocardial cells needs to be explored in the future.

5. Conclusion

In conclusion, our findings support the hypothesis that LC combined with TIMP-1 overexpression may affect fibrotic cell apoptosis, viability, and migration by regulating the expression of MF-, oxidative stress-, and cell apoptosis-related genes, thereby delaying the progression of MF. Our study provides a theoretical foundation for the treatment of MF-based cardiovascular diseases, with TIMP1 as a potential therapeutic target for LC to promote cardiovascular health and prolong life expectancy in older individuals.

Appendix

Figure A1.

Figure A1

Open in a new tab

Effects of empty plasmids and transfection reagents on the cell viability of H9C2 cells after culturing for 24, 48, 72, and 96 h using CCK-8.

Footnotes

Funding information: This study was supported by the Medical research project of Jing’an District (General program 2020MS12) and Key medical discipline construction project of Jing’an District (Key Medical Disciplines 2021ZD03).

Author contributions: Conceptualization: Xiangwei Wu and Xinyu Peng; data curation: Jian Yang; formal analysis: Jian Yang and Meiyan Wang; funding acquisition: Xiangwei Wu; investigation: Jian Yang, Jing Yang, Zhiqiang Chu, and Xueling Chen; methodology: Jian Yang and Xueling Chen; project administration: Jian Yang; resources: Xiangwei Wu and Xinyu Peng; software: Meiyan Wang; supervision: Xinyu Peng; validation: Jing Yang and Zhiqiang Chu; visualization: Jing Yang and Zhiqiang Chu; writing – original draft: Jian Yang; writing – review and editing: Xiangwei Wu and Xinyu Peng.

Conflict of interest: Authors state no conflict of interest.

Data availability statement: The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Contributor Information

Haiya Wang, Email: 18918179588@163.com.

Li Jin, Email: jinli923_2022@163.com.

References

  • [1].Savarese G, Becher PM, Lund LH, Seferovic P, Rosano GMC, Coats A. Global burden of heart failure: a comprehensive and updated review of epidemiology. Cardiovasc Res. 2023;118(17):3272–87. [DOI] [PubMed]
  • [2].Gonzalez A, Lopez B, Ravassa S, San Jose G, Diez J. The complex dynamics of myocardial interstitial fibrosis in heart failure. Focus on collagen cross-linking. Biochim Biophys Acta, Mol Cell Res. 2019;1866(9):1421–32. [DOI] [PubMed]
  • [3].Maruyama K, Imanaka-Yoshida K. The pathogenesis of cardiac fibrosis: a review of recent progress. Int J Mol Sci. 2022;23(5):2617. [DOI] [PMC free article] [PubMed]
  • [4].Zegard A, Okafor O, de Bono J, Kalla M, Lencioni M, Marshall H, et al. Myocardial fibrosis as a predictor of sudden death in patients with coronary artery disease. J Am Coll Cardiol. 2021;77(1):29–41. [DOI] [PubMed]
  • [5].Gyongyosi M, Winkler J, Ramos I, Do QT, Firat H, McDonald K, et al. Myocardial fibrosis: biomedical research from bench to bedside. Eur J Heart Fail. 2017;19(2):177–91. [DOI] [PMC free article] [PubMed]
  • [6].Schupp T, Behnes M, Weiss C, Nienaber C, Reiser L, Bollow A, et al. Digitalis therapy and risk of recurrent ventricular tachyarrhythmias and ICD therapies in atrial fibrillation and heart failure. Cardiology. 2019;142(3):129–40. [DOI] [PubMed]
  • [7].Neefs J, van den Berg NW, Limpens J, Berger WR, Boekholdt SM, Sanders P, et al. Aldosterone pathway blockade to prevent atrial fibrillation: a systematic review and meta-analysis. Int J Cardiol. 2017;231:155–61. [DOI] [PubMed]
  • [8].Huang DD, Huang HF, Yang Q, Chen XQ. Liraglutide improves myocardial fibrosis after myocardial infarction through inhibition of CTGF by activating cAMP in mice. Eur Rev Med Pharmacol Sci. 2018;22(14):4648–56. [DOI] [PubMed]
  • [9].Gaspari T, Brdar M, Lee HW, Spizzo I, Hu Y, Widdop RE, et al. Molecular and cellular mechanisms of glucagon-like peptide-1 receptor agonist-mediated attenuation of cardiac fibrosis. Diab Vasc Dis Res. 2016;13(1):56–68. [DOI] [PubMed]
  • [10].Chen P, Yang F, Wang W, Li X, Liu D, Zhang Y, et al. Liraglutide attenuates myocardial fibrosis via inhibition of AT1R-mediated ROS production in hypertensive mice. J Cardiovasc Pharmacol Ther. 2021;26(2):179–88. [DOI] [PubMed]
  • [11].Zhao HY, Li HY, Jin J, Jin JZ, Zhang LY, Xuan MY, et al. L-carnitine treatment attenuates renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. Korean J Intern Med. 2021;36(Suppl 1):S180–95. [DOI] [PMC free article] [PubMed]
  • [12].Emran T, Chowdhury NI, Sarker M, Bepari AK, Hossain M, Rahman GMS, et al. L-carnitine protects cardiac damage by reducing oxidative stress and inflammatory response via inhibition of tumor necrosis factor-alpha and interleukin-1beta against isoproterenol-induced myocardial infarction. Biomed Pharmacother. 2021;143:112139. [DOI] [PubMed]
  • [13].Cabral-Pacheco GA, Garza-Veloz I, Castruita-De la Rosa C, Ramirez-Acuña JM, Perez-Romero BA, Guerrero-Rodriguez JF, et al. The roles of matrix metalloproteinases and their inhibitors in human diseases. Int J Mol Sci. 2020;21(24):9739. [DOI] [PMC free article] [PubMed]
  • [14].Yoshiji H, Kuriyama S, Miyamoto Y, Thorgeirsson UP, Gomez DE, Kawata M, et al. Tissue inhibitor of metalloproteinases-1 promotes liver fibrosis development in a transgenic mouse model. Hepatology. 2000;32(6):1248–54. [DOI] [PubMed]
  • [15].Takeda K, Noguchi R, Kitade M, Namisaki T, Moriya K, Kawaratani H, et al. Periostin crossreacts with the reninangiotensin system during liver fibrosis development. Mol Med Rep. 2017;16(5):5752–8. [DOI] [PMC free article] [PubMed]
  • [16].Shu J, Gu Y, Jin L, Wang H. Matrix metalloproteinase 3 regulates angiotensin II induced myocardial fibrosis cell viability, migration and apoptosis. Mol Med Rep. 2021;23(2):151. [DOI] [PMC free article] [PubMed]
  • [17].Sun Y. Local angiotensin II and myocardial fibrosis. Adv Exp Med Biol. 1997;432:55–61. [DOI] [PubMed]
  • [18].Wang S, Gong H, Jiang G, Ye Y, Wu J, You J, et al. Src is required for mechanical stretch-induced cardiomyocyte hypertrophy through angiotensin II type 1 receptor-dependent β-arrestin2 pathways. PLoS One. 2014;9(4):e92926. [DOI] [PMC free article] [PubMed]
  • [19].Weber KT, Brilla CG, Campbell SE, Guarda E, Zhou G, Sriram K. Myocardial fibrosis: role of angiotensin II and aldosterone. Basic Res Cardiol. 1993;88(Suppl 1):107–24. [DOI] [PubMed]
  • [20].Billet S, Aguilar F, Baudry C, Clauser E. Role of angiotensin II AT1 receptor activation in cardiovascular diseases. Kidney Int. 2008;74(11):1379–84. [DOI] [PubMed]
  • [21].Chen Y, Huang M, Yan Y, He D. Tranilast inhibits angiotensin II-induced myocardial fibrosis through S100A11/transforming growth factor-β (TGF-β1)/Smad axis. Bioengineered. 2021;12(1):8447–56. [DOI] [PMC free article] [PubMed]
  • [22].Liu L, Gong W, Zhang S, Shen J, Wang Y, Chen Y, et al. Hydrogen sulfide attenuates angiotensin II-induced cardiac fibroblast proliferation and transverse aortic constriction-induced myocardial fibrosis through oxidative stress inhibition via sirtuin 3. Oxid Med Cell Longevity. 2021;2021:9925771. [DOI] [PMC free article] [PubMed]
  • [23].Kim S, Iwao H. Molecular and cellular mechanisms of angiotensin II-mediated cardiovascular and renal diseases. Pharmacol Rev. 2000;52(1):11–34. [PubMed]
  • [24].Almehmadi F, Joncas SX, Nevis I, Zahrani M, Bokhari M, Stirrat J, et al. Prevalence of myocardial fibrosis patterns in patients with systolic dysfunction: prognostic significance for the prediction of sudden cardiac arrest or appropriate implantable cardiac defibrillator therapy. Circ Cardiovasc Imaging. 2014;7(4):593–600. [DOI] [PubMed]
  • [25].Lijnen PJ, Petrov VV, Fagard RH. Induction of cardiac fibrosis by angiotensin II. Methods Find Exp Clin Pharmacol. 2000;22(10):709–23. [DOI] [PubMed]
  • [26].Rosin NL, Falkenham A, Sopel MJ, Lee TD, Légaré JF. Regulation and role of connective tissue growth factor in AngII-induced myocardial fibrosis. Am J Pathol. 2013;182(3):714–26. [DOI] [PubMed]
  • [27].Kong P, Christia P, Frangogiannis NG. The pathogenesis of cardiac fibrosis. Cell Mol Life Sci. 2014;71(4):549–74. [DOI] [PMC free article] [PubMed]
  • [28].Wan M, Yin K, Yuan J, Ma S, Xu Q, Li D, et al. YQFM alleviated cardiac hypertrophy by apoptosis inhibition and autophagy regulation via PI(3)K/AKT/mTOR pathway. J ethnopharmacology. 2022;285:114835. [DOI] [PubMed]
  • [29].Ren J, Pulakat L, Whaley-Connell A, Sowers JR. Mitochondrial biogenesis in the metabolic syndrome and cardiovascular disease. J Mol Med. 2010;88(10):993–1001. [DOI] [PMC free article] [PubMed]
  • [30].Mao CY, Lu HB, Kong N, Li JY, Liu M, Yang CY, et al. Levocarnitine protects H9c2 rat cardiomyocytes from H2O2-induced mitochondrial dysfunction and apoptosis. Int J Med Sci. 2014;11(11):1107–15. [DOI] [PMC free article] [PubMed]
  • [31].Thiele ND, Wirth JW, Steins D, Koop AC, Ittrich H, Lohse AW, et al. TIMP-1 is upregulated, but not essential in hepatic fibrogenesis and carcinogenesis in mice. Sci Rep. 2017;7(1):714. [DOI] [PMC free article] [PubMed]
  • [32].Ries C. Cytokine functions of TIMP-1. Cell Mol Life Sci. 2014;71(4):659–72. [DOI] [PMC free article] [PubMed]
  • [33].Steiner CA, Rodansky ES, Johnson LA, Berinstein JA, Cushing KC, Huang S, et al. AXL is a potential target for the treatment of intestinal fibrosis. Inflamm bowel Dis. 2021;27(3):303–16. [DOI] [PMC free article] [PubMed]
  • [34].Wu QY, Feng Y, Wang LL, Zhang XH. Levels of Apelin-12, AT1R, and AGT are correlated with degree of renal fibrosis in patients with immunoglobulin A nephropathy. Ann Palliat Med. 2021;10(5):5687–93. [DOI] [PubMed]
  • [35].Li K, Zhai M, Jiang L, Song F, Zhang B, Li J, et al. Tetrahydrocurcumin ameliorates diabetic cardiomyopathy by attenuating high glucose-induced oxidative stress and fibrosis via activating the SIRT1 pathway. Oxid Med Cell Longevity. 2019;2019:6746907. [DOI] [PMC free article] [PubMed]
  • [36].Purnomo Y, Piccart Y, Coenen T, Prihadi JS, Lijnen PJ. Oxidative stress and transforming growth factor-beta1-induced cardiac fibrosis. Cardiovasc Hematol Disord Drug Targets. 2013;13(2):165–72. [DOI] [PubMed]
  • [37].Huo S, Shi W, Ma H, Yan D, Luo P, Guo J, et al. Alleviation of inflammation and oxidative stress in pressure overload-induced cardiac remodeling and heart failure via IL-6/STAT3 inhibition by raloxifene. Oxid Med Cell Longevity. 2021;2021:6699054. [DOI] [PMC free article] [PubMed] [Retracted]
  • [38].Cichon MA, Radisky DC. ROS-induced epithelial–mesenchymal transition in mammary epithelial cells is mediated by NF-kB-dependent activation of snail. Oncotarget. 2014;5(9):2827–38. [DOI] [PMC free article] [PubMed]
  • [39].Skacelova M, Hermanova Z, Horak P, Ahmed K, Langova K. Higher levels of matrix metalloproteinase-3 in patients with RA reflect disease activity and structural damage. Biomed Pap. 2017;161(3):296–302. [DOI] [PubMed]
  • [40].Yang C, Mai H, Peng J, Zhou B, Hou J, Jiang D. STAT4: an immunoregulator contributing to diverse human diseases. Int J Biol Sci. 2020;16(9):1575–85. [DOI] [PMC free article] [PubMed]
  • [41].Taghavie-Moghadam PL, Gjurich BN, Jabeen R, Krishnamurthy P, Kaplan MH, Dobrian AD, et al. STAT4 deficiency reduces the development of atherosclerosis in mice. Atherosclerosis. 2015;243(1):169–78. [DOI] [PMC free article] [PubMed]
  • [42].Meng D, Li Z, Wang G, Ling L, Wu Y, Zhang C. Carvedilol attenuates liver fibrosis by suppressing autophagy and promoting apoptosis in hepatic stellate cells. Biomed Pharmacother. 2018;108:1617–27. [DOI] [PubMed]
  • [43].Lossi L, Castagna C, Merighi A. Caspase-3 mediated cell death in the normal development of the mammalian cerebellum. Int J Mol Sci. 2018;19(12):3999. [DOI] [PMC free article] [PubMed]
  • [44].Wang X, Simpson ER, Brown KA. p53: protection against tumor growth beyond effects on cell cycle and apoptosis. Cancer Res. 2015;75(23):5001–7. [DOI] [PubMed]
  • [45].Meng X, Cui J, He G. Bcl-2 is involved in cardiac hypertrophy through PI3K-Akt pathway. Biomed Res Int. 2021;2021:6615502. [DOI] [PMC free article] [PubMed]

Articles from Open Life Sciences are provided here courtesy of De Gruyter

RESOURCES