Skip to main content
NCBI home page
Food Science & Nutrition logoLink to Food Science & Nutrition
. 2022 Nov 17;11(2):1127–1133. doi: 10.1002/fsn3.3150

Effect of partially hydrolyzed guar gum on the expression of aquaporin‐3 in the colon

Risako Kon 1, Nobutomo Ikarashi 1,✉, Kazuhiro Onuma 1, Zenta Yasukawa 2, Makoto Ozeki 3, Hiroyasu Sakai 1, Junzo Kamei 4
PMCID: PMC9922137  PMID: 36789055

Abstract

In recent years, the development of functional foods targeting gastrointestinal disorders has been in progress. Partially hydrolyzed guar gum (PHGG), which is a water‐soluble dietary fiber, is known to have a constipation‐improving effect. However, many aspects of the mechanism remain unclear. In this study, we investigated the role of aquaporin‐3 (AQP3), which regulates the water content of feces in ameliorative effect of PHGG on constipation. Rats were allowed to freely consume a normal diet or a diet containing 5% PHGG for 14 days, and defecation parameters were measured. We also analyzed the expression levels of genes involved in water transport in the colon. The defecation frequency and volume of rats treated with PHGG were not different from those from the control group, but the fecal water content was significantly increased, and soft stools were observed. The expressions of claudin‐1, tight junction protein‐1, and cadherin‐1, which are involved in tight junctions or adherens junctions, were almost the same in the PHGG‐treated group and the control group. The expression level of AQP3 in the colon was significantly decreased in the PHGG‐treated group. In this study, PHGG decreased the colonic AQP3 expression, thereby suppressing water transport from the luminal side to the vascular side and improving constipation.

Keywords: aquaporin, colon, constipation, fiber, partially hydrolyzed guar gum

We found that PHGG decreases the expression level of AQP3 without changing the osmotic pressure in the colon. This suppresses the transport of water from the luminal side to the vascular side, and PHGG is thought to improve constipation.

graphic file with name FSN3-11-1127-g001.jpg

1. INTRODUCTION

Chronic constipation affects approximately 20% of the general population and is known to be especially prevalent in elderly individuals (De Giorgio et al., 2015; McCrea et al., 2009). As constipation is caused by a lack of water or disorders of intestinal motility, water intake and lifestyle improvements, such as eating habits and exercise, are effective ways to alleviate constipation. However, it is often difficult to relieve symptoms by improving only these lifestyle factors, and more active intervention may be needed. Various laxatives are used for the treatment of constipation, and recently functional foods have also attracted attention as a self‐medication tool. Functional foods targeting constipation include probiotics such as bifidobacteria and lactic acid bacteria and prebiotics such as dietary fiber, and these foods are currently under development and included in clinical research (Aoki et al., 2016; Liu & Zhi, 2021; Miryan et al., 2022).

Partially hydrolyzed guar gum (PHGG) is a water‐soluble dietary fiber obtained from the seed endosperms of Cyamopsis tetragonolobus. PHGG has various beneficial effects; it has been reported to improve hyperglycemia and hyperlipidemia (Kondo et al., 2004; Naito et al., 2016; Yasukawa et al., 2012). Moreover, there are many reports that PHGG can improve constipation (Inoue et al., 2019; Kappor et al., 2017). The improvement of constipation by PHGG has been attributed to a prebiotic effect, which is thought to be due to the alteration of the intestinal environment and the enhancement of intestinal peristalsis (Okubo et al., 1994). However, the mechanism by which PHGG improves constipation remains unclear.

In recent years, aquaporin (AQP) has been shown to be an important molecule that regulates the amount of water in the body (Verkman, 2011). AQPs are water channels that distribute throughout the human body, and 13 types, AQP0 through AQP12, have been identified. It has been found that abnormalities in AQP cause water metabolism disorder and are involved in the development of various diseases: nephrogenic diabetes insipidus (Lu, 2017; Satake et al., 2010), dry skin (Ikarashi et al., 2017, 2021), and cerebral edema (Wang et al., 2014). AQP3 is abundantly expressed in colonic mucosal epithelial cells (Silberstein et al., 1999), which regulates the water content of feces (Ikarashi et al., 2016; Laforenza, 2012). We have previously clarified that change in the AQP3 is involved in the development of constipation and diarrhea (Ikarashi et al., 2012; Ikarashi, Baba, et al., 2011; Kon et al., 2015). In this study, we investigated the role of AQP in the ameliorative effect of PHGG on constipation. Specifically, we analyzed the expression levels of various genes related to stool properties, including AQP3 in the rats fed PHGG.

2. MATERIALS AND METHODS

2.1. PHGG

PHGG was obtained by Taiyo Kagaku Co., Ltd. (Mie, Japan). The guar gum was treated with β‐endogalactomannase from an Aspergillus niger strain and purified to be PHGG.

2.2. Animals and treatment

Wistar rats (male, 8‐week‐old) were obtained from Japan SLC Co., Ltd. This animal experiment was approved by the Hoshi University (approval number; 30‐097).

Rats were allowed to freely consume a normal diet or a diet containing 5% PHGG and provided drinking water ad libitum for 14 days. On the 14th day, the total number of fecal pellets and fecal wet weight were determined using defecated stools from rats. The feces were dried in a freeze‐dryer for 24 hours, and the water content was calculated. In addition, the colon was removed from rats under isoflurane anesthesia.

2.3. Real‐time RT‐PCR

Total RNA was extracted from rat colon tissue, and cDNA was synthesized. The expression levels of each gene were detected with real‐time PCR under the following conditions: cDNA solution, SsoAdvanced SYBR green supermix (Bio‐Rad Laboratories, Hercules, CA), and mixed forward and reverse primers (Table 1). Gene expression levels were analyzed due to monitoring by the CFX Connect real‐time PCR detection system. All genes were normalized by the mRNA level of beta actin (Actb).

TABLE 1.

Primer sequences

Gene Forward (5′–3′) Reverse (5′–3′)
Cldn1 ATTTCAGGTCTGGCGACATT TAAGAGGTTGTTTTCCGGGG
Tjp1 GAACAGCCAACCAGTGGATA CGGCTCAGATGACTTAGGAC
Cdh1 GGACCGAGAGAGTTACCCTA CGACCTCATTCTCAAGCACT
Aqp3 CCCCTTGTGATGCCTCTC CCCTAGCTGGCAGAGTTC
Smit AGGAGTCCTTGGGTTGGAAC ACTGCAACAAGGCCTCCAG
Taut GTTCTGGGAGCGCAACGT ACCGAACACCCTTCCAGATG
Actb GCCACTGCCGCATCCTCTTG CGGAACCGCTCATTGCCGAT
Open in a new tab

2.4. Preparation of the plasma membrane (PM)‐rich fraction

The colonic mucosa from rats was homogenized in dissecting buffer (0.3 M sucrose, 25 mM imidazole, 1 mM ethylenediaminetetraacetic acid, 8.5 μM leupeptin, and 1 μM phenylmethylsulfonyl fluoride; pH 7.2). After centrifugation (800 g, 4°C, 15 min), the supernatant was further centrifuged (17,000 g, 4°C, 30 min). The precipitates were sonicated to obtain the PM‐rich fraction (Kon et al., 2017).

2.5. Western blotting

After measuring the protein concentration of PM fraction, western blotting was performed. After blocking the poly vinylidene difluoride membrane, it was treated with primary antibodies, rabbit anti‐rat AQP3 antibody (Alomone Labs, Jerusalem, Israel) or mouse anti‐Na+/K+ ATPase α‐1 antibody (Merck Millipore, Darmstadt, Germany). Secondary antibodies used were sheep anti‐mouse IgG‐HRP antibody (Merck Millipore) or donkey anti‐rabbit IgG‐HRP antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). After the membrane was treated with detection reagents, and the bands were analyzed by luminoimage analyzer ImageQuant LAS500 (Cytiva, Tokyo, Japan).

2.6. Statistical analysis

The data are shown as the mean ± standard deviation (SD). Student's t test was performed to determine a statistically significant difference.

3. RESULTS

3.1. Effect of PHGG treatment on defecation parameters

The rats were allowed to freely consume a normal diet or a diet containing 5% PHGG for 14 days. Body weight, food intake, and defecation status were examined (Table 2).

TABLE 2.

Body weight, food intake, and defecation parameters

Control group PHGG‐treated group
Body weight (g)
Day 0 187.1 ± 8.1 185.8 ± 5.9
Day 14 254.0 ± 9.9 256.0 ± 9.4
Food intakes (g/rat/day) 17.9 ± 1.9 17.1 ± 0.5
Weight of feces (g) 0.71 ± 0.36 0.74 ± 0.29
Number of feces (counts) 4.3 ± 2.1 3.3 ± 1.7
Fecal water contents (%) 100.0 ± 4.7 120.0 ± 9.9*
Open in a new tab

Note: Normal rats were allowed to freely consume a normal diet or a diet containing 5% PHGG for 14 days. The body weight, food intake, weight of feces, numbers of feces, and fecal water contents were examined (mean ± SD, n = 7, *p < .05).

The body weight and food intake of rats treated with PHGG were almost the same as those of rats in the control group. The total weight of fecal pellets and the total number of fecal pellets were not changed by the administration of PHGG. However, the water content in feces of the PHGG‐treated group was significantly increased by approximately 1.2 times.

Based on these results, PHGG increased fecal water content without affecting the total weight and number of fecal pellets.

3.2. Effect of PHGG on the expression of genes involved in tight junctions and adherence junctions in the colon

In the colon, water is transported from the luminal side to the vascular side by the paracellular and transcellular pathways (Fischbarg, 2010; Hill & Shachar‐Hill, 2006). In the paracellular pathway, water is transported via tight junctions and adherence junctions (Suzuki, 2013). Therefore, we analyzed the mechanism by which PHGG increases fecal water content, focusing on claudin‐1 (CLDN1) and tight junction protein‐1 (TJP1), which are components of tight junctions, and cadherin‐1 (CDH1), which is a component of adherence junctions.

The Cldn1 mRNA expression level in the colon of the PHGG‐treated group was almost the same as that of the control group (Figure 1a). Similarly, there were no differences in the expression levels of Tjp1 and Cdh1 between the PHGG‐treated group and the control group (Figure 1b, c).

FIGURE 1.

FIGURE 1

Open in a new tab

The Cldn1, Tjp1, and Cdh1 mRNA expression levels in the colon. Normal rats were allowed to freely consume a normal diet or diet containing 5% PHGG for 14 days. The Cldn1 (a), Tjp1 (b), and Cdh1 (c) mRNA expression levels in the colon were measured by real‐time RT‐PCR (mean ± SD, n = 7).

Based on these findings, tight junctions or adherence junctions in the colon do not seem to be related to the increase in fecal water content during the PHGG treatment.

3.3. Effect of PHGG on AQP3 expression in the colon

AQP3 is predominantly expressed in the colon and is involved in water transport through the transcellular pathway. As the osmotic pressure on the luminal side is lower than that on the vascular side in the colon under physiological conditions, water is transported from the luminal side to the vascular side through AQP3, and stool is concentrated (Ikarashi et al., 2016). Therefore, we investigated the possibility that the PHGG‐induced increase in fecal water content was caused by changes in AQP3 expression.

There was no difference in the mRNA expression level of Aqp3 between the PHGG‐treated group and the control group (Figure 2a). AQP3 protein expression was detected as deglycosylated AQP3 (27 kDa) and glycosylated AQP3 (30–40 kDa) by western blotting (Silberstein et al., 1999; Spector et al., 2002). The AQP3 protein expression level was significantly decreased in the PHGG‐treated group (Figure 2b). For the purpose of investigating the intraluminal osmotic pressure that regulates the water transport direction by AQP3, we examined the mRNA expression levels of sodium myo‐inositol cotransporter (Smit) and taurine transporter (Taut) as genes that reflect change in osmotic pressure in colonic lumen (Ikarashi, Ushiki, et al., 2011; Minami et al., 1996), were measured. No difference was observed between the PHGG‐treated group and the control group (Figure 3).

FIGURE 2.

FIGURE 2

Open in a new tab

The mRNA and protein expression levels of AQP3 in the colon. Normal rats were allowed to freely consume a normal diet or diet containing 5% PHGG for 14 days. (a) The Aqp3 mRNA expression in the colon was measured by real‐time RT‐PCR. (b) The AQP3 protein expression level in the colon was measured by western blotting (mean ± SD, n = 7, ***p < .001).

FIGURE 3.

FIGURE 3

Open in a new tab

The mRNA expression levels of Smit and Taut in the colon. Normal rats were allowed to freely consume a normal diet or a diet containing 5% PHGG for 14 days. The Smit (a) and Taut (b) mRNA expression levels in the colon were measured by real‐time RT‐PCR (mean ± SD, n = 7).

These data suggest that the increase in fecal water content during PHGG treatment may be related to the decrease in the AQP3 expression in the colon.

4. DISCUSSION

Constipation, a defecation disorder, is not directly life threatening, therefore its treatment is often neglected. However, constipation interferes with daily life and mental health (Belsey et al., 2010; Sun et al., 2011). In this study, to elucidate the mechanism by which the water‐soluble dietary fiber PHGG improves constipation, we investigated the action of PHGG on defecation status, focusing on the colonic water channel AQP3.

In this study, rats were fed a normal diet containing 5% PHGG for 14 days (Okamura et al., 2022; Takagi et al., 2016). The defecation frequency and volume of the rats in the PHGG treatment group were not different from those of rats in the control group. In contrast, the fecal water content in the PHGG‐treated group was significantly increased (Table 2). There was no change in food intake between the PHGG‐treated group and the control group throughout the administration period. In addition, there was no difference in body weight between the two groups at the end of the treatment (Table 2). These findings suggest that the increase in fecal water content by PHGG treatment was not caused by toxicity, and there is no problem with the dose. Furthermore, the above findings suggested that PHGG may have increased the fecal water content and softened the feces without affecting peristaltic movement.

Orally ingested water and digestive fluids secreted from the small intestine are absorbed while passing through the gastrointestinal tract, eventually concentrating stool in the colon. We analyzed the mechanism underlying the PHGG‐induced increase in fecal water content, focusing on genes important for water transport in the colon. Colonic epithelial cells have strong tight junctions and adherence junctions, and the disruption of these junctions causes diarrhea (Schneider et al., 2010; Van Sebille et al., 2018; Yu et al., 2017). Therefore, we investigated the effects of PHGG on the expression levels of CLDN1 and TJP1, constituent proteins of tight junctions, and the expression level of CDH1, a constituent protein of adhesion junctions. The expression levels of Cldn1, Tjp1, and Cdh1 in the colon of the PHGG‐treated group were almost the same as those of the control group (Figure 1). Therefore, it is unlikely that PHGG acted on tight junctions or adhesion junctions in the colon.

As a route for the water transport through the cell in the colon, the expression level of AQP3 is an important. The AQP3 protein expression was significantly decreased in the PHGG‐treated group (Figure 2). Additionally, there were no differences in the levels of Smit and Taut (Ikarashi, Ushiki, et al., 2011; Minami et al., 1996) between both groups (Figure 3). These findings suggested that PHGG did not change the osmotic pressure in the colonic lumen, and that water was transported from the luminal side to the vascular side in the normal physiological absorption direction. The above results indicated that the increase in fecal water content by PHGG may have been caused by the decrease in the expression of colon AQP3.

Why did PHGG treatment decrease the AQP3 expression in the colon? In previous reports, AQP3 expression decreases by inflammation (Horie et al., 2009; Ikarashi, Baba, et al., 2011). However, the results showed no change in the expression levels of inflammatory cytokines (tumor necrosis factor‐α, interleukin‐1β, and interleukin‐6) in the colon after treatment with PHGG (data not shown). Therefore, inflammation does not seem to be related to decrease in colonic AQP3 caused by PHGG treatment.

Diarrhea is caused by impaired absorption or altered the synthesis of bile acids, which is called bile acid diarrhea. Recently, it has been reported that when bile acid diarrhea develops, Aqp3 mRNA is not affected, but AQP3 protein is decreased (Yde et al., 2016). On the other hand, PHGG is known to change the amount of gut microbiota and its metabolites in the colon, such as bile acids and short‐chain fatty acids (Kovacs et al., 2002; Levrat‐Verny et al., 2000; Takayama et al., 2021). Although the mechanism by which PHGG decreases the expression of AQP3 is speculative, since the low gastrointestinal absorption of PHGG, AQP3 was considered to be decreased by the following mechanism. Oral administration of PHGG changes the gut microbiota and thereby the amount of gut microbiota metabolites changes, decreasing AQP3. The details of this mechanism will be clarified in the future.

In summary, we found that PHGG decreases the AQP3 expression level without changing the osmotic pressure in the colon. This suppresses water movement from the luminal side to the vascular side, thus softening the stool and PHGG improves constipation (Figure 4). In the future, scientific evidence supporting the use of prebiotics can be clarified by elucidating the mechanism by which AQP3 expression is decreased by PHGG.

FIGURE 4.

FIGURE 4

Open in a new tab

Effect of PHGG on the colonic AQP3

FUNDING INFORMATION

This study was funded by the Lotte Shigemitsu Prize and Taiyo Kagaku Co., Ltd.

CONFLICT OF INTEREST

M.O. and Z.Y. are employees of Taiyo Kagaku Co., Ltd. Neither the external organization nor the funding agency participated in research design or no competing interests. The other authors (R.K., N.I., K.O., H.S., and J.K.) declared that the study was conducted in the absence of financial relationships that could be constructed as potential conflicts of interest.

Kon, R. , Ikarashi, N. , Onuma, K. , Yasukawa, Z. , Ozeki, M. , Sakai, H. , & Kamei, J. (2023). Effect of partially hydrolyzed guar gum on the expression of aquaporin‐3 in the colon. Food Science & Nutrition, 11, 1127–1133. 10.1002/fsn3.3150

DATA AVAILABILITY STATEMENT

Data will be made available on request.

REFERENCES

  1. Aoki, R. , Tsuchida, S. , Arai, Y. , Ohno, K. , Nishijima, T. , Mawatari, T. , Mikami, Y. , & Ushida, K. (2016). Effect of Bifidobacterium animalis subsp. lactis GCL2505 on the physiological function of intestine in a rat model. Food Science & Nutrition, 4(6), 782–790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Belsey, J. , Greenfield, S. , Candy, D. , & Geraint, M. (2010). Systematic review: Impact of constipation on quality of life in adults and children. Alimentary Pharmacology and Therapeutics, 31(9), 938–949. [DOI] [PubMed] [Google Scholar]
  3. De Giorgio, R. , Ruggeri, E. , Stanghellini, V. , Eusebi, L. H. , Bazzoli, F. , & Chiarioni, G. (2015). Chronic constipation in the elderly: A primer for the gastroenterologist. BMC Gastroenterology, 15, 130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Fischbarg, J. (2010). Fluid transport across leaky epithelia: Central role of the tight junction and supporting role of aquaporins. Physiological Reviews, 90(4), 1271–1290. [DOI] [PubMed] [Google Scholar]
  5. Hill, A. E. , & Shachar‐Hill, B. (2006). A new approach to epithelial isotonic fluid transport: An osmosensor feedback model. Journal of Membrane Biology, 210(2), 77–90. [DOI] [PubMed] [Google Scholar]
  6. Horie, I. , Maeda, M. , Yokoyama, S. , Hisatsune, A. , Katsuki, H. , Miyata, T. , & Isohama, Y. (2009). Tumor necrosis factor‐alpha decreases aquaporin‐3 expression in DJM‐1 keratinocytes. Biochemical and Biophysical Research Communications, 387(3), 564–568. [DOI] [PubMed] [Google Scholar]
  7. Ikarashi, N. , Baba, K. , Ushiki, T. , Kon, R. , Mimura, A. , Toda, T. , Ishii, M. , Ochiai, W. , & Sugiyama, K. (2011). The laxative effect of bisacodyl is attributable to decreased aquaporin‐3 expression in the colon induced by increased PGE2 secretion from macrophages. American Journal of Physiology: Gastrointestinal and Liver Physiology, 301(5), G887–G895. [DOI] [PubMed] [Google Scholar]
  8. Ikarashi, N. , Kon, R. , Iizasa, T. , Suzuki, N. , Hiruma, R. , Suenaga, K. , Toda, T. , Ishii, M. , Hoshino, M. , Ochiai, W. , & Sugiyama, K. (2012). Inhibition of aquaporin‐3 water channel in the colon induces diarrhea. Biological and Pharmaceutical Bulletin, 35(6), 957–962. [DOI] [PubMed] [Google Scholar]
  9. Ikarashi, N. , Kon, R. , Kaneko, M. , Mizukami, N. , Kusunoki, Y. , & Sugiyama, K. (2017). Relationship between aging‐related skin dryness and Aquaporins. International Journal of Molecular Sciences, 18(7), 18071559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ikarashi, N. , Kon, R. , & Sugiyama, K. (2016). Aquaporins in the colon as a new therapeutic target in diarrhea and constipation. International Journal of Molecular Sciences, 17(7), 17071172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ikarashi, N. , Mizukami, N. , Pei, C. , Uchino, R. , Fujisawa, I. , Fukuda, N. , Kon, R. , Sakai, H. , & Kamei, J. (2021). Role of cutaneous Aquaporins in the development of Xeroderma in type 2 diabetes. Biomedicine, 9(2), 9020104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ikarashi, N. , Ushiki, T. , Mochizuki, T. , Toda, T. , Kudo, T. , Baba, K. , Ishii, M. , Ito, K. , Ochiai, W. , & Sugiyama, K. (2011). Effects of magnesium sulphate administration on aquaporin 3 in rat gastrointestinal tract. Biological and Pharmaceutical Bulletin, 34(2), 238–242. [DOI] [PubMed] [Google Scholar]
  13. Inoue, R. , Sakaue, Y. , Kawada, Y. , Tamaki, R. , Yasukawa, Z. , Ozeki, M. , Ueba, S. , Sawai, C. , Nonomura, K. , Tsukahara, T. , & Naito, Y. (2019). Dietary supplementation with partially hydrolyzed guar gum helps improve constipation and gut dysbiosis symptoms and behavioral irritability in children with autism spectrum disorder. Journal of Clinical Biochemistry and Nutrition, 64(3), 217–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kappor, M. P. , Sugita, M. , Fukuzawa, Y. , & Okubo, T. (2017). Impact of partially hydrolyzed guar gum (PHGG) on constipation prevention: A systematic review and meta‐analysis. Journal of Functional Foods, 33, 52–66. [Google Scholar]
  15. Kon, R. , Ikarashi, N. , Hayakawa, A. , Haga, Y. , Fueki, A. , Kusunoki, Y. , Tajima, M. , Ochiai, W. , Machida, Y. , & Sugiyama, K. (2015). Morphine‐induced constipation develops with increased aquaporin‐3 expression in the colon via increased serotonin secretion. Toxicological Sciences, 145(2), 337–347. [DOI] [PubMed] [Google Scholar]
  16. Kon, R. , Yamamura, M. , Fujikawa, T. , Umemura, T. , Kusunoki, Y. , Ikarashi, N. , & Sugiyama, K. (2017). Laxative action of sennoside a, which causes decreased colonic aquaporin‐3 expression, is controlled by the anti‐inflammatory effect of glycyrrhizin. Traditional and Kampo Medicine, 5(1), 45–50. [Google Scholar]
  17. Kondo, S. , Xiao, J. Z. , Takahashi, N. , Miyaji, K. , Iwatsuki, K. , & Kokubo, S. (2004). Suppressive effects of dietary fiber in yogurt on the postprandial serum lipid levels in healthy adult male volunteers. Bioscience, Biotechnology, and Biochemistry, 68(5), 1135–1138. [DOI] [PubMed] [Google Scholar]
  18. Kovacs, E. M. , Westerterp‐Plantenga, M. S. , Saris, W. H. , Melanson, K. J. , Goossens, I. , Geurten, P. , & Brouns, F. (2002). The effect of guar gum addition to a semisolid meal on appetite related to blood glucose, in dieting men. European Journal of Clinical Nutrition, 56(8), 771–778. [DOI] [PubMed] [Google Scholar]
  19. Laforenza, U. (2012). Water channel proteins in the gastrointestinal tract. Molecular Aspects of Medicine, 33(5–6), 642–650. [DOI] [PubMed] [Google Scholar]
  20. Levrat‐Verny, M. A. , Behr, S. , Mustad, V. , Remesy, C. , & Demigne, C. (2000). Low levels of viscous hydrocolloids lower plasma cholesterol in rats primarily by impairing cholesterol absorption. Journal of Nutrition, 130(2), 243–248. [DOI] [PubMed] [Google Scholar]
  21. Liu, W. , & Zhi, A. (2021). The potential of quercetin to protect against loperamide‐induced constipation in rats. Food Science & Nutrition, 9(6), 3297–3307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lu, H. A. (2017). Diabetes Insipidus. Advances in Experimental Medicine and Biology, 969, 213–225. [DOI] [PubMed] [Google Scholar]
  23. McCrea, G. L. , Miaskowski, C. , Stotts, N. A. , Macera, L. , & Varma, M. G. (2009). A review of the literature on gender and age differences in the prevalence and characteristics of constipation in North America. Journal of Pain and Symptom Management, 37(4), 737–745. [DOI] [PubMed] [Google Scholar]
  24. Minami, Y. , Inoue, K. , Shimada, S. , Morimura, H. , Miyai, A. , Yamauchi, A. , Matsunaga, T. , & Tohyama, M. (1996). Rapid and transient up‐regulation of Na+/myo‐inositol cotransporter transcription in the brain of acute hypernatremic rats. Brain Research: Molecular Brain Research, 40(1), 64–70. [DOI] [PubMed] [Google Scholar]
  25. Miryan, M. , Soleimani, D. , Alavinejad, P. , Abbaspour, M. , & Ostadrahimi, A. (2022). Effects of propolis supplementation on irritable bowel syndrome with constipation (IBS‐C) and mixed (IBS‐M) stool pattern: A randomized, double‐blind clinical trial. Food Science & Nutrition, 10(6), 1899–1907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Naito, Y. , Ichikawa, H. , Akagiri, S. , Uchiyama, K. , Takagi, T. , Handa, O. , Yasukawa, Z. , Tokunaga, M. , Ishihara, N. , Okubo, T. , Mukai, J. , Ohki, M. , Uchida, K. , & Yoshikawa, T. (2016). Identification of cysteinylated transthyretin, a predictive biomarker of treatment response to partially hydrolyzed guar gum in type 2 diabetes rats, by surface‐enhanced laser desorption/ionization time‐of‐flight mass spectrometry. Journal of Clinical Biochemistry and Nutrition, 58(1), 23–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Okamura, T. , Hamaguchi, M. , Mori, J. , Yamaguchi, M. , Mizushima, K. , Abe, A. , Ozeki, M. , Sasano, R. , Naito, Y. , & Fukui, M. (2022). Partially hydrolyzed guar gum suppresses the development of Sarcopenic obesity. Nutrients, 14(6), 1157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Okubo, T. , Ishihara, N. , Takahashi, H. , Fujisawa, T. , Kim, M. , Yamamoto, T. , & Mitsuoka, T. (1994). Effects of partially hydrolyzed guar gum intake on human intestinal microflora and its metabolism. Bioscience, Biotechnology, and Biochemistry, 58, 1364–1369. [Google Scholar]
  29. Satake, M. , Ikarashi, N. , Ichikawa, Y. , Maniwa, A. , Toda, T. , Ito, K. , Ochiai, W. , & Sugiyama, K. (2010). The role of renal aquaporin 2 in the alleviation of dehydration associated with diabetic polyuria in KKAy mice. Life Sciences, 87(15–16), 475–480. [DOI] [PubMed] [Google Scholar]
  30. Schneider, M. R. , Dahlhoff, M. , Horst, D. , Hirschi, B. , Trulzsch, K. , Muller‐Hocker, J. , Vogelmann, R. , Allgauer, M. , Gerhard, M. , Steininger, S. , Wolf, E. , & Kolligs, F. T. (2010). A key role for E‐cadherin in intestinal homeostasis and Paneth cell maturation. PLoS One, 5(12), e14325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Silberstein, C. , Kierbel, A. , Amodeo, G. , Zotta, E. , Bigi, F. , Berkowski, D. , & Ibarra, C. (1999). Functional characterization and localization of AQP3 in the human colon. Brazilian Journal of Medical and Biological Research, 32(10), 1303–1313. [DOI] [PubMed] [Google Scholar]
  32. Spector, D. A. , Wade, J. B. , Dillow, R. , Steplock, D. A. , & Weinman, E. J. (2002). Expression, localization, and regulation of aquaporin‐1 to −3 in rat urothelia. American Journal of Physiology: Renal Physiology, 282(6), F1034–F1042. [DOI] [PubMed] [Google Scholar]
  33. Sun, S. X. , Dibonaventura, M. , Purayidathil, F. W. , Wagner, J. S. , Dabbous, O. , & Mody, R. (2011). Impact of chronic constipation on health‐related quality of life, work productivity, and healthcare resource use: An analysis of the National Health and wellness survey. Digestive Diseases and Sciences, 56(9), 2688–2695. [DOI] [PubMed] [Google Scholar]
  34. Suzuki, T. (2013). Regulation of intestinal epithelial permeability by tight junctions. Cellular and Molecular Life Sciences, 70(4), 631–659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Takagi, T. , Naito, Y. , Higashimura, Y. , Ushiroda, C. , Mizushima, K. , Ohashi, Y. , Yasukawa, Z. , Ozeki, M. , Tokunaga, M. , Okubo, T. , Katada, K. , Kamada, K. , Uchiyama, K. , Handa, O. , Itoh, Y. , & Yoshikawa, T. (2016). Partially hydrolysed guar gum ameliorates murine intestinal inflammation in association with modulating luminal microbiota and SCFA. British Journal of Nutrition, 116(7), 1199–1205. [DOI] [PubMed] [Google Scholar]
  36. Takayama, S. , Katada, K. , Takagi, T. , Iida, T. , Ueda, T. , Mizushima, K. , Higashimura, Y. , Morita, M. , Okayama, T. , Kamada, K. , Uchiyama, K. , Handa, O. , Ishikawa, T. , Yasukawa, Z. , Okubo, T. , Itoh, Y. , & Naito, Y. (2021). Partially hydrolyzed guar gum attenuates non‐alcoholic fatty liver disease in mice through the gut‐liver axis. World Journal of Gastroenterology, 27(18), 2160–2176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Van Sebille, Y. Z. A. , Gibson, R. J. , Wardill, H. R. , Ball, I. A. , Keefe, D. M. K. , & Bowen, J. M. (2018). Dacomitinib‐induced diarrhea: Targeting chloride secretion with crofelemer. International Journal of Cancer, 142(2), 369–380. [DOI] [PubMed] [Google Scholar]
  38. Verkman, A. S. (2011). Aquaporins at a glance. Journal of Cell Science, 124(Pt 13), 2107–2112. [DOI] [PubMed] [Google Scholar]
  39. Wang, W. W. , Xie, C. L. , Zhou, L. L. , & Wang, G. S. (2014). The function of aquaporin4 in ischemic brain edema. Clinical Neurology and Neurosurgery, 127, 5–9. [DOI] [PubMed] [Google Scholar]
  40. Yasukawa, Z. , Naito, Y. , Takagi, T. , Mizushima, K. , Tokunaga, M. , Ishihara, N. , & Yoshikawa, T. (2012). Partially hydrolyzed guar gum affects the expression of genes involved in host defense functions and cholesterol absorption in colonic mucosa of db/db male mice. Journal of Clinical Biochemistry and Nutrition, 51(1), 33–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yde, J. , Keely, S. , Wu, Q. , Borg, J. F. , Lajczak, N. , O'Dwyer, A. , Dalsgaard, P. , Fenton, R. A. , & Moeller, H. B. (2016). Characterization of AQPs in mouse, rat, and human colon and their selective regulation by bile acids. Frontiers in Nutrition, 3, 46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yu, Y. B. , Zhao, D. Y. , Qi, Q. Q. , Long, X. , Li, X. , Chen, F. X. , & Zuo, X. L. (2017). BDNF modulates intestinal barrier integrity through regulating the expression of tight junction proteins. Neurogastroenterology and Motility, 29(3), e12967. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.

Articles from Food Science & Nutrition are provided here courtesy of Wiley

RESOURCES