Abstract
Probiotics have been increasingly investigated for their role in alleviating symptoms of ulcerative colitis (UC), but the specific mechanism involved remains unclear. We investigated the alleviating effect of Bifidobacterium animalis A6 (BAA6) in UC through a mouse dextran sulfate sodium (DSS) model. When treated with a high dose of BAA6 (1 × 1010 cfu/ml), it was found that colitis symptoms were significantly alleviated, and mucosal damages experienced obvious relief. Moreover, a high dose of BAA6 effectively upregulated free fatty acid receptors 2 and 3 (FFAR2 and FFAR3) expression and butyric acid metabolism specifically. Furthermore, the supplement of BAA6 significantly suppressed pro‐inflammatory cytokines levels (interleukin‐13) and the expression of pore‐forming protein claudin‐2. The upstream regulatory genes of claudin‐2, such as STAT6, GATA4, Cdx2, were also significantly inhibited by BAA6. Collectively, this study concludes that BAA6 attenuated DSS‐induced colitis by increasing the levels of intestinal butyric acid, activating the butyric acid‐FFAR pathway, suppressing excessive proinflammatory response, and protecting the function of the colon epithelial barrier.
Keywords: Bifidobacterium animalis A6, epithelial barrier function, immune function, STAT6, ulcerative colitis
This study suggested that Bifidobacterium animalis A6 attenuated DSS‐induced colitis by increasing the levels of intestinal butyric acid, activating the butyric acid‐FFAR pathway, suppressing excessive proinflammatory response, and protecting colon epithelial barrier function.

1. INTRODUCTION
Ulcerative colitis (UC) is the main form of inflammatory bowel disease (IBD), and the incidence of UC has been increasing worldwide for decades (Molodecky et al., 2012). UC has been convincingly shown to develop as a result of a combination of various factors, including genes, innate immunity, and environmental factors (Malmborg & Hildebrand, 2016). According to clinical studies, UC is difficult to permanently cure due to its high recurrence rate (Lakatos, 2006; Ng, Wong, & Ng, 2016). The existing drugs most commonly used to treat UC are salazosulfamide, prednisone, and antibiotics. However, the clinical uses of these drugs are hampered by adverse effects and UC's high recurrence rates (Vegas‐Sanchez, Rollan‐Landeras, Garcia‐Rodriguez, & Bolas‐Fernandez, 2015). Therefore, novel therapeutic or preventive strategies for UC are urgently needed.
Although the exact etiology and etiopathogenesis of UC have remained elusive, there is no doubt that tight junction (TJ) plays a vital role in the pathogenetic process of UC, which could connect the adjacent cells by sealing the intercellular space and regulating epithelial cell permeability (Lee, 2015). TJ proteins, which were comprised of occluding, claudins, junctional adhesion molecules, and zonula occludens, contributed to intestinal barrier function via their role in the strength and selectivity of paracellular permeability (Oshima, Miwa, & Joh, 2008). Claudin‐2 in particular has been shown to form a channel for small cations and water, resulting in increased paracellular permeability in intestinal (Luettig, Rosenthal, Barmeyer, & Schulzke, 2015). Furthermore, numerous studies have confirmed the high expression of claudin‐2 in colonic samples from UC patients (Weber, Nalle, Tretiakova, Rubin, & Turner, 2008; Zeissig et al., 2007). Claudin‐2 could form antigen complexes by binding, thus allowing the protein antigen to be internalized into epithelial cells and cause epithelial barrier dysfunction (Liu et al., 2013). Various functional food components could effectively ameliorate UC by preventing epithelial barrier dysfunction and suppressing claudin‐2 in mice (Bibi, Kang, Du, & Zhu, 2018; G. Yang, Wang, Kang, & Zhu, 2014).
Probiotics have demonstrated a protective effect in the treatment of UC, such as how administered Bifidobacteria infantis resulted in a therapeutic effect in dextran sodium sulfate (DSS) murine model (Ewaschuk et al., 2008). The UC patients who received treatment with a combination of Lactobacillus and Bifidobacterium showed fewer relapses and longer remission periods (Wildt, Nordgaard, Hansen, Brockmann, & Rumessen, 2011). Meanwhile, live Lactobacillus GG has shown improved barrier function with downregulation of claudin‐2 expression in NEC mice (Bergmann et al., 2013). Live Bifidobacterium infantis similarly has shown increased transepithelial resistance and decreased claudin‐2 in T84 cells (Ewaschuk et al., 2008). Probiotics may upregulate intestinal microbial metabolism of short‐chain fatty acids (SCFA), which could strengthen epithelial barrier integrity and suppress excessive inflammation response (D. Yang et al., 2021). SCFAs, like acetate, propionate, and butyrate, can activate the expression of the Free Fatty Acid Receptors (FFAR2 and FFAR3) of intestinal cells and exhibit anti‐inflammatory effects on colonic epithelium and immune cells (Kimura, Ichimura, Ohue‐Kitano, & Igarashi, 2020). Previous studies have demonstrated that the inhibition of pro‐inflammatory cytokines may contribute to the improvement of mucosal barrier function and intestinal permeability in UC patients and mice models (Creyns et al., 2020; Oh et al., 2020). These studies led us to deduce that probiotics might exhibit an ameliorating inflammatory effect via the SCFA‐FFAR pathway.
As stated above, Bifidobacterium animalis A6 (BAA6) was separated from the feces of the longevous population from Bama, Guangxi, China (Sun et al., 2015), which is famous for its long‐lived population and the rarity of bowel diseases among the local population. Therefore, we propose that this bacterium serve as a candidate to provide a new option for the treatment of UC. To study the possible therapeutic strategies for UC, we selected a model of oral administration of DSS induces colonic inflammation, which is similar to human UC (Pan et al., 2014; Tsang et al., 2015). The main goal of the present study was to investigate the potential effects and putative mechanism of BAA6 in the DSS colitis model.
2. MATERIALS AND METHODS
2.1. Animals and groups
Male BALB/c mice that were 6 weeks old and had a body weight of 20–25 g were obtained from Vital River (Vital River Laboratory Animal Technology Co., Ltd, Beijing, China). After quarantine, mice were divided into five groups. All experimental protocols were followed in accordance with institutional guidelines (GB 14925, 2010/63/EU). UC was induced by continuous oral administration of DSS (2.5% w/v, TdB Consultancy, Uppsala, Sweden) in distilled water from Day 1 to Day 7. The experimental protocol was as follows: Group 1, the untreated control (Control); Group 2, DSS‐treated group (DSS); Group 3, high dose BAA6 (1 × 1010 CFU/mL, 0.2 ml/d) treatment after 1,2‐dimethylhydrazine (DMH) initiation (H‐BAA6/DSS); Group 4, medium dose BAA6 (1 × 108 CFU/ml, 0.2 ml/d) treatment after DMH initiation (M‐BAA6/DSS); Group 5, low dose BAA6 (1 × 106 CFU/ml, 0.2 ml/d) treatment after DMH initiation (L‐BAA6/DSS). BAA6 was administered once per day to Groups 3–5 from Day 8 to Day 14.
2.2. Experimental design
Daily body weight was monitored. The severity of UC was assessed according to the disease activity index (DAI), which was calculated by weight loss score, fecal trait score, and blood test score as described in previous studies (Murthy et al., 1993). The mice were anesthetized and sacrificed after 14 days. Colons were then excised at necropsy at which point they were subjected to length measurements and opened longitudinally. A segment of the distal colon that was 1 cm in length was immediately fixed in PBS‐buffered 10% (v/v) formaldehyde solution. The paraffin‐embedded sections were cut for hematoxylin and eosin stain (HE) staining and immunocytochemistry. A histological score was determined as previously described (Dieleman et al., 1998).
2.3. Myeloperoxidase assay of colon tissue
Colonic tissues were homogenized in 9 volumes of cold saline solution. The MPO activity was determined according to the protocol described by the manufacturer (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). MPO activity was reported as per gram units of sample, and one unit of MPO activity was defined as the amount of enzyme that degraded to 1 mmol hydrogen peroxide/min at 25°C.
2.4. Immunocytochemistry assay of colon tissue
Immunocytochemistry analyses were performed in accordance with the manufacturer's instructions (Wuhan Guge, Wuhan, China). Anti‐claudin‐2 antibodies were obtained from Abcam (Cambridge, MA, USA). Each section of the colons was deparaffinized and rehydrated, and the antigen was then retrieved. All paraffin sections were then blocked by a hydrogen peroxide/methanol solution and decolorized in PBS in order to execute the following steps. The sections were incubated with the anti‐claudin2 antibody (1:200) overnight at 4°C. After being washed with PBS, HRP‐conjugated streptavidin (Biocare Medical, Concord, CA, USA) was used as the secondary antibody and incubated with the sections for 50 min at RT. The sections were then washed in a PBS solution and coloration with 3,3‐diaminobenzidin (DAB). The yellow or brown‐yellow granules are positively stained claudin‐2 proteins. After each section was washed with distilled water to finish coloration, they were stained with hematoxylin, dehydrated, and mounted with neutral gums. The immunohistochemical staining was quantified using Image‐Pro plus software (Version 6.0, Media Cybernetics, Bethesda, MD USA) based on the previously reported protocol (Guerra et al., 2015).
2.5. Western blot assays
Protein expression levels of β‐actin, FFAR2, and FFAR3 were detected by WB analysis. The colon was tissue carefully removed and homogenized. After conducting a quantitative determination of protein concentration, WB analysis was performed as previously described (Araujo et al., 2017). Primary antibodies against β‐actin, FFAR2, and FFAR3 were purchased from Abcam (Cambridge, MA, USA).
2.6. Determination of SCFAs in the feces
Fecal samples were moderately diluted, placed at room temperature for 10 min and then centrifuged at 5000 r/min for 10 min. The supernatant was taken for 0.22 μm microporous membrane filtration for GC detection. The SCFAs content was determined and calculated according to the previously mentioned method (Ou et al., 2019). 7890B GC system (Agilent, USA) was used to determine the concentration of SCFAs.
2.7. Quantitative Real‐Time PCR
RNA from each colon tissue was extracted using TRIzol® Reagent (Tiangen Biotech, Beijing, China P.R.) and then reverse transcribed into cDNA. Real‐time PCR conditions were performed based on the manufacturer's protocol in the TaKaRa Real‐Time PCR Kit (Takara, Bio, Japan). The primers for Cdx2, signal transducers, and activators of transcription 6 (STAT6) and GATA4 were designed by Primer Premier (Version 5.0, Biosoft International, Palo Alto, CA). The sequences of the primers are summarized in Table 1. All reactions were performed in triplicate, and the detected mRNA expression was normalized to GAPDH.
TABLE 1.
Primer sequences for the real‐time PCR
| Gene | Sequence(5′‐3′) |
|---|---|
| GAPDH |
F: ACCACAGTCCATGCCATCAC R: TCCACCACCCTGTTGCTGTA |
| Claudin‐2 |
F:CTCCTGGGATTCATTCCTGTTG R:TCAGGCACCAGTGGTGAGTAGA |
| STAT6 |
F:CAACGGCTCTATGTTGACTT R:AGATGCTGTTTCCCTTCC |
| GATA4 |
F: CTGGAGCAACCGCAAATC R: CACGAGGCAGACAAGAACTAG |
| Cdx2 |
F:ACAACCTTCCCAGCCTCA R:TTCTCGCAGCGTCCATAC |
| Butyryl‐CoA acetate‐CoA transferase |
F: AGGATCTCGGIRTICAYWSIGARATG R: GAGGTCGTCICKRAAITYIGGRTGNGC |
| Butyrate kinase |
F: TGCTGTWGTTGGWAGAGGYGGA R: GCAACIGCYTTTTGATTTAATGCATGG |
Fecal bacterial DNA was extracted from fecal samples using the QIAamp® DNA Stool mini kit (Qiagen, Germany), and the DNA concentrations were then determined by Nanodrop. The abundance of butyrate kinase and butyryl CoA: acetate CoA transferase genes in DNA extracted from fecal samples was measured by real‐time PCR as described above (Xu et al., 2017). 25 ng DNA was used as a template for each reaction. The sequences of primers are summarized in Table 1. The abundance of functional genes was expressed as log10 gene copies of total DNA / g of fresh fecal samples.
2.8. Measure of Interleukin‐13 and tumor necrosis factor‐α in each group
Each of the colonic tissues were homogenized in cold Tris–HCl buffer (100 mM, pH 7.0) in the presence of protease inhibitors. After centrifugation, the protein contents of supernatant were quantified using bicinchoninic acid assay (BCA) (Beyotime, Shanghai, China). Pro‐Inflammatory cytokines (IL‐13 and TNF‐α) in supernatants were measured with the ELISA kit (R&D, Emeryville, CA, USA). The contents of cytokines were expressed as pg/mg protein.
2.9. Statistical analysis
Statistical analysis was performed using SPSS (Version 17.0, SPSS Inc., USA) and the results were expressed as mean ± standard deviation. An ANOVA test and unpaired Student's t‐test were used for evaluating the significance of the differences among the groups, with p value <.05 being regarded as statistically significant. The graphs were generated using GraphPad Prism (Version 8.0, GraphPad Software Inc., USA).
3. RESULTS
3.1. BAA6 alleviated colonic shortening of DSS‐treated mice
Colonic shortening is a typical symptom of colitis in mice. As shown in Figure 1, DSS treatment shortened colon length by 30.2% compared to the control group (p < .05). A high dose of BAA6 (H‐BAA6/DSS group) significantly alleviated the effects of DSS on colon shortening (Figure 1), although it was still shorter than the control group (p < .05). The colon length of the M‐BAA6/DSS and L‐BAA6/DSS groups increased by 9.54% and 8.58% in comparison with the DSS group, but the increases were not noteworthy (p > .05).
FIGURE 1.

BAA6 alleviated colonic shortening of DSS‐treated mice. (a) Representative photographs of colon lengths. (b) Length of colons in all mice groups after being sacrificed.
3.2. BAA6 reduced the severity of colitis in mice colons
DAI scores of different groups are summarized in Figure 2b. The DAI was much lower in mice administered with BAA6 than in DSS‐only treated mice, and it was higher compared to the control group. Significant differences between the H‐BAA6/DSS group and other groups were also observed. (p < .05).
FIGURE 2.

BAA6 alleviated DSS‐induced representative symptoms of colitis. (a) HE staining colonic tissue, (b) disease activity index (DAI), (c) histological scores, and (d) MPO activity.
The HE stainings of colon tissues are shown in Figure 2a. The colon slides of the DSS group displayed the loss of crypts, depleted goblet cells, and a destroyed epithelial layer. Oral BAA6 administration attenuated the severity of colitis in comparison with the DSS group, but they were still worse than control group. The histological scores were consistent with the HE staining observation (Figure 2c). The histological score of the administered BAA6 groups was remarkably lower than the DSS group (p < .05) but was not significantly different from each other.
3.3. BAA6 restored the upregulation of MPO activity induced by DSS
MPO activity has been reported to indirectly reflect the degree of inflammation in the tissue because it is regarded as a maker of neutrophil accumulation and activation (Tang et al., 2015). Moreover, excessive secretion of MPO in intestinal tissue occurred in response to produce oxidative stress (Sang et al., 2014). As displayed in Figure 2d, the MPO activity was significantly elevated in the DSS group in comparison with the other groups. When BAA6 was given, an obvious decrease in MPO activity was observed (p < .05). It is worth mentioning that no noticeable difference could be distinguished among the H‐BAA6/DSS and control group, which implies the powerful inhibitory effects on inflammation and oxidative stress of high‐dose BAA6.
3.4. BAA6 promoted the butyric acid metabolism of the gut microbiome
The impact of BAA6 on fecal SCFA levels is presented in Figure 3a. The results showed that butyric acid content in the DSS group was significantly lower than the control group (p < .05). At the same time, the contents of acetic acid and propionic acid in the DSS group also decreased, but the variation was not significant compared with the control group. The high doses of BAA6 significantly reversed the decrease in butyric acid induced by DSS. In addition, the rising tendencies of acetic acid and propionic acid were also observed in the BAA6 treatment group, and the change was not statically significant.
FIGURE 3.

BAA6 promoted the butyric acid metabolism of gut. (a) the impact of BAA6 on fecal SCFA levels; (b) effect of BAA6 on expression levels of two major butyric acid metabolism enzymes in feces, butyrate kinase, and butyryl CoA: Acetate CoA transferase.
To find the cause of butyric acid upregulation, we determined the expression levels of two major butyric acid metabolism enzymes in feces, butyrate kinase, and butyryl CoA: acetate CoA transferase. As shown in Figure 3b, there were no significant differences between groups in the expression of butyrate kinase. However, DSS treatment significantly downregulated the expression of butyryl CoA: acetate CoA transferase (p < .05). Satisfactorily, after the intervention of BAA6 at three dosages, the levels of butyryl CoA: acetate CoA transferase had returned to nearly normal levels (vs. Control group, p > .05).
3.5. BAA6 activated expression levels of FFAR‐2 and FFAR‐3 in colon tissue
FFAR2 and FFAR3 of intestinal cells can be activated by SCFAs including acetate, propionate, and butyrate. To validate whether SCFA‐FFAR activation occurred after administration of BAA6, WB analysis of FFAR was performed. As shown in Figure 4, DSS treatment significantly decreased the expression of FFAR2 and FFAR3 in colon tissue (p < .05). Notably, after treatment with the high dose of BAA6, the protein expressions of FFAR2 and FFAR3 were significantly increased, respectively, and were higher than in the DSS group and close to the normal levels (vs. Control group, p > .05). The results above implied that BAA6 may affect butyric acid metabolism and activate the expression of FFAR2 and FFAR3 in colonic mucosal cells.
FIGURE 4.

BAA6 activated protein expression levels of FFAR‐2 and FFAR‐3 in colon tissue.
3.6. BAA6 regulated gene expression of Claudin‐2
Claudin‐2 is predominantly upregulated during intestinal inflammation, and it has been suggested to have channel‐forming functions that eventually lead to intestinal leakage. We thereby determined the protein and mRNA expression levels of claudin‐2 in colon tissue. Representative immunohistochemical expression of claudin‐2 in different groups is shown in Figure 5a. In normal colonic tissue, only slight immunoreactivity for claudin‐2 was observed. By contrast, claudin‐2 was highly expressed in the intestinal mucosa of DSS‐treated rats. The immunohistochemical staining score for claudin‐2 showed a similar trend (Figure 5b). The high doses of BAA6 significantly reduced claudin‐2 immunoreactivity in comparison with the DSS group (Figure 5b, p < .05) and eventually reinstated to the normal levels. Likewise, the RT–PCR results showed that gene expression of Claudin‐2 was remarkably suppressed by the high and medium doses of BAA6 (Figure 5c, p < .05).
FIGURE 5.

BAA6 attenuated the expression of claudin‐2 in the intestinal epithelial cells of acute colitis. (a) Representative immunohistochemical staining of claudin‐2; (b) the immunohistochemical staining score of claudin‐2; (c) Claudin‐2 mRNA level.
3.7. BAA6 regulated the excessive Pro‐Inflammatory response
Given that the upregulation of pro‐inflammatory cytokines is closely associated with claudin‐2 overexpression and FFAR deficiency (Huang et al., 2021; Rosen et al., 2011; Sakaguchi et al., 2002), we determined the expression levels of two pro‐inflammatory cytokines (TNF‐α and IL‐13). As displayed in Figure 6, IL‐13 and TNF‐α expression were significantly increased in the DSS group (p < .05). Oral administration of BAA6 could remarkably decrease the secretion of IL‐13 in dose‐dependent effect (p < .05). In comparison, the levels of TNF‐α slightly decreased after BAA6 treatment, but the reduction was not significant (p > .05).
FIGURE 6.

BAA6 reduced pro‐inflammatory cytokines expression in colon tissue.
3.8. BAA6 regulated the expression transcription factors and STAT6
The upregulated expression of claudin‐2 has indeed been documented and is associated with transcription factors (Cdx2, GATA4) and STAT6 (Rosen et al., 2013; Takeda, Kamanaka, Tanaka, Kishimoto, & Akira, 1996). To test the mRNA levels of STAT6, GATA4, and Cdx2, real‐time PCR analysis was performed. As shown in Figure 7a, b, the STAT6 and GATA4 gene expressions of the DSS group were significantly elevated in comparison with the control group (p < .05) and reduced in BAA6‐treated mice. The decrease was more pronounced with higher BAA6 concentrations. However, Cdx2 gene expressions in the DSS group were slightly reduced in comparison with the control group (p < .05), and further decreased in the H‐BAA6/DSS and M‐BAA6/DSS groups (p < .05). The data collectively suggested that BAA6 supplementation inhibited the expression of Claudin‐2‐associated genes. Taken as a whole, the mRNA expression levels of the STAT6, GATA4, and Cdx2 were positively correlated with IL‐13 and claudin‐2 in each group.
FIGURE 7.

Effects of oral administration of BAA6 on STAT6, GATA4, and Cdx2 gene expression of colon tissues.
4. DISCUSSION
UC is a complex, long‐term chronic IBD that accompanies typical symptoms such as abscesses, ulcerations, and bleeding (Di Sabatino, Biancheri, Rovedatti, MacDonald, & Corazza, 2012). Multiple studies show that probiotics might play a role in attenuating inflammation and histological symptoms in patients with UC (de Oliveira, Leite, Higuchi, Gonzaga, & Mariano, 2017). The present study illustrated BAA6 possessed preventive effects against DSS‐induced colitis via several targets. It could increase the content of SCFAs in the intestine, especially butyric acid, activate SCFA receptors (FFAR2 and FFAR3) to utilize beneficial metabolites from the gut, suppress excessive proinflammatory IL‐13 cytokines to alleviate inflammatory responses, and decrease the expression of Claudin‐2 to enhance the intestinal barrier.
The DSS‐induced colitis model effectively mimics the typical clinical and histological symptoms of human UC, such as weight loss, stool consistency, and fecal bleeding. In the mice UC model, the DAI score is used as the basis for the evaluation of these symptoms above (Pan et al., 2014). In addition, the histological score represents the injuries of intestine mucosa and muscularis, further demonstrating the severity of inflammation (Guerra et al., 2015). MPO activity has been reported to reflect the levels of inflammation in colon tissues indirectly because it is usually regarded as a maker of neutrophil accumulation and activation (Balaha, Kandeel, & Elwan, 2016; Sang et al., 2014). In this study, we proved that BAA6 played a protective role in the colitis induced by DSS as indicated by deceased DAI and the histological score, attenuated MPO activity, and mucosal damage. All these results implied that BAA6 can be used as a potential supplement to treat or prevent UC.
The content of SCFAs in feces is becoming an important clinical indicator to judge the intestinal health status of patients with IBDs, which include UC and Crohn's disease (Zhgun et al., 2020). Low levels of SCFAs may lead to a series of problems such as reduced intestinal peristalsis, barrier dysfunction, and excessive inflammation (Parada Venegas et al., 2019). Intestinal microbes, as the main producer of SCFAs, are the primary reason for the insufficient synthesis ability of SCFAs. In the present study, BAA6 intervention reversed the decrease in butyric acid induced by DSS, which suggests that BAA6 may improve the structure of intestinal microbes and the synthesis capability of butyric acid. The biosynthesis of butyrate can occur via the butyrate kinase or the butyryl CoA: acetate CoA transferase pathway (Xu et al., 2017). We also assessed the two terminal genes that provided information specifically targeting the activity of butyrate production. The present study confirmed that butyryl CoA: acetate CoA transferase upregulation may be associated with the change in butyric acid content.
SCFAs exerted beneficial physiological effects through various mechanisms, however, their signaling through FFAR2/3 is a new therapeutic target to shape host health (Mishra, Karunakar, Taraphder, & Yadav, 2020). FFAR2/3, as widely expressed cell surface receptors, can bind endogenous SCFAs specifically, which ensured that the SCFAs produced in the intestine would also be absorbed by other cells including adipocytes, splenocytes, and monocytes (Ang et al., 2016; Kimura et al., 2011; Veprik, Laufer, Weiss, Rubins, & Walker, 2016). In addition to absorption, FFAR2/3 can also be activated by SCFAs, which contributed to various biological or physiological functions such as anti‐inflammation response (Kimura et al., 2011). The present study also proved that the protein levels of FFAR‐2 and FFAR‐3 in colon tissue were upregulated after BAA6 intervention. Taken together, we speculated that administration of BAA6 promoted butyric acid biosynthesis and upregulated the expression of FFAR simultaneously, resulting in the activation of the SCFA‐FFAR signaling cascade.
The damaged intestinal barrier function is one important reason for the pathogenesis of UC (Antoni, Nuding, Wehkamp, & Stange, 2014). UC induced by DSS have been explained by a toxic effect on colonic mucous epithelial cells, followed by the stimulation of local immune responses changing the barrier function of colonic mucous epithelial cells. A damaged mucosa layer causes alterations in intercellular permeability, which is regulated by the junctional repertoire of various tight junction proteins (Fries, Belvedere, & Vetrano, 2013). To date, the tight junction protein claudin‐2 has been proven to increase the intercellular permeability of water and small cations. The over‐expression of claudin‐2 supports a key role of impaired barrier function of UC (Gunzel & Yu, 2013). Ewaschuk et al. demonstrated that Bifidobacterium infantis could effectively decrease expression of claudin‐2 (Ewaschuk et al., 2008). In the present study, claudin‐2 overexpression induced in the DSS group was significantly suppressed by BAA6 in protein and mRNA levels. Thus, we postulated that claudin‐2 may be the molecular target of the BAA6 anti‐inflammatory action.
Pro‐inflammatory cytokines may aggravate the severity of DSS‐induced colitis, and they were regarded as major contributing factors to mucosa barrier dysfunction. IL‐13, the key effector th2 cytokine secreted by natural killer T cells, contributed to the mucosa inflammation and claudin‐2 upregulation (Ahmad et al., 2014; Heller et al., 2005; Oshima et al., 2008). Michael J. et al. demonstrated that the mucosa barrier damage induced by IL‐13 in murine colitis is STAT6 dependent, and IL‐13 played a key role in the pathogenesis of colitis (Rosen et al., 2013). Similarly, using a STAT6 knockout mouse model, another group proved that the upregulation of intestinal permeability induced by IL‐13 is STAT6‐dependent (Rosen et al., 2011). Previous studies had proven that the IL‐13 level was markedly reduced in DSS‐induced colitis after administrated with probiotics (Mastrangeli et al., 2009; Toomer et al., 2014). However, the relationship between the STAT6 pathway and probiotics is obscure. In our study, we found that the secretion of IL‐13 was markedly inhibited in the H‐BAA6/DSS and M‐BAA6/DSS groups, which was consistent with the above reports. In addition, dietary BAA6 supplementation suppressed the STAT6 expression level, which was proportional to the expression of claudin‐2. Based on the results of this study, BAA6 may prove to be an effective treatment in prevention against intestinal barrier dysfunction.
There was evidence that transcription factor Cdx2 and GATA4 activated the claudin‐2 promoter in the human intestinal cell line (Sakaguchi et al., 2002) considered in cooperation. Other evidences demonstrated that the protein level of claudin‐2 was upregulated by transcriptional factors (Cdx1, Cdx2, HNF‐1α, and GATA‐4) in the intestinal cell line or HIEC‐6 cells (Ikari, Sato, Watanabe, Yamazaki, & Sugatani, 2012). However, the mechanisms behind the transcription factors and probiotics are rarely the focus of research. In the present study, GATA4 expression levels after DSS treated were prominently increased in comparison with the control group, which were significantly attenuated by BAA6 supplementation. In addition, the Cdx2 expression levels were inhibited by BAA6 supplementation. These results suggest that GATA4 and Cdx2 genes have been implicated in regulating the BAA6 protective processes. Collectively, we concluded that the main alleviating mechanism of BAA6 was improving intestinal epithelial barrier function through the inhibition of claudin‐2, which was regulated by the suppression of the IL‐13‐induced STAT6 pathway.
5. CONCLUSIONS
In summary, the present study illustrated that BAA6 possessed preventive effects against DSS‐induced colitis via several targets. It could increase the content of SCFAs in the intestine, especially butyric acid, and activate SCFA receptors (FFAR2 and FFAR3) to utilize beneficial metabolites from gut. Meanwhile, supplementing BAA6 significantly suppressed pro‐inflammatory cytokines levels (interleukin‐13) and the expression of pore‐forming protein claudin‐2. In addition, upstream regulatory genes of claudin‐2, such as STAT6, GATA4, and Cdx2, were significantly inhibited by BAA6. Overall results suggest that BAA6 could be explored as a promising prophylactic agent for UC.
FUNDING INFORMATION
This work was supported by the National Natural Science Foundation of China (31601443, 32101938).
CONFLICT OF INTEREST
The authors declare no conflict of interest.
ACKNOWLEDGMENTS
Thanks to all the authors for their contributions to this article.
Wu, F. , Wuri, G. , Fang, B. , Shi, M. , Zhang, M. , & Zhao, L. (2023). Alleviative mechanism and effect of Bifidobacterium animalis A6 on dextran sodium sulfate‐induced ulcerative colitis in mice. Food Science & Nutrition, 11, 892–902. 10.1002/fsn3.3124
Fang Wu and Guna Wuri contributed equally to this work and should be considered co‐first authors.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available on request from the corresponding author.
REFERENCES
- Ahmad, R. , Chaturvedi, R. , Olivares‐Villagomez, D. , Habib, T. , Asim, M. , Shivesh, P. , & Singh, A. B. (2014). Targeted colonic claudin‐2 expression renders resistance to epithelial injury, induces immune suppression, and protects from colitis. Mucosal Immunology, 7(6), 1340–1353. 10.1038/mi.2014.21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ang, Z. W. , Er, J. Z. , Tan, N. S. , Lu, J. H. , Liou, Y. C. , Grosse, J. , & Ding, J. L. (2016). Human and mouse monocytes display distinct signalling and cytokine profiles upon stimulation with FFAR2/FFAR3 short‐chain fatty acid receptor agonists. Scientific Reports, 6, 34145. 10.1038/srep34145 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Antoni, L. , Nuding, S. , Wehkamp, J. , & Stange, E. F. (2014). Intestinal barrier in inflammatory bowel disease. World Journal of Gastroenterology, 20(5), 1165–1179. 10.3748/wjg.v20.i5.1165 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Araujo, A. A. , Pereira, A. , Medeiros, C. , Brito, G. A. C. , Leitao, R. F. C. , Araujo, L. S. , & Araujo Junior, R. F. (2017). Effects of metformin on inflammation, oxidative stress, and bone loss in a rat model of periodontitis. PLoS One, 12(8), e0183506. 10.1371/journal.pone.0183506 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Balaha, M. , Kandeel, S. , & Elwan, W. (2016). Garlic oil inhibits dextran sodium sulfate‐induced ulcerative colitis in rats. Life Sciences, 146, 40–51. 10.1016/j.lfs.2016.01.012 [DOI] [PubMed] [Google Scholar]
- Bergmann, K. R. , Liu, S. X. L. , Tian, R. L. , Kushnir, A. , Turner, J. R. , Li, H. L. , & de Plaen, I. G. (2013). Bifidobacteria stabilize claudins at tight junctions and prevent intestinal barrier dysfunction in mouse necrotizing enterocolitis. American Journal of Pathology, 182(5), 1595–1606. 10.1016/j.ajpath.2013.01.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bibi, S. , Kang, Y. F. , Du, M. , & Zhu, M. J. (2018). Dietary red raspberries attenuate dextran sulfate sodium‐induced acute colitis. Journal of Nutritional Biochemistry, 51, 40–46. 10.1016/j.jnutbio.2017.08.017 [DOI] [PubMed] [Google Scholar]
- Creyns, B. , Jacobs, I. , Verstockt, B. , Cremer, J. , Ballet, V. , Vandecasteele, R. , & Breynaert, C. (2020). Biological therapy in inflammatory bowel disease patients partly restores intestinal innate lymphoid cell subtype equilibrium. Frontiers in Immunology, 11, 1847. 10.3389/fimmu.2020.01847 [DOI] [PMC free article] [PubMed] [Google Scholar]
- de Oliveira, G. L. V. , Leite, A. Z. , Higuchi, B. S. , Gonzaga, M. I. , & Mariano, V. S. (2017). Intestinal dysbiosis and probiotic applications in autoimmune diseases. Immunology, 152(1), 1–12. 10.1111/imm.12765 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Di Sabatino, A. , Biancheri, P. , Rovedatti, L. , MacDonald, T. T. , & Corazza, G. R. (2012). Recent advances in understanding ulcerative colitis. Internal and Emergency Medicine, 7(2), 103–111. 10.1007/s11739-011-0719-z [DOI] [PubMed] [Google Scholar]
- Dieleman, L. A. , Palmen, M. J. H. J. , Akol, H. , Bloemena, E. , Pena, A. S. , Meuwissen, S. G. M. , & van Rees, E. P. (1998). Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clinical and Experimental Immunology, 114(3), 385–391. 10.1046/j.1365-2249.1998.00728.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ewaschuk, J. B. , Diaz, H. , Meddings, L. , Diederichs, B. , Dmytrash, A. , Backer, J. , Langen, M. L.‐v. , & Madsen, K. L. (2008). Secreted bioactive factors from Bifidobacterium infantis enhance epithelial cell barrier function. American journal of physiology‐gastrointestinal and liver Physiology, 295(5), G1025–G1034. 10.1152/ajpgi.90227.2008 [DOI] [PubMed] [Google Scholar]
- Fries, W. , Belvedere, A. , & Vetrano, S. (2013). Sealing the broken barrier in IBD: Intestinal permeability, epithelial cells and junctions. Current Drug Targets, 14(12), 1460–1470. 10.2174/1389450111314120011 [DOI] [PubMed] [Google Scholar]
- Guerra, G. C. B. , Araujo, A. A. , Lira, G. A. , Melo, M. N. , Souto, K. K. O. , Fernandes, D. , & Araujo, R. F. (2015). Telmisartan decreases inflammation by modulating TNF‐alpha, IL‐10, and RANK/RANKL in a rat model of ulcerative colitis. Pharmacological Reports, 67(3), 520–526. 10.1016/j.pharep.2014.12.011 [DOI] [PubMed] [Google Scholar]
- Gunzel, D. , & Yu, A. S. L. (2013). Claudins and the modulation of tight junction permeability. Physiological Reviews, 93(2), 525–569. 10.1152/physrev.00019.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Heller, F. , Florian, P. , Bojarski, C. , Richter, J. , Christ, M. , Hillenbrand, B. , & Schulzke, J. D. (2005). Interleukin‐13 is the key effector Th2 cytokine in ulcerative colitis that affects epithelial tight junctions, apoptosis, and cell restitution. Gastroenterology, 129(2), 550–564. 10.1053/j.gastro.2005.05.002 [DOI] [PubMed] [Google Scholar]
- Huang, G. T. , Wang, Z. N. , Wu, G. X. , Zhang, R. F. , Dong, L. H. , Huang, F. , Zhang, M. , & Su, D. X. (2021). Lychee (Litchi chinensis Sonn.) pulp phenolics activate the short‐chain fatty acid‐free fatty acid receptor anti‐inflammatory pathway by regulating microbiota and mitigate intestinal barrier damage in dextran sulfate sodium‐induced colitis in mice. Journal of Agricultural and Food Chemistry, 69(11), 3326–3339. 10.1021/acs.jafc.0c07407 [DOI] [PubMed] [Google Scholar]
- Ikari, A. , Sato, T. , Watanabe, R. , Yamazaki, Y. , & Sugatani, J. (2012). Increase in claudin‐2 expression by an EGFR/MEK/ERK/c‐Fos pathway in lung adenocarcinoma A549 cells. Biochimica et Biophysica Acta‐Molecular Cell Research, 1823(6), 1110–1118. 10.1016/j.bbamcr.2012.04.005 [DOI] [PubMed] [Google Scholar]
- Kimura, I. , Ichimura, A. , Ohue‐Kitano, R. , & Igarashi, M. (2020). Free fatty acid receptors in health and disease. Physiological Reviews, 100(1), 171–210. 10.1152/physrev.00041.2018 [DOI] [PubMed] [Google Scholar]
- Kimura, I. , Inoue, D. , Maeda, T. , Hara, T. , Ichimura, A. , Miyauchi, S. , & Tsujimoto, G. (2011). Short‐chain fatty acids and ketones directly regulate sympathetic nervous system via G protein‐coupled receptor 41 (GPR41). Proceedings of the National Academy of Sciences of the United States of America, 108(19), 8030–8035. 10.1073/pnas.1016088108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lakatos, P. L. (2006). Recent trends in the epidemiology of inflammatory bowel diseases: up or down? World Journal of Gastroenterology, 12(38), 6102–6108. 10.3748/wjg.v12.i38.6102 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee, S. H. (2015). Intestinal permeability regulation by tight junction: Implication on inflammatory bowel diseases. Intestinal Research, 13(1), 11–18. 10.5217/ir.2015.13.1.11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu, X. Y. , Yang, G. , Geng, X. R. , Cao, Y. J. , Li, N. , Ma, L. , & Liu, Z. G. (2013). Microbial products induce claudin‐2 to compromise gut epithelial barrier function. Plos one, 8, 0068547. 10.1371/journal.pone.0068547 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luettig, J. , Rosenthal, R. , Barmeyer, C. , & Schulzke, J. D. (2015). Claudin‐2 as a mediator of leaky gut barrier during intestinal inflammation. Tissue barriers, 3, e977176. 10.4161/21688370.2014.977176 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Malmborg, P. , & Hildebrand, H. (2016). The emerging global epidemic of paediatric inflammatory bowel disease–causes and consequences. Journal of Internal Medicine, 279(3), 241–258. 10.1111/joim.12413 [DOI] [PubMed] [Google Scholar]
- Mastrangeli, G. , Corinti, S. , Butteroni, C. , Afferni, C. , Bonura, A. , Boirivant, M. , Colombo, P. , & di Felice, G. (2009). Effects of live and inactivated VSL#3 probiotic preparations in the modulation of in vitro and in vivo allergen‐induced Th2 responses. International Archives of Allergy and Immunology, 150(2), 133–143. 10.1159/000218116 [DOI] [PubMed] [Google Scholar]
- Mishra, S. P. , Karunakar, P. , Taraphder, S. , & Yadav, H. (2020). Free fatty acid receptors 2 and 3 as microbial metabolite sensors to shape host health: Pharmacophysiological view. Biomedicine, 8(6), 8060154. 10.3390/biomedicines8060154 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Molodecky, N. A. , Soon, I. S. , Rabi, D. M. , Ghali, W. A. , Ferris, M. , Chernoff, G. , & Kaplan, G. G. (2012). Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology, 142(1), 46–54. 10.1053/j.gastro.2011.10.001 [DOI] [PubMed] [Google Scholar]
- Murthy, S. N. S. , Cooper, H. S. , Shim, H. , Shah, R. S. , Ibrahim, S. A. , & Sedergran, D. J. (1993). Treatment of dextran sulfate sodium‐induced murine colitis by intracolonic cyclosporine. Digestive Diseases and Sciences, 38(9), 1722–1734. 10.1007/Bf01303184 [DOI] [PubMed] [Google Scholar]
- Ng, W. K. , Wong, S. H. , & Ng, S. C. (2016). Changing epidemiological trends of inflammatory bowel disease in Asia. Intestinal Research, 14(2), 111–119. 10.5217/ir.2016.14.2.111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oh, W. S. , Jung, J. C. , Choi, Y. M. , Mun, J. Y. , Ku, S. K. , & Song, C. H. (2020). Protective effects of fermented rice extract on ulcerative colitis induced by dextran sodium sulfate in mice. Food Science and Nutrition, 8(3), 1718–1728. 10.1002/fsn3.1460 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oshima, T. , Miwa, H. , & Joh, T. (2008). Changes in the expression of claudins in active ulcerative colitis. Journal of Gastroenterology and Hepatology, 23, S146–S150. 10.1111/j.1440-1746.2008.05405.x [DOI] [PubMed] [Google Scholar]
- Ou, Y. , Chen, S. , Ren, F. , Zhang, M. , Ge, S. , Guo, H. , & Zhao, L. (2019). Lactobacillus casei strain Shirota alleviates constipation in adults by increasing the pipecolinic acid level in the gut. Frontiers in Microbiology, 10, 00324. 10.3389/fmicb.2019.00324 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pan, T. , Guo, H. Y. , Zhang, H. , Liu, A. P. , Wang, X. X. , & Ren, F. Z. (2014). Oral administration of lactobacillus paracasei alleviates clinical symptoms of colitis induced by dextran sulphate sodium salt in BALB/c mice. Beneficial Microbes, 5(3), 315–322. 10.3920/Bm2013.0041 [DOI] [PubMed] [Google Scholar]
- Parada Venegas, D. , De la Fuente, M. K. , Landskron, G. , Gonzalez, M. J. , Quera, R. , Dijkstra, G. , & Hermoso, M. A. (2019). Short chain fatty acids (SCFAs)‐mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases. Frontiers in Immunology, 10, 277. 10.3389/fimmu.2019.00277 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rosen, M. J. , Chaturvedi, R. , Washington, M. K. , Kuhnhein, L. A. , Moore, P. D. , Coggeshall, S. S. , & Wilson, K. T. (2013). STAT6 deficiency ameliorates severity of oxazolone colitis by decreasing expression of claudin‐2 and Th2‐inducing cytokines. Journal of Immunology, 190(4), 1849–1858. 10.4049/jimmunol.1201373 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rosen, M. J. , Frey, M. R. , Washington, M. K. , Chaturvedi, R. , Kuhnhein, L. A. , Matta, P. , & Polk, D. B. (2011). STAT6 activation in ulcerative colitis: A new target for prevention of IL‐13‐induced colon epithelial cell dysfunction. Inflammatory Bowel Diseases, 17(11), 2224–2234. 10.1002/ibd.21628 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sakaguchi, T. , Gu, X. B. , Golden, H. M. , Suh, E. R. , Rhoads, D. B. , & Reinecker, H. C. (2002). Cloning of the human claudin‐2 5 '‐flanking region revealed a TATA‐less promoter with conserved binding sites in mouse and human for caudal‐related homeodomain proteins and hepatocyte nuclear factor‐1 alpha. Journal of Biological Chemistry, 277(24), 21361–21370. 10.1074/jbc.M110261200 [DOI] [PubMed] [Google Scholar]
- Sang, L. X. , Chang, B. , Dai, C. , Gao, N. , Liu, W. X. , & Jiang, M. (2014). Heat‐killed VSL#3 ameliorates dextran sulfate sodium (DSS)‐induced acute experimental colitis in rats. International Journal of Molecular Sciences, 15(1), 15–28. 10.3390/ijms15010015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun, E. N. , Zhao, L. , Ren, F. Z. , Liu, S. L. , Zhang, M. , & Guo, H. Y. (2015). Complete genome sequence of Bifidobacterium animalis subsp lactis A6, a probiotic strain with high acid resistance ability. Journal of Biotechnology, 200, 8–9. 10.1016/j.jbiotec.2015.02.016 [DOI] [PubMed] [Google Scholar]
- Takeda, K. , Kamanaka, M. , Tanaka, T. , Kishimoto, T. , & Akira, S. (1996). Impaired IL‐13‐mediated functions of macrophages in STAT6‐deficient mice. Journal of Immunology, 157(8), 3220–3222. 10.1016/0022-1759(96)00126-3 [DOI] [PubMed] [Google Scholar]
- Tang, Y. H. , Chen, Y. Y. , Wang, X. , Song, G. , Li, Y. G. , & Shi, L. J. (2015). Combinatorial intervention with mesenchymal stem cells and granulocyte colony‐stimulating factor in a rat model of ulcerative colitis. Digestive Diseases and Sciences, 60(7), 1948–1957. 10.1007/s10620-015-3655-3 [DOI] [PubMed] [Google Scholar]
- Toomer, O. T. , Ferguson, M. , Pereira, M. , Do, A. , Bigley, E. , Gaines, D. , & Williams, K. (2014). Maternal and postnatal dietary probiotic supplementation enhances splenic regulatory T helper cell population and reduces ovalbumin allergen‐induced hypersensitivity responses in mice. Immunobiology, 219(5), 367–376. 10.1016/j.imbio.2014.01.003 [DOI] [PubMed] [Google Scholar]
- Tsang, S. W. , Ip, S. P. , Wu, J. C. Y. , Ng, S. C. , Yung, K. K. L. , & Bian, Z. X. (2015). A Chinese medicinal formulation ameliorates dextran sulfate sodium‐induced experimental colitis by suppressing the activity of nuclear factor‐kappaB signaling. Journal of Ethnopharmacology, 162, 20–30. 10.1016/j.jep.2014.12.035 [DOI] [PubMed] [Google Scholar]
- Vegas‐Sanchez, M. C. , Rollan‐Landeras, E. , Garcia‐Rodriguez, J. J. , & Bolas‐Fernandez, F. (2015). Induction of ulcerative colitis in mice influences the course of infection with the nematode Trichuris muris . Journal of Helminthology, 89(5), 593–600. 10.1017/S0022149x14000558 [DOI] [PubMed] [Google Scholar]
- Veprik, A. , Laufer, D. , Weiss, S. , Rubins, N. , & Walker, M. D. (2016). GPR41 modulates insulin secretion and gene expression in pancreatic beta‐cells and modifies metabolic homeostasis in fed and fasting states. The FASEB Journal, 30(11), 3860–3869. 10.1096/fj.201500030R [DOI] [PubMed] [Google Scholar]
- Weber, C. R. , Nalle, S. C. , Tretiakova, M. , Rubin, D. T. , & Turner, J. R. (2008). Claudin‐1 and claudin‐2 expression is elevated in inflammatory bowel disease and may contribute to early neoplastic transformation. Laboratory Investigation, 88(10), 1110–1120. 10.1038/labinvest.2008.78 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wildt, S. , Nordgaard, I. , Hansen, U. , Brockmann, E. , & Rumessen, J. J. (2011). A randomised double‐blind placebo‐controlled trial with lactobacillus acidophilus La‐5 and Bifidobacterium animalis subsp lactis BB‐12 for maintenance of remission in ulcerative colitis. Journal of Crohns & Colitis, 5(2), 115–121. 10.1016/j.crohns.2010.11.004 [DOI] [PubMed] [Google Scholar]
- Xu, J. , Verbrugghe, A. , Lourenco, M. , Cools, A. , Liu, D. J. X. , Van de Wiele, T. , & Hesta, M. (2017). The response of canine faecal microbiota to increased dietary protein is influenced by body condition. BMC Veterinary Research, 13, 374. 10.1186/s12917-017-1276-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang, D. , Lyu, W. , Hu, Z. , Gao, J. , Zheng, Z. , Wang, W. , & Ren, D. (2021). Probiotic effects of lactobacillus fermentum ZJUIDS06 and lactobacillus plantarum ZY08 on hypercholesteremic golden hamsters. Frontiers in Nutrition, 8, 705763. 10.3389/fnut.2021.705763 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang, G. , Wang, H. , Kang, Y. F. , & Zhu, M. J. (2014). Grape seed extract improves epithelial structure and suppresses inflammation in ileum of IL‐10‐deficient mice. Food & Function, 5(10), 2558–2563. 10.1039/c4fo00451e [DOI] [PubMed] [Google Scholar]
- Zeissig, S. , Burgel, N. , Gunzel, D. , Richter, J. , Mankertz, J. , Wahnschaffe, U. , & Schulzke, J. D. (2007). Changes in expression and distribution of claudin 2, 5 and 8 lead to discontinuous tight junctions and barrier dysfunction in active Crohn's disease. Gut, 56(1), 61–72. 10.1136/gut.2006.094375 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhgun, E. S. , Kislun, Y. V. , Kalachniuk, T. N. , Veselovsky, V. A. , Urban, A. S. , Tikhonova, P. O. , & Ilina, E. N. (2020). Evaluation of metabolites levels in feces of patients with inflammatory bowel diseases. Biomeditsinskaya Khimiya, 66(3), 233–240. 10.18097/PBMC20206603233 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author.
