Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2023 Feb 11;13:2482. doi: 10.1038/s41598-023-28731-9

RETRACTED ARTICLE: Mechanism of arterial injury exacerbated by hyperhomocysteinemia in spontaneously hypertensive rats

Lihua Zhang 1,#, Rui Xu 2,, Xiaoshan Ma 1,#, Xia Zhang 3,#, Jun Gong 4, Zhongliang Li 4
PMCID: PMC9922276  PMID: 36774389

Abstract

Hypertension associated with hyperhomocysteinemia (HHcy) accounts for 75% of hypertension in China. HHcy plays a synergistic role with hypertension in vascular injury and significantly increases the incidence of cardiovascular and cerebrovascular diseases. The present study aimed to explore the molecular mechanism of HHcy-induced arterial injury in hypertension. Spontaneously hypertensive rats (SHR) were injected intraperitoneally with DL-homocysteine (Hcy) to construct the model of hypertension associated with HHcy (HHcy + SHR). Biological network was employed to identify the material basis of arterial injury in hypertension associated with HHcy. The prediction molecules in oxidative stress and inflammation pathways were experimentally verified by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot (WB) analysis. The HHcy + SHR group significantly increased oxidative stress pathway molecules: nicotinamide adenine dinucleotide phosphate oxidase (Nox); inflammatory pathway molecules: vascular adhesion protein-1 (VAP-1), interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-a); as well as inflammatory pathway regulatory factors: nuclear factor-κ-gene binding (NF-κB) p65 and protein kinase B (Akt1). Among them, IL-6 was also significantly increased in the HHcy group. Both oxidative stress and inflammation contributed to the arterial injury of hypertension associated with HHcy, and inflammation mechanism might play a leading role in HHcy aggravating arterial injury, at least partially through the Akt1/NF-κB p65/IL-6 signaling pathway.

Subject terms: Diseases, Medical research, Molecular medicine

Introduction

Hypertension associated with hyperhomocysteinemia (HHcy) accounts for 75% of hypertension cases in China1. HHcy is defined as an accumulated homocysteine (Hcy) level above 10 μmol/L in human blood2. Additionally, HHcy, known as the “new cholesterol of the twenty-first century”, is an independent risk factor for cardiovascular and cerebrovascular diseases3,4. Studies found that HHcy can significantly increase cardiovascular and cerebrovascular events in hypertension5. Another study found that the levels of oxidative stress and inflammation are increased in hypertension associated with HHcy6. However, the molecular mechanism of HHcy synergistically aggravating the arterial damage in hypertension is rarely reported.

To explore the molecular mechanism of HHcy aggravating hypertensive arterial injury, biological network was utilized to screen out potential candidate targets between HHcy, hypertension and cardiovascular diseases (CVD) in the study. Afterwards, the candidate targets were investigated using an over-representation enrichment analysis method with Gene Ontology (GO). GO analysis is a commonly used approach for annotating genes with functions, including molecular function and biological pathways7,8. Finally, nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Nox), nuclear factor-κ-gene binding (NF-κB) and protein kinase B (Akt1) were selected as the research objects.

Nox is a type of oxidative stress enzyme, including Nox1, Nox2, Nox3, Nox4, Nox5, DUox1 and DUox29. Vascular tissue highly expresses Nox1, Nox2, Nox4 and Nox5, of which Nox4 is more expressed in endothelial cells (EC)10. Nox is an important molecule of the integrated stress response in the body and can produce reactive oxygen species (ROS) that leads to malondialdehyde (MDA) and inhibits superoxide dismutase (SOD). Previous study demonstrated that Nox is involved in the target organ damage of hypertension and HHcy-induced oxidative stress6. However, it is unclear whether oxidative stress is the leading cause for arterial pathological changes of hypertension associated with HHcy, and whether HHcy aggravates the arterial damage of hypertension through Nox2 or Nox4 signaling pathways.

NF-κB is a family of transcription factors11, including NF-κB1, NF-κB2, Rela/P65, Relb, Relc, etc. Among them, Rela/P65, Relb and Relc contain c-terminal trans-activation domain (TD) and can be activated by the upstream molecule Akt1, a serine / threonine protein kinase (protein kinase B), which activates or inhibits downstream substrates by phosphorylation. On the contrary, NF-κB1 and NF-κB2 are absent from TD and exist as inhibitory molecules. The study found that NF-κB molecules are closely related to the inflammation response12, and the activation of NF-κB can induce inflammatory cytokines, such as tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6)13. However, it is unclear whether the inflammation reaction is the leading cause of the arterial injury in hypertension associated with HHcy, and whether HHcy aggravates the arterial damage of hypertension through Akt1/NF-κB signaling pathways.

It is known that TNF-α and IL-6 are pro-inflammatory cytokines, and vascular adhesion protein-1 (VAP-1) and macrophage chemoattractant protein-1 (MCP-1) are pro-inflammatory chemokines, which can recruit lymphocytes for inflammatory response14 and are positively related to the severity of inflammatory diseases15. Data showed that VAP-1 is abundantly expressed in cardiovascular cells. And under normal conditions, VAP-1 is expressed within cytosolic vesicles of endothelial cells. However, under inflammatory conditions, VAP-1 migrates to the luminal surface of endothelial cells within the blood vessels, where it mediates binding and transmigration of immune cells into vascular tissues to co-regulate inflammatory micro-environment16. It can be seen that the expression of VAP-1 in arterial tissues can be used to reflect the local inflammatory state, so VAP-1 was selected as one of the indicators for us to objectively assess whether HHcy aggravated the inflammation in arterial vessels.

In this study, we followed the method of Çelik N et al.17 to construct the model of hypertension associated with HHcy. The present study aimed to investigate the impact of oxidative stress and inflammation on the arterial damage of hypertension associated with HHcy, and to explore the possible molecular mechanism of HHcy aggravating arterial injury.

Material and methods

Animals and experimental groups

Male healthy specific pathogen free (SPF) Wistar-Kyoto rats (WKY) and male spontaneously hypertensive rats (SHR) (250–270 g body weight, 12 weeks) were provided by Beijing Vital River Laboratory Animal Center (Beijing, China). All rats were maintained in a constant temperature (22 ± 2 °C), humidity and 12 h light/dark cycle and had free access to standard laboratory food and water. The animal procedures were approved by Institutional Animal Care and Use Committee, and the current study was implemented in full accordance with the institutional animal care and use protocols of Laboratory Animals of Shandong University (ethical code S285).

Sixteen WKYs were randomized into the WKY group and the HHcy group, and sixteen SHRs were randomized into the SHR group and the HHcy + SHR group (8 per group). We followed the method of Çelik N et al.17 to construct rat models: (1) the WKY group and the SHR group were given physiological saline (PS, 5 ml/kg, twice a day) by intraperitoneal injection for 12 weeks, and (2) the HHcy group and the HHcy + SHR group were given 2% DL-Hcy (5 ml/kg, twice a day at 8 h intervals, H4628, Sigma-Aldrich, St. Louis, USA) by intraperitoneal injection for 12 weeks. Methods of inducing HHcy in rats as previously described by Gao N18. DL-Hcy was dissolved in PS for 2% concentration and brought to pH 7.4 by the addition of sodium hydroxide.

Model evaluation

The HHcy model was evaluated by measuring plasma Hcy concentration of rat tail blood at week 4, 8 and 12 of the experiment, respectively. When the mean Hcy level was more than 10 μmol/L, it was defined as a successful HHcy model. Similarly, blood pressure (BP) was evaluated by measuring systolic blood pressure (SBP) and diastolic blood pressure (DBP) of rat tail artery at week 4, 8 and 12 of the experiment, respectively. When BP was more than 160/110 mmHg combined with the HHcy standard2, it was defined as a successful model of hypertension associated with HHcy. The detailed procedures of determination were shown in the supplementary material, and all procedures were performed in accordance with the specifications.

Noninvasive BP measurement

Rat tail artery BP was monitored with noninvasive BP measurement system (Beijing Ruolong Biotechnology Company, BP-2010A). To ensure the precision of the measurement, the temperature was controlled at 37 °C. Furthermore, BP was measured after the rat was quiet and its pulse was stable. At each measurement, the BP of each rat was repeatedly measured 3 times with an interval of more than 2 min, and the mean value was taken as the final BP.

Detection methods of plasma Hcy, serum MDA and SOD

Rat blood samples were sent to the laboratory of Qianfoshan Hospital for the measurement of plasma Hcy, serum MDA and SOD. The concentration of plasma Hcy was measured by using a Cobas8000 automatic biochemistry analyzer (Roche, Switzerland). The activity of serum SOD and the level of serum MDA were determined by using the commercial kits (SOD kit, A001-1-2, hydroxylamine method; MDA kit, A003-1-2, TBA method. Jiancheng Institute of Biological Technology, Nanjing, Jiangsu, China) according to the manufacturer’s instruction.

Specimen preparation

All rats (after 24 weeks old) were fasted overnight on the 12th weekend of the experiment. Afterwards, each rat was anesthetized with sodium pentobarbital (50 mg/kg, intraperitoneal) and euthanized by rapid bloodletting. Rat left ventricular arterial blood was extracted for the measurement of Hcy, MDA and SOD, then rat thoracic aorta was harvested for experiment. A part of the thoracic aorta was prepared by standard method for histopathological and immunohistochemical examinations. The remaining arterial tissue was immediately frozen in liquid nitrogen and then stored at − 80 °C for measuring protein and mRNA expression levels by western blot (WB) analysis and quantitative real-time polymerase chain reaction (qRT-PCR). Attached experimental flow chart (Fig. 1).

Figure 1.

Figure 1

Flow chart of experiment. WKY Wistar-Kyoto, HHcy hyperhomocysteinemia, SHR spontaneously hypertensive rat, Hcy homocysteine, MDA malondialdehyde, SOD superoxide dismutase, BP blood pressure, PS physiological saline, HE hematoxylin and eosin, VAP-1 vascular adhesion protein-1, TNF-α tumor necrosis factor-alpha, IL-6 interleukin-6, NF-κB nuclear factor-κ-gene binding, Nox nicotinamide adenine dinucleotide phosphate oxidase, Akt1 protein kinase B.

Histopathological and immunohistochemical evaluation

Five-micron sections of formalin-fixed and paraffin-embedded thoracic aorta were deparaffinized and then stained with hematoxylin and eosin (HE) staining and Masson’s trichrome staining to assess vascular pathology, arterial wall thickness and collagen deposition. Each sample slice was observed under the microscope (Olympus, Tokyo, Japan) at a magnification of 400× . The relative count of vascular smooth muscle cell (VSMC) was measured by Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, Maryland, USA), independent of the orientation, form or size of cell nucleus. The collagen deposition in the vascular wall was analyzed by using Image‑Pro Plus 6.0 software, and the ratio of collagen (blue) to the fixed area of the thoracic aorta was calculated as the result of semi-quantitative analysis of collagen deposition.

Immunohistochemical analysis for VAP-1 was performed according to the manufacturer’s instruction. Antigen retrieval was performed on artery sections and incubated with antibodies against VAP-1 (1:100, Proteintech, ab181168), then the arterial sections were incubated with a horseradish peroxidase (HRP)-linked secondary antibody (1:100, Servicebio, GB21301). The protein expression levels of VAP-1 were assessed on a Nikon Eclipse Ti-E inverted fluorescent microscope (Nikon Instruments, Tokyo Japan) at a magnification of 400× , and the brown areas were considered positive. Use Image-Pro Plus 6.0 software (Media Cybernetics, Inc, Rockville, Maryland, USA) to select the same brown as the uniform positive standard, and analyze each photo to obtain the integrated optical density value (IOD). IOD divided by pixel area of the tissue (AREA) was defined as the average optical density value (AO value)19,20, AO = IOD/AREA. And the greater the AO value, the higher the positive expression level of VAP-1.

Biological network analysis of target genes

To characterize the interactions between HHcy, hypertension and CVD, a visualized target gene network was constructed by the method of De-Hui Li et al.21. Firstly, diseases-related genes were obtained in Genecards database (https://www.genecards.org/) with “HHcy”, “Hypertension” and “cardiovascular diseases” as the keywords, respectively. Secondly, the intersection genes were screened out as the candidate targets of hypertension associated with HHcy on cardiovascular damage. Thirdly, the candidate targets were imported to STRING database (http://string-db.org, version 11.0) for interaction analysis and main pathway prediction. Finally, GO enrichment analysis of the candidate targets were carried out with R software. The purpose of the gene network analysis was to predict the material basis and molecular mechanism of arterial injury in hypertension associated with HHcy.

qRT-PCR analysis

Total RNA was extracted from the homogenate of fresh-frozen thoracic aorta by using TRIzol reagents (Invitrogen, 15,596,026) and was quantified spectrophotometrically (Spectrophotometer, Merinton, SMA4000). Then two micrograms of RNA per sample were reversely transcribed into cDNA by using RT reagent kit with gDNA Eraser (Takara, RR047A). Afterwards, the primer sequences (Table 1) were used to determine the expression of target genes by using TB Green Premix Ex TaqII (Takara, RR820A) in a real-time PCR machine (ABI ViiA 7, Applied Biosystems, Foster City, CA). The program of qRT-PCR was run with the reaction cycling of initial denaturing (95 °C, 30 s), followed by 40 cycles of denaturing (95 °C, 5 s), and then extension (60 °C, 30 s). Additionally, the melting curve was run to confirm specificity of qRT-PCR products. Finally, gene expression levels were normalized to GAPDH expression levels, and the relative expression quantity of mRNA was calculated according to the cycle threshold (2−△△Ct) method.

Table 1.

Primer sequences for quantitative real-time polymerase chain reaction.

Name Sequence-F Sequence-R
TNF-α GGCGTGTTCATCCGTTCTC CTTCAGCGTCTCGTGTGTTTCT
IL-6 ATTGTATGAACAGCGATGATGCAC CCAGGTAGAAACGGAACTCCAGA
Nox2 CCTGGAGACCCAGATGCAAGA CGTGGTGCACAGCAAAGTGA
Nox4 ACTGGTGAAGATTTGCCTGGAAG CACAGTATAGGCACAAAGGTCCAGA
NF-κB p65/Rela ATCCCTGCTTCCCCTTTCTC CTGTCTTATGGCTGAGGTCTGGT
NF-κB 2 CTGATGGCACAGGACGAGAA TGGGCTATCTGCTCAATGACAC

Western blot analysis

Total protein was extracted from the homogenate of fresh-frozen thoracic aorta by using Protein Extraction Kit (invent, SA-03-BV), and the protein concentration was determined by BCA protein assay kit (Beyotime, Shanghai, China). Protein sample (40 µg per lane) was separated by SDS-PAGE and transferred to PVDF membrane. Afterwards, the PVDF membrane was cut then blocked with 5% milk in Tris-buffered saline Tween, and was incubated with primary antibodies (Anti-Nox2, abcam, ab129068; Anti-Nox4, abcam, ab133303; Anti-TNF-α, Abcam, ab205587; Anti-IL-6, Abcam, ab259341; Anti-Akt1, Cell Signaling, C73H10; Anti-NF-κB P65, Cell Signaling, D14E12) overnight at 4 °C. Finally, the PVDF membrane was washed with Tris-buffered saline Tween solution and incubated with HRP-linked secondary antibody (Wuhan Sanying, SA00001-2) for 1 h. ChemiDoc™ Touch Gel imaging system (Bio-Rad, Hercules, CA, USA) was used to visualize immunoreactivity with a chemiluminescent HRP substrate (Vazyme, Nanjing, Jiangsu, China). The intensity of grayscale per band was quantified by Image-J Lab software, and the target protein was expressed relative to GAPDH.

Statistical analysis

Statistical analysis was conducted using one-way ANOVA followed by LSD test. Results were expressed as means ± SD. All statistical analyses were performed using SPSS software version 13.0. P < 0.05 was considered statistically significant.

Ethics approval and consent to participate

Animal care and experimental protocol for this study were approved by the Committee on the Use of Live Animals in Teaching and Research of Qianfoshan Hospital (ethical code S285).

Statement

The study is reported in accordance with ARRIVE guidelines. Additionally, I solemnly declare that the research data and experimental materials are true and reliable.

Results

HHcy model was constructed

Plasma Hcy level was significantly increased in the HHcy group and the HHcy + SHR group, compared with the WKY group and the SHR group (P < 0.05), respectively. Moreover, Hcy level in both the HHcy group and the HHcy + SHR group was more than 10 μmol/L, which was fully complied with the HHcy model standard2. Furthermore, Hcy level was significantly higher in the SHR group compared to the WKY group (P < 0.05), suggesting that SHR itself had Hcy metabolism disorder. (Fig. 2A).

Figure 2.

Figure 2

Plasma homocysteine (Hcy) level, serum malondialdehyde (MDA) level, serum superoxide dismutase (SOD) activity, and rat tail artery blood pressure in Wistar-Kyoto (WKY) group, hyperhomocysteinemia (HHcy) group, spontaneously hypertensive rat (SHR) group and HHcy + SHR group. (A) Plasma Hcy levels. (B) Blood pressure levels. (C) Serum MDA levels. (D) Serum SOD activity. Values represent means ± SD (*P < 0.05 vs. WKY group, $P < 0.05 vs. SHR group, δP < 0.05 vs. HHcy group, n = 8).

HHcy did not increase blood pressure

SHR BP was in line with the hypertension model standard (BP ≥ 160/110 mmHg). However, BP level was not significantly different between the WKY group and the HHcy group, or between the SHR group and the HHcy + SHR group, suggesting that HHcy did not contribute to the increase of BP. (Fig. 2B).

HHcy increased oxidative stress level of rat arterial blood

The level of serum MDA was significantly increased in the HHcy + SHR group, followed by the SHR group and the HHcy group compared to the WKY group (P < 0.05) (Fig. 2C). On the contrary, the activity of serum SOD was significantly lower in the HHcy + SHR group, followed by the SHR group and the HHcy group compared to the WKY group (P < 0.05) (Fig. 2D). Considering the role of MDA as a metabolite of oxidative stress and SOD as an antioxidant enzyme, increased MDA level and decreased SOD activity indicated the state of high oxidative stress, which was the highest in the HHcy + SHR group, then the SHR group and the HHcy group. Therefore, HHcy combined with hypertension significantly promoted the level of oxidative stress in rat arterial blood.

HHcy promoted VSMC proliferation and collagen deposition in rat aortic wall

We found that rat aortic wall in HHcy, SHR and SHR + HHcy groups was thickened and the smooth muscle cell nuclei were sparsely arranged, suggesting that VSMCs in the pathological group were hypertrophic (representative images in Fig. 3A1). Due to the hypertrophy of VSMCs and the deposition of collagen in the extracellular matrix, the number of VSMCs in the fixed area was relatively reduced, when the arterial tissue with the same magnification was filled with the whole microscopic field of vision. Therefore, our data showed that the VSMC number in the same microscopic field of vision decreased significantly in the HHcy + SHR group, followed by the SHR group and the HHcy group compared to the WKY group (P < 0.05) (Fig. 3A2). Hence, the proliferation and hypertrophy of VSMC was the most obvious in the HHcy + SHR group, followed by the SHR group and the HHcy group.

Figure 3.

Figure 3

Representative images of hematoxylin and eosin (HE) staining, Masson’s trichrome staining and immunohistochemical staining. Thin blue arrows indicate vacuolar degeneration of vascular smooth muscle cells (VSMCs) in rat aortic wall. Thick blue arrows indicate blue collagen deposition. Thick hollow arrows indicate brown particles of vascular adhesion protein-1 (VAP-1). (A1) Representative images of HE staining. (B1) Representative images of Masson’s trichrome staining. (C1) Representative images of VAP-1 immunohistochemical staining. (A2) Relative cell count of VSMCs. (B2) Semi-quantitative analysis of collagen deposition. (C2) The average optical density value (AO value) of VAP-1. (Original magnification of rat aortic wall, × 400, in Wistar-Kyoto (WKY) group, hyperhomocysteinemia (HHcy) group, spontaneously hypertensive rat (SHR) group and HHcy + SHR group. Values represent means ± SD, *P < 0.05 vs. WKY group, $P < 0.05 vs. SHR group, δP < 0.05 vs. HHcy group, n = 8).

Collagen deposition, as another feature of vascular remodeling, was semi‑quantified by Masson staining (representative images in Fig. 3B1). Our data showed that the collagen deposition in rat aortic wall markedly increased in the HHcy + SHR group, followed by the SHR group and the HHcy group compared to the WKY group. Also, the collagen deposition was significantly increased in the SHR + HHcy compared to the SHR group (P < 0.05) (Fig. 3B2).

HHcy synergistically promoted VAP-1 expression in rat aortic wall

Representative images of immunohistochemical staining of VAP-1 in rat aortic wall were shown in Fig. 3C1. In addition, the immunohistochemical analysis by Image-Pro Plus 6.0 software showed that the AO value of VAP-1 was significantly higher in SHR + HHcy group compared to both the SHR and WKY groups (P < 0.05) (Fig. 3C2), suggesting that HHcy combined with hypertension could significantly increase the inflammatory response in rat arterial wall.

Material basis and molecular mechanism of HHcy aggravating arterial damage by biological network analysis

First of all, we obtained 353 HHcy-related genes, 8435 hypertension-related genes and 18006 CVD-related genes from Genecards database. Then, these genes were merged to obtain 317 intersection genes, and a Venn diagram was drawn based on the results (Fig. 4A). Secondly, the 317 intersection genes were imported to STRING database for interaction analysis, and the top 30 core material molecules were shown in a bar graph (Fig. 4B). We found that inflammation indicators IL-6 and TNF-α, and signal pathway regulatory molecule Akt1 occupied the important position, indicating that inflammation reflection might play a leading role in the arterial damage of HHcy-related hypertension. Thirdly, the 317 intersection genes were performed on enrichment analysis by using the “clusterProfiler” R package, and the top 20 biological processes (Fig. 4C) and the top 20 signal pathways (Fig. 4D) were selected for bar chart analysis, respectively. Finally, based on gene interaction analysis and GO enrichment analysis, inflammatory pathway molecules (IL-6, TNF-α and NF-κB) and oxidative stress pathway molecules (Nox2 and Nox4) were selected for further experimental verification.

Figure 4.

Figure 4

Bionetwork analysis diagram. (A) VENN diagram of candidate targets. (B) Top 30 core material molecules in the intersection genes. (C) Top 20 biological processes from the intersection genes. (D) Top 20 signal pathways from the intersection genes.

HHcy promoted IL-6 expression in rat aortic tissue

The mRNA relative expression levels of inflammation molecules IL-6, TNF-α, NF-κB p65 and NF-κB2 of rat aortic tissue homogenate were significantly increased in the HHcy + SHR group compared to the WKY group (P < 0.05, Fig. 5A,B,C and D). Furthermore, the protein relative expression levels of IL-6, TNF-α, NF-κB p65 and Akt1 of rat aortic tissue homogenate were also significantly increased in the HHcy + SHR group compared to the WKY group (P < 0.05, Fig. 6A,B,C and D). What is more, the mRNA and protein relative expression levels of IL-6 in the HHcy group were significantly increased compared with the WKY group (P < 0.05, Figs. 5A and 6A), whereas the mRNA and protein relative expression levels of TNF-α and NF-κB p65 in the SHR group were significantly increased compared with the WKY group (P < 0.05, Figs. 5B and 6B).

Figure 5.

Figure 5

The mRNA relative expression levels of rat aortic tissue in Wistar-Kyoto (WKY) group, hyperhomocysteinemia (HHcy) group, spontaneously hypertensive rat (SHR) group and HHcy + SHR group. (A) interleukin-6 (IL-6). (B) tumor necrosis factor-alpha (TNF-α). (C) nuclear factor-κ-gene binding (NF-κB) p65. (D) NF-κB2. (E) nicotinamide adenine dinucleotide phosphate oxidase (Nox)2. (F) Nox4. Values represent means ± SD (*P < 0.05 vs. WKY group, $P < 0.05 vs. SHR group, δP < 0.05 vs. HHcy group, n = 8).

Figure 6.

Figure 6

Representative images of target proteins and western blot analysis after normalized to GAPDH (35KD) in rat aortic tissue in Wistar-Kyoto (WKY) group, hyperhomocysteinemia (HHcy) group, spontaneously hypertensive rat (SHR) group and HHcy + SHR group. (A) interleukin-6 (IL-6, 24KD). (B) tumor necrosis factor-alpha (TNF-α, 26KD). (C) nuclear factor-κ-gene binding p65 (NF-κB p65, 65KD). (D) protein kinase B (Akt1, 60KD). (E) nicotinamide adenine dinucleotide phosphate oxidase 2 (Nox2, 65KD). (F) Nox4 (67KD). Values represent means ± SD (*P < 0.05 vs. WKY group, $P < 0.05 vs. SHR group, δP < 0.05 vs. HHcy group, n = 8). The representative blots were cut prior to hybridization with antibodies during blotting.

HHcy synergistically promoted Nox4 expression in rat aortic tissue

The mRNA and protein relative expression levels of oxidative stress indicator Nox2 in rat aortic tissue only showed an increasing trend in the HHcy + SHR group (P > 0.05, Fig. 5E and Fig. 6E). However, the mRNA and protein relative expression levels of oxidative stress indicator Nox4 in rat aortic tissue were significantly increased in the HHcy + SHR group compared with the WKY group (P < 0.05, Figs. 5F and 6F).

Discussion

Hypertension associated with HHcy has attracted more and more attention due to its significant cardiovascular and cerebrovascular complications5. Research found22 that HHcy also remains significantly associated with cardiovascular events and death in fully adjusted models. Moreover, participants with Hcy > 9.47 mmol/L have a 2.3 fold risk for cardiovascular events, and participants with Hcy > 11.84 mmol/L have a 2.4 fold risk for death. To verify the pathological effect of HHcy on hypertension artery, we followed the method of Çelik N et al.17 to successfully construct the HHcy model with SHRs. We researched the pathological changes of rat aorta, and found that VSMC proliferation and collagen deposition were the most obvious in the HHcy + SHR group, followed by the SHR group and the HHcy group. Therefore, our research proved that HHcy synergistically aggravated the arterial damage in hypertension. In order to further explore the pathological mechanism of arterial damage in hypertension associated with HHcy, we used the gene network analysis to screen out the main material and molecular basis of the interactions between HHcy, hypertension and CVD, and to select the key pathway molecules related to oxidative stress and inflammation as our research direction.

We found that the oxidative stress level of rat peripheral blood (elevated MDA levels and decreased SOD activity) was the highest in the HHcy + SHR group, followed by the SHR group and the HHcy group. Similarly, the mRNA and protein relative expression of oxidative stress molecule Nox4 in rat aortic tissue was also significantly increased in the HHcy + SHR group compared with the WKY group. The results were also supported by previous studies, which showed that hypertension associated with HHcy is usually accompanied by an increase in oxidative stress levels23, and HHcy can promote Nox4 to increase ROS leading to tissue damage24. Therefore, it was concluded that high oxidative stress was involved in the arterial damage of hypertension associated with HHcy, and HHcy might aggravate the arterial injury in hypertension though the Nox4/ROS pathway.

Research showed that hypertension itself is a chronic inflammatory disease, and the severity of hypertension is associated with the degree of infiltration of immune cells25. After the immunohistochemical analysis on rat aortic vessels, we found that the expression of pro-inflammatory chemokine VAP-1 was higher in the HHcy + SHR group than the SHR group, suggesting the obvious infiltration of inflammatory cells in the arterial tissue of hypertension associated with HHcy. Furthermore, we compared the expression levels of inflammatory molecules in rat aortic tissues, and found that the inflammatory factor IL-6 and TNF-α, as well as the inflammatory pathway regulator NF-κB p65 and Akt1 were all the highest in the HHcy + SHR group. Moreover, IL-6 was also significantly increased in the HHcy group compared to the WKY group. Therefore, it was inferred that inflammation response was involved in the arterial damage of hypertension associated with HHcy, and HHcy synergistically aggravated the arterial injury in hypertension mainly though the Akt1 / NF-κB p65 / IL-6 pathway.

In order to explore the dominant mechanism of oxidative stress and/or inflammation on HHcy aggravating the arterial damage in hypertension, we specifically observed the mRNA and protein expression levels of oxidative stress molecules (Nox2 and Nox4) and inflammatory factors (TNF-a and IL-6) in the HHcy group and the SHR group. We found that the SHR group showed an increasing trend in both the oxidative stress molecule (Nox4) and the inflammatory molecule (TNF-a), while the HHcy group only showed a significant promoting effect on the inflammatory factor IL-6. In summary, the SHR increased oxidative stress and inflammation respond levels, which were consistent with the mechanisms of oxidative stress26,27 and inflammation28,29 of hypertension. However, HHcy had more advantages on inducing the inflammatory marker IL-6 than hypertension. Therefore, it was inferred that HHcy aggravated hypertensive arterial damage mainly by inflammation mechanism, and HHcy might have pro-inflammatory properties.

We reviewed the literature and analyzed that the pro-inflammatory property of HHcy might be related to the unique structure of Hcy itself. Research found that Hcy can be catalyzed to Hcy-thiolactone (Hcy-TL) by methionine (Met)-tRNA synthetases (MetRS), and Hcy-TL can also be hydrolyzed to Hcy by paraoxonase-1 (PON1) in turn30. Hence, HHcy (Hcy excessive accumulation in the body) can promote the conversion of Hcy to Hcy-TL. Hcy-TL contains reactive high-energy thioester bond3133, which can modify protein lysine (Lys) residues to form N-Hcy-protein, the so-called Hcy-N-protein modification3436. Furthermore, abnormal increased Hcy-N-protein alters and impairs protein’s biological structure and function, even triggers the synthesis of anti-Hcy-protein auto-antibodies37, then induces inflammatory response38,39. Overall, the above literature supported our conclusion that inflammation injury was the major factor for HHcy synergistically aggravating hypertensive arterial damage. This provides another perspective for preventing and treating the vascular damage of hypertension associated with HHcy.

The limitations of this study. (1) We initially found that the HHcy group had a significant advantage in inducing IL-6 expression. Thus, we inferred that HHcy might aggravate the arterial injury through the NF-κB/IL-6 pathway. However, this argument needs to be further verified in vitro experiments. (2) Base on the literature, we explained the inflammatory mechanism of HHcy. For example, the molecular structure of Hcy is similar to methionine40, and can replace methionine to participate in protein composition. Then, Hcy-protein produces an antigen–antibody response to trigger inflammatory response. However, this theory still needs to be verified on the arterial wall of hypertension associated with HHcy (Supplementary Information).

Conclusion

Inflammation mechanism might play a leading role in the arterial injury of hypertension associated with HHcy, and HHcy exacerbated hypertensive arterial injury partially through the Akt1/NF-κB p65/IL-6 signaling pathway.

Supplementary Information

Acknowledgements

We special thank Xiaoshan Ma for helping our team in histopathology and immunohistochemistry.

Author contributions

L.Z. and R.X. designed the experiment; L.Z., X.Z. and J.G. performed the experiments; Z.L. analyzed the data and prepared the figures; L.Z., X.M. and X.Z. contributed equally to this work; and R.X. had primary responsibility for the final content. All authors read and approved the final manuscript.

Funding

This study was supported by grants from National Science Foundation for Incubation Fund of Shandong Provincial Qianfoshan Hospital (Grant No. QYPY2020NSFC1011), Shandong Provincial Key Research and Development Program Foundation (Grant No. 2018GSF118009), Technology Program Foundation of Jinan (Grant No. 201805060), Jinan City Medical and Health Development Plan (Grant No. 2022-2-118), Jinan medical and health development, Grant No. 2018-2-31, and Shandong province medical and health science and technology development plan (Grant No. 2018WS488).

Data availability

Source data for figure(s) [number(s)] are provided with the paper. And the data that support the findings of this study are available on request from the corresponding author.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This article has been retracted. Please see the retraction notice for more detail: https://doi.org/10.1038/s41598-024-70879-5"

These authors contributed equally: Lihua Zhang, Xiaoshan Ma and Xia Zhang.

Change history

8/27/2024

This article has been retracted. Please see the Retraction Notice for more detail: 10.1038/s41598-024-70879-5

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-023-28731-9.

References

  • 1.Jian-Ping, L. I. et al. Efficacy and safety of Enalapril-Folate acid tablets in lowering blood pressure and plasma homocysteine. J. Peking Univ.39(6), 614–618 (2007). [PubMed] [Google Scholar]
  • 2.Hu, D. Y. & Xu, X. P. Prevention of stroke relies on valid control “H” type hypertension. Chin. J. Intern. Med.47(12), 976–977 (2009). [PubMed] [Google Scholar]
  • 3.Pushpakumar, S., Kundu, S. & Sen, U. Endothelial dysfunction: The link between homocysteine and hydrogen sulfide. Curr. Med. Chem.21(32), 3662–3672 (2014). 10.2174/0929867321666140706142335 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ren, Z. et al. Hypertension-mediated organ damage correlates with serum homocysteine level in community-dwelling elderly Chinese: The North Shanghai study. Front. Cardiovasc. Med.8, 662741 (2021). 10.3389/fcvm.2021.662741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chen, Z. et al. H-type hypertension is an important risk factor of carotid atherosclerotic plaques. Clin. Exp. Hypertens.38(5), 424–428 (2016). 10.3109/10641963.2015.1116547 [DOI] [PubMed] [Google Scholar]
  • 6.Zhang, L., Li, Z., Xing, C., Gao, N. & Xu, R. Folate reverses NF-κB p65/Rela/IL-6 level induced by hyperhomocysteinemia in spontaneously hypertensive rats. Front. Pharmacol.12, 651582 (2021). 10.3389/fphar.2021.651582 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.The Gene Ontology Consortium. Expansion of the gene ontology knowledgebase and resources. Nucleic Acids Res.45(D1), D331–D338 (2017). 10.1093/nar/gkw1108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen, L. et al. Prediction and analysis of essential genes using the enrichments of gene ontology and KEGG pathways. PLoS One12(9), e0184129 (2017). 10.1371/journal.pone.0184129 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chuong Nguyen, M. V. et al. Les NADPH oxydases Nox. Méd. Sci.31(1), 43–52 (2015). [DOI] [PubMed] [Google Scholar]
  • 10.Bedard, K. & Krause, K. H. The Nox family of ROS-generating NADPH oxidases: Physiology and pathophysiology. Physiol. Rev.87(1), 245–313 (2007). 10.1152/physrev.00044.2005 [DOI] [PubMed] [Google Scholar]
  • 11.Oeckinghaus, A. & Ghosh, S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb. Perspect. Biol.1(4), a000034 (2009). 10.1101/cshperspect.a000034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.DiDonato, J. A., Mercurio, F. & Karin, M. NF-κB and the link between inflammation and cancer. Immunol. Rev.246(1), 379–400 (2012). 10.1111/j.1600-065X.2012.01099.x [DOI] [PubMed] [Google Scholar]
  • 13.Barnabei, L., Laplantine, E., Mbongo, W., Rieux-Laucat, F. & Weil, R. NF-κB: At the borders of autoimmunity and inflammation. Front. Immunol.12, 716469 (2021). 10.3389/fimmu.2021.716469 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Polesso, F. et al. Constitutive expression of NF-κB inducing kinase in regulatory T cells impairs suppressive function and promotes instability and pro-inflammatory cytokine production. Sci. Rep.7(1), 14779 (2017). 10.1038/s41598-017-14965-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Proto, J. D. et al. NF-κB inhibition reveals a novel role for HGF during skeletal muscle repair. Cell Death Dis.6(4), e1730 (2015). 10.1038/cddis.2015.66 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Salmi, M. & Jalkanen, S. Cell-surface enzymes in control of leukocyte trafficking. Nat. Rev. Immunol.5(10), 760–771 (2005). 10.1038/nri1705 [DOI] [PubMed] [Google Scholar]
  • 17.Çelik, N., Vurmaz, A. & Kahraman, A. Protective effect of quercetin on homocysteine-induced oxidative stress. Nutrition33, 291–296 (2017). 10.1016/j.nut.2016.07.014 [DOI] [PubMed] [Google Scholar]
  • 18.Gao, N. et al. Hyperhomocysteinemia-induced oxidative stress aggravates renal damage in hypertensive rats. Am. J. Hypertens.33(12), 1127–1135 (2020). 10.1093/ajh/hpaa086 [DOI] [PubMed] [Google Scholar]
  • 19.Kumasaka, T. et al. Role of the intercellular adhesion molecule-1(ICAM-1) in endotoxin-induced pneumonia evaluated using ICAM-1 antisense oligonucleotides, anti-ICAM-1 monoclonal antibodies, and ICAM-1 mutant mice. J. Clin. Investig.97(10), 2362–2369 (1996). 10.1172/JCI118679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Durand, P., Lussier-Cacan, S. & Blache, D. Acute methionine load-induced hyperhomocysteinemia enhances platelet aggregation, thromboxane biosynthesis, and macrophage-derived tissue factor activity in rats. FASEB J.11(13), 1157–1168 (1997). 10.1096/fasebj.11.13.9367351 [DOI] [PubMed] [Google Scholar]
  • 21.Li, D. H., Su, Y. F., Sun, C. X., Fan, H. F. & Gao, W. J. A network pharmacology-based identification study on the mechanism of Xiao-Xu-Ming decoction for cerebral ischemic stroke. Evid. Based Complement. Alternat. Med.2020, 2507074 (2020). 10.1155/2020/2507074 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sun, Y. et al. Use of serum homocysteine to predict stroke, coronary heart disease and death in ethnic Chinese. 12-year prospective cohort study. Circ. J.73(8), 1423–1430 (2009). 10.1253/circj.CJ-08-1077 [DOI] [PubMed] [Google Scholar]
  • 23.Guo, G. Comparison of oxidative stress biomarkers in hypertensive patients with or without hyperhomocysteinemia. Clin. Exp. Hypertens.3(40), 262–266 (2018). 10.1080/10641963.2017.1368535 [DOI] [PubMed] [Google Scholar]
  • 24.Hu, H. et al. Catalpol inhibits homocysteine-induced oxidation and inflammation via inhibiting Nox4/NF-κB and GRP78/PERK pathways in human aorta endothelial cells. Inflammation42(1), 64–80 (2019). 10.1007/s10753-018-0873-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Viel, E. C. et al. Immune regulation and vascular inflammation in genetic hypertension. Am. J. Physiol.298(2), 938–944 (2010). [DOI] [PubMed] [Google Scholar]
  • 26.Lob, H. E. et al. Induction of hypertension and peripheral inflammation by reduction of extracellular superoxide dismutase in the central nervous system. Hypertension55(2), 277–283 (2010). 10.1161/HYPERTENSIONAHA.109.142646 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lob, H. E., Schultz, D., Marvar, P. J., Davisson, R. L. & Harrison, D. G. Role of the NADPH oxidases in the subfornical organ in angiotensin II-induced hypertension. Hypertension61(2), 382–387 (2013). 10.1161/HYPERTENSIONAHA.111.00546 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Solak, Y. et al. Hypertension as an autoimmune and inflammatory disease. Hypertens. Res.39(8), 567–573 (2016). 10.1038/hr.2016.35 [DOI] [PubMed] [Google Scholar]
  • 29.Suematsu, M. et al. the inflammatory aspect of the microcirculation in hypertension: Oxidative stress, leukocytes/endothelial interaction Apoptosis. Microcirculation9(4), 259–276 (2002). 10.1038/sj.mn.7800141 [DOI] [PubMed] [Google Scholar]
  • 30.Jakubowski, H. Calcium-dependent human serum homocysteine thiolactone hydrolase. A protective mechanism against protein N-homocysteinylation. J. Biol. Chem.275(6), 3957–3962 (2000). 10.1074/jbc.275.6.3957 [DOI] [PubMed] [Google Scholar]
  • 31.Jakubowski, H. Aminoacyl thioester chemistry of class II aminoacyl-tRNA synthetases. Biochemistry36(37), 11077–11085 (1997). 10.1021/bi970589n [DOI] [PubMed] [Google Scholar]
  • 32.Jakubowski, H. Misacylation of tRNALys with noncognate amino acids by lysyl-tRNA synthetase. Biochemistry38(25), 8088–8093 (1999). 10.1021/bi990629i [DOI] [PubMed] [Google Scholar]
  • 33.Jakubowski, H. & Fersht, A. R. Alternative pathways for editing non-cognate amino acids by aminoacyl-tRNA synthetases. Nucleic Acids Res.9(13), 3105–3117 (1981). 10.1093/nar/9.13.3105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Jakubowski, H. Metabolism of homocysteine thiolactone in human cell cultures. Possible mechanism for pathological consequences of elevated homocysteine levels. J. Biol. Chem.272(3), 1935–1942 (1997). 10.1016/S0021-9258(19)67504-6 [DOI] [PubMed] [Google Scholar]
  • 35.Jakubowski, H. Molecular basis of homocysteine toxicity in humans. Cell. Mol. Life Sci. CMLS61(4), 470–487 (2004). 10.1007/s00018-003-3204-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Jakubowski, H. Protein homocysteinylation: Possible mechanism underlying pathological consequences of elevated homocysteine levels. Faseb J. Off. Publ. Fed. Am. Soc. Exp. Biol.13(15), 2277 (1999). [PubMed] [Google Scholar]
  • 37.Undas, A. et al. Autoantibodies against N-homocysteinylated proteins in humans: Implications for atherosclerosis. Stroke35(6), 1299–1304 (2004). 10.1161/01.STR.0000128412.59768.6e [DOI] [PubMed] [Google Scholar]
  • 38.Ferguson, E. et al. Generation and initial characterization of a novel polyclonal antibody directed against homocysteine thiolactone-modified low density lipoprotein. J. Lipid Res.39(4), 925–933 (1998). 10.1016/S0022-2275(20)32578-5 [DOI] [PubMed] [Google Scholar]
  • 39.Undas, A. et al. Antibodies to N-homocysteinylated albumin as a marker for earlyonset coronary artery disease in men. Thromb. Haemost.93(02), 346–350 (2005). 10.1160/TH04-08-0493 [DOI] [PubMed] [Google Scholar]
  • 40.Skovierová, H. et al. The molecular and cellular effect of homocysteine metabolism imbalance on human health. Int. J. Mol. Sci.17(10), 1733 (2016). 10.3390/ijms17101733 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Source data for figure(s) [number(s)] are provided with the paper. And the data that support the findings of this study are available on request from the corresponding author.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES