Serial recombineering cloning to build selectable and tagged genomic P[acman] BAC clones for selection transgenesis and functional gene analysis using Drosophila melanogaster

Koen JT Venken; Nick Matinyan; Yezabel Gonzalez; Herman A Dierick

doi:10.1002/cpz1.675

. Author manuscript; available in PMC: 2024 Feb 1.

Published in final edited form as: Curr Protoc. 2023 Feb;3(2):e675. doi: 10.1002/cpz1.675

Serial recombineering cloning to build selectable and tagged genomic P[acman] BAC clones for selection transgenesis and functional gene analysis using Drosophila melanogaster

Koen JT Venken ^1,^2,^3,^4,^&, Nick Matinyan ^1,^3,^#, Yezabel Gonzalez ¹, Herman A Dierick ^5,⁶

PMCID: PMC9923880 NIHMSID: NIHMS1864723 PMID: 36757632

Abstract

Transgenes with genomic DNA fragments that encompass genes of interest are the gold standard for complementing null alleles in rescue experiments in the fruit fly Drosophila melanogaster. Of particular interest are genomic DNA clones available as bacterial artificial chromosomes (BACs) or fosmids from publicly available genomic DNA libraries. Genes contained within BAC and fosmid clones can be easily modified by recombineering cloning to insert peptide or protein tags to localize, visualize, or manipulate gene products, and to create point mutations or deletions for structure-function analysis of the inserted genes. However, since transgenesis efficiency is inversely correlated with transgene size, obtaining transgenic animals for increasingly larger BAC and fosmid clones requires increasingly laborious screening efforts using the transgenesis marker commonly used for these transgenes, the dominant eye color marker white⁺. We recently described a drug-based selectable genetic platform for Drosophila melanogaster, which included four resistance markers that allow direct selection of transgenic animals, eliminating the need to identify transgenic progeny by laborious phenotypic screening. By integrating these resistance markers into BAC transgenes, we were able to isolate animals containing large transgenes by direct selection, avoiding laborious screening. Here we present procedures on how to upgrade BAC clones by serial recombineering cloning to build both selectable and tagged BAC transgenes, for selection transgenesis and functional gene analysis, respectively. We illustrate these procedures using a BAC clone encompassing the gene encoding the synaptic versicle protein Cysteine string protein. We demonstrate that the modified BAC clone, serially recombineered with a selectable marker for selection transgenesis and an N-terminal green fluorescent protein tag for gene expression analysis, is functional by showing the expression pattern obtained after successful selection transgenesis. The protocols cover: 1) cloning and preparation of the recombineering templates needed for serial recombineering cloning to incorporate selectable markers and protein tags; 2) preparing electrocompetent cells needed to perform serial recombineering cloning; and 3) the serial recombineering workflow to generate both selectable and tagged genomic BAC reporter transgenes for selection transgenesis and functional gene analysis in Drosophila melanogaster. The protocols we describe can be easily adapted to incorporate any of four selectable markers, protein tags or any other modification for structure-function analysis of the genes present within any of the BAC or fosmid clones. A protocol for generating transgenic animals using serially recombineered BAC clones is presented in an accompanying Current Protocols article (Current Protocols #1).

Basic Protocol 1:

Cloning and preparation of recombineering templates used for serial recombineering cloning.

Basic Protocol 2:

Making electrocompetent cells of the bacterial strains used to perform serial recombineering cloning or induction of plasmid copy number.

Basic Protocol 3:

Serial recombineering cloning to generate both selectable and tagged genomic P[acman] BAC reporter transgenes for selection transgenesis and gene expression analysis in Drosophila melanogaster.

Keywords: Serial recombineering cloning, Selection, Bacterial Artificial Chromosome, P[acman], Transgenesis, Drosophila melanogaster, gene expression analysis

INTRODUCTION

The gold standard to prove that a null allele is responsible for specific phenotypes in any model organism, including Drosophila melanogaster, is to complement, or “rescue”, the presumably phenotype-causing mutation using a transgene containing a genomic DNA fragment that covers the candidate causal gene of interest for the observed phenotype (Venken and Bellen, 2007, 2012, 2014; Venken et al., 2011, 2016, 2006, 2009, 2010). Such transgenic clones can be engineered (Venken et al., 2006; Venken and Bellen, 2007), or chosen from genome-wide libraries (Ejsmont et al., 2009; Venken et al., 2009), to contain sufficient endogenous genomic context to recapitulate most if not all developmental aspects of the gene of interest across space and time (Venken et al., 2006; Venken and Bellen, 2007; Venken et al., 2009; Ejsmont et al., 2009). Ideally, such transgenes revert most if not all mutant phenotypes caused by the underlying null genotype, and therefore provide proof the null genotype is responsible for most if not all observed phenotypes (Venken et al., 2006, 2009, 2010).

A useful resource for such genomic rescue experiments are genomic DNA clones available as bacterial artificial chromosomes (BACs). Three publicly available libraries exist: the CHORI-322 and the CHORI-321 P[acman] BAC libraries consisting of genomic DNA clones with insert sizes averaging 21 and 83 kilobases respectively (Venken et al., 2009), and the FlyFos fosmid library consisting of genomic DNA clones with insert sizes averaging 36 kilobases (Ejsmont et al., 2009). These libraries represent a 15-fold coverage of the fly genome and cover more than 95% of annotated genes in the reference genome (Venken et al., 2009; Ejsmont et al., 2009). Moreover, genes contained within P[acman] BACs and FlyFos fosmid clones can be easily modified by recombineering cloning (Thomason et al., 2014, 2007; Sharan et al., 2009). Commonly used modifications are the insertion of tags for protein manipulation, localization, and visualization (Venken et al., 2009, 2008; Ejsmont et al., 2009; Sarov et al., 2016; Avellaneda and Schnorrer, 2022; Kanca et al., 2017; Gohl et al., 2017; Venken and Bellen, 2014; Venken et al., 2016; Dunst and Tomancak, 2019), as well as the incorporation of point mutations or deletions for structure-function analyses (Pepple et al., 2008; Leonardi et al., 2011; Leonardi and Jafar-Nejad, 2014). However, the efficiency of transgenesis with P[acman] BAC and FlyFos fosmid clones decreases as their size increases making it more laborious to screen for the commonly used dominant eye color marker white⁺ (Venken et al., 2006, 2009, 2010; Ejsmont et al., 2009).

Recently, we developed a drug-based selection transgenesis strategy that eliminates screening for the white⁺ marker, by coupling a drug resistance marker to transgenes (Matinyan et al., 2021a, 2021b), including P[acman] BAC clones (Matinyan et al., 2021b). This strategy introduced four different drug resistance markers adapted for use in Drosophila melanogaster. Each marker confers robust and exclusive resistance to its corresponding drug, one of four commonly-used, universally toxic antibiotics (Matinyan et al., 2021b). The four selectable markers encompass the genes encoding Neomycin phosphotransferase II, Puromycin HCl N-acetyltransferase, Blasticidin S-resistance, and Hygromycin B phosphotransferase, and provide animal resistance against G418 sulfate, Puromycin HCl, Blasticidin S, and Hygromycin B, respectively (Matinyan et al., 2021b). Since selection-based transgenic strategies provide an easier and more cost-effective method for isolating low-frequency transgesis events when working with genomic P[acman] BAC clones, integrating these resistance markers into P[acman] BAC transgenes allowed us to isolate animals containing these transgenes by direct selection, avoiding laborious screening (Matinyan et al., 2021b). These results demonstrate that the incorporation of resistance markers into P[acman] BAC transgenes facilitates the isolation of these often difficult-to-obtain transgenic animals (Matinyan et al., 2021b).

In this work, we describe how to implement serial recombineering to build both selectable and tagged genomic P[acman] BAC reporter transgenes for selection transgenesis and functional gene analysis in Drosophila melanogaster. We illustrate these protocols using a P[acman] BAC clone that covers the gene that encodes the synaptic versicle protein Cysteine string protein, Csp (Figure 1). From the available clones present within the CHORI-321 (83-kilobase average insert) and CHORI-322 (21-kilobase average insert) P[acman] BAC libraries, we selected a suitable P[acman] BAC clone that covers the Csp gene surrounded by at least 5 kilobases of upstream and downstream regulatory sequence (CH322–06D09) (Figure 1A) (Venken et al., 2009). We modified this clone using recombineering cloning (Figure 1B) to add an N-terminal enhanced green fluorescent protein (EGFP) tag for gene expression analysis and a G418 sulfate-selectable marker for selection transgenesis.

Figure 1. — (A) **P[acman] BAC clones covering the genetic locus encoding the synaptic vesicle protein Cysteine string protein (Csp) as an example**. A 60-kb *Drosophila melanogaster* genome interval covering the gene that encodes the synaptic vesicle protein Cysteine string protein (Csp), shows clones from both the CHORI-322 (top, shown in **dark green**) and CHORI-321 (bottom, shown in **light green**) P[acman] BAC libraries with average insert sizes of 21 and 83 kilobases, respectively. Clone CH322–06D09 (shown in **dark blue**), containing *Csp*, was picked for serial recombineering cloning to build a selectable, tagged genomic P[acman] BAC reporter transgene for gene expression analysis of *Csp*. Genes contained within this 60-kb region, and transcript variants just for *Csp*, are indicated below the P[acman] BAC clones. This genome interval was obtained through the webpage for *Csp* in FlyBase, version FB2022_04 (https://flybase.org/reports/FBgn0004179) (Gramates et al., 2022), and linking to the Gbrowse genome map of *Csp*. After selecting a 60-kb genome interval, this interval was exported as an editable svg image and edited using Adobe Illustrator, Adobe Creative Cloud. (B) **P[acman] BAC modifications by recombineering cloning: tagging the synaptic vesicle protein Cysteine string protein (Csp) with a fluorescent protein for expression analysis**. Simplified schematic overview illustrating P[acman] BAC modifications by recombineering cloning of clone CH322–06D09 to generate an N-terminally EGFP-tagged version of the synaptic vesicle protein Csp for downstream expression analysis.

We provide step-by-step protocols on how to build both selectable and tagged genomic P[acman] BAC reporter transgenes for selection transgenesis and functional gene analysis in Drosophila melanogaster, using P[acman] BAC clone CH322–06D09 covering Csp as an example (Venken et al., 2009) (Figure 2). We begin by describing how to clone and prepare recombineering templates needed for serial recombineering cloning to incorporate selectable markers and protein tags during the workflow, focused on N-terminal tagging of Csp using the EGFP tag for gene expression analysis and the G418 sulfate-selectable marker for selection transgenesis (Basic Protocol 1). We then describe how to make electrocompetent cells for the EL350 bacterial strain that provides orthogonally inducible recombineering and Cre recombinase functions needed to perform the serial recombineering workflow, as well as the EPI300 bacterial strain that allows plasmid copy number toggling between very low (basal state) and high (after induction using a simple sugar solution) copy numbers (Basic Protocol 2). Finally, we explain the serial recombineering workflow itself to generate a G418 sulfate-selectable and N-terminal green fluorescent protein tagged genomic P[acman] BAC reporter transgene for gene expression analysis of Csp in Drosophila melanogaster (Basic Protocol 3). The protocols we present can be easily adapted to incorporate any of the four selectable markers, different protein tags or any other modification for structure-function analysis of the genes present within any P[acman] BAC (Venken et al., 2009) or FlyFos fosmid (Ejsmont et al., 2009) clone. By the end of this protocol, the user should be able to modify P[acman] BACs starting from original BACs to modified versions for sophisticated genetic applications. A protocol to generate transgenic animals using modified P[acman] BAC clones, as described here, is presented in an accompanying Current Protocols article (Current Protocols #1).

Figure 2. — The first step in this protocol describes how to decide on homology arms for recombineering followed by cloning those homology arms to make recombineering templates that are then prepared for recombineering (Basic Protocol 1). First, the user selects homology arms where recombineering needs to occur within the P[acman] BAC clone encompassing *Csp* to make both upgrades: one location surrounding the chloramphenicol marker (Chl^R) embedded in the P[acman] clone to make the clone selectable for downstream *Drosophila* transgenesis (see **Current Protocols 1#**), and a second location to generate a tagged version of the gene of interest for downstream expression analysis, N-terminally (as shown for Csp) or C-terminally (not shown). Next, the selected homology arms for recombineering are cloned to make the necessary recombineering templates: one pair of homology arms for recombineering is cloned together with a cassette for fluorescent protein tagging (see Figure 3A) to generate a plasmid encoding the “fluorescent protein tagging” recombineering template (see Figure 4), while the second pair of homology arms for recombineering is cloned together with a cassette for selection genetics (see Figure 3B) to generate a plasmid encoding the “selection genetics” recombineering template (see Figure 5). After verification by Sanger DNA sequencing, plasmids encoding both recombineering templates are prepared and linearized to release the templates from their respective plasmid backbones for downstream recombineering. The second step in this protocol describes how to prepare electrocompetent cells for the different bacterial strains needed during the course of this protocol, including the EL350 strain that provides orthogonally inducible recombineering and Cre recombinase functions needed during the different steps of the serial recombineering protocol, as well as the EPI300 strain that allows plasmid copy number induction to produce a high concentration of BAC clone plasmid (see below) (Basic Protocol 2 and Figure 6). The third and final step in this protocol describes the serial recombineering protocol (Basic Protocol 3, Figure 7 and Figure 8). A first round of modifications (done by recombineering) upgrades the P[acman] BAC clone with the *Csp* gene using the linearized “fluorescent protein tagging” recombineering template encoding the N-terminal EGFP tag linked to the ampicillin resistance marker (Amp^R) flanked by *LoxP* sites. A second round of modifications (done by recombineering as well) upgrades the clone using the linearized “selection genetics” recombineering template encoding the selection marker that provides resistance to kanamycin (Kan^R) in bacteria for bacterial clone selection and G418 sulfate (G418^R) in flies for downstream selectable transgenesis (see **Current Protocols 1#**). During the last round of modifications, Cre recombinase removes the floxed ampicillin marker leaving just the N-terminal EGFP tag plus peptide linker behind, resulting in the final selectable, tagged genomic P[acman] BAC reporter plasmid for *Csp*. The final plasmid is then isolated from the EL350 strain and transformed in electrocompetent EPI300 cells prepared as described above (Basic Protocol 2 and Figure 6) to induce plasmid copy number towards high copy to facilitate plasmid purification for downstream selectable transgenesis and gene expression analysis of the *Csp* gene, respectively (Figure 9).

BASIC PROTOCOL 1

Cloning and preparation of recombineering templates used for serial recombineering cloning.

Introductory paragraph

This protocol describes cloning and template preparation needed for serial recombineering cloning to build selectable, tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster. We will first explain where to obtain and how to prepare plasmids containing cassettes for fluorescent protein tagging and selection genetics in Drosophila melanogaster (Table 1). For this purpose, we generated four plasmids for fluorescent protein tagging as recombineering templates to modify the N- or C-terminus of a protein with a green (EGFP) or red (mCherry) fluorescent protein (Figure 3A) and four plasmids for selection genetics in Drosophila melanogaster, as recombineering templates to confer resistance to a different antibiotic (Figure 3B). The selection cassettes contain the Kan^R/G418^R, Puro^R, Blast^R, or Hygro^R resistance markers that encode Neomycin phosphotransferase II (nptII), Puromycin HCl N-acetyltransferase (pac), Blasticidin S deaminase (bsr), and Hygromycin B phosphotransferase (hph), respectively. They can be used to select with kanamycin in bacteria or G418 sulfate in flies, or with Puromycin HCl, Blasticidin S, or Hygromycin B in both bacteria and flies. Next, we will explain how to perform PCR amplification of the “fluorescent protein tagging” (Figure 4) and “selection genetics” (Figure 5) cassettes using primers that add sequences homologous to the target regions in the P[acman] BAC for the recombineering event. We will then describe cloning and verification of these recombineering templates in a plasmid with a conditional origin of replication that aids recombineering (see Basic Protocol 3) using GoldenBraid 2.0 (GB2.0) synthetic assembly cloning (Sarrion-Perdigones et al., 2013, 2019; Sarrion-Perdigones et al., 2020; Sarrion-Perdigones et al., 2022; Matinyan et al., 2021b). Finally, we will explain how to prepare the recombineering templates (Figure 4 and Figure 5), that will then be used for serial recombineering cloning to generate both selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis (see Basic Protocol 3). We will apply the principles described above to modify the P[acman] BAC clone CH322–06D09 covering the Cysteine string protein gene (Csp) with an N-terminal EGFP tag and a G418 sulfate-selectable marker. By the end of this protocol, the user should understand how to create recombineering templates that can be used to generate modifications in P[acman] BAC plasmids using serial recombineering cloning.

Table 1. Summary of vectors described in this work.

Plasmid name, brief description, vector backbone, vector backbone resistance, Addgene stock number, and bibliographic reference are indicated for all plasmids mentioned in this work.

Plasmid name	Description	Vector backbone¹	Vector backbone resistance	Addgene²	Reference
pEGFP-N-Terminal-Tagging	PCR template for the EGFP N-terminal tagging cassette	ColE1	Kanamycin^R, Ampicillin^R	165868	(Matinyan et al., 2021b)
pEGFP-C-Terminal-Tagging	PCR template for the EGFP C-terminal tagging cassette	ColE1	Kanamycin^R, Ampicillin^R	165869	(Matinyan et al., 2021b)
pmCherry-N-Terminal-Tagging	PCR template for the mCherry N-terminal tagging cassette	ColE1	Kanamycin^R, Ampicillin^R	165870	(Matinyan et al., 2021b)
pmCherry-C-Terminal-Tagging	PCR template for the mCherry C-terminal tagging cassette	ColE1	Kanamycin^R, Ampicillin^R	165871	(Matinyan et al., 2021b)
pHSP70B-CP6-nptII	PCR template for the G418^R resistance marker encoding the protein Neomycin phosphotransferase II (nptII) that can be selected for using Kanamycin (Bacteria) and G418 sulfate (Flies)	ColE1	Kanamycin^R	165876	(Matinyan et al., 2021b)
pHSP70B-CP6-pac	PCR template for the Puro^R resistance marker encoding the protein Puromycin HCl N-acetyltransferase (pac) that can be selected for using Puromycin HCl (Bacteria and flies)	ColE1	Kanamycin^R, Puromycin HCl^R	165877	(Matinyan et al., 2021b)
pHSP70B-CP6-bsr	PCR template for the Blast^R resistance marker encoding the protein Blasticidin S deaminase (bsr) that can be selected for using Blasticidin S (Bacteria and flies)	ColE1	Kanamycin^R	165878	(Matinyan et al., 2021b)
pHSP70B-CP6-hph	PCR template for the Hygro^R resistance marker encoding the protein Hygromycin B phosphotransferase (hph) that can be selected for using Hygromycin B (Bacteria and flies)	ColE1	Kanamycin^R	165879	(Matinyan et al., 2021b)
pR6Kg-A1 ^spm	Conditionally replicative plasmid backbone for GoldenBraid 2.0 cloning	R6Kγ	Spectinomycin^R	165866	(Matinyan et al., 2021b)
P[acman] BAC CH322–06D09	P[acman] BAC clone containing the genomic locus encompassing the gene Cysteine string protein (Csp)	BAC/OriV	Chloramphenicol^R	NA	(Venken et al., 2009)

Open in a new tab

ColE1, high-copy number plasmid backbone; R6Kγ, conditionally replicative plasmid backbone requiring the PIR1 or PIR2 Escherichia coli strain for plasmid maintenance; BAC/OriV, conditionally amplifiable copy number plasmid backbone requiring the EPI300 Escherichia coli strain for plasmid copy number control.

NA, not applicable.

Figure 3. — **(A) Plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging.** Overview of plasmids with “fluorescent protein tagging” cassettes to generate recombineering templates for modifying either the N- (**Left**) or C-terminus (**Right**) of a protein encoded by the gene of interest covered by a P[acman] BAC clone, using either the green fluorescent protein EGFP (**Top**) or the red fluorescent protein mCherry (**Bottom**) (see Figure 4). (B) **Plasmids containing cassettes to generate recombineering templates for selection genetics**. Overview of plasmids with one of four different “selection genetics” cassettes to generate recombineering templates for selection genetics in *Drosophila melanogaster*, each conferring resistance to a different antibiotic: the Kan^R/G418^R resistance marker encodes the protein Neomycin phosphotransferase II (nptII) that can be used for selection with kanamycin in bacteria or G418 sulfate in flies (**Top left**), the Puro^R resistance marker encodes the protein Puromycin HCl N-acetyltransferase (pac) for selection with Puromycin HCl in both bacteria and flies (**Top right**), the Blast^R resistance marker encodes the protein Blasticidin S deaminase (bsr) for selection with Blasticidin S in both bacteria and flies (**Bottom left**), and the Hygro^R resistance marker encodes the protein Hygromycin B phosphotransferase (hph) for selection with Hygromycin B resistance in both bacteria and flies (**Bottom right**) (see Figure 5). Each marker contains a fusion promoter with eukaryotic and prokaryotic activities, a gene encoding the selection/resistance marker, and the minimal terminator of the *thymidine kinase* gene of the herpes simplex virus. The fusion promoter consists of the eukaryotic promoter of the *Drosophila melanogaster Hsp70* gene for optimal transcription in flies, followed by the prokaryotic synthetic *Escherichia coli CP6* promoter for optimal transcription in bacteria. At the 3’ end of the *CP6* promoter are a prokaryotic Shine-Dalgarno sequence for optimal translational in bacteria, followed by a eukaryotic Kozak/Cavener sequence for optimal translational in flies. Hence, for bacterial cloning purposes, *CP6*-stimulated transcription and Shine-Dalgarno-stimulated translation of the resistance marker provides bacterial selection (see this **Current Protocols** and **Current Protocols #2**), while for fly genetics purposes, *Hsp70*-stimulated transcription and Kozak/Cavener-stimulated translation of the resistance marker provides larval and fly selection (see **Current Protocols 1#**).

Figure 4. — (A) **Selection of homology arms where recombineering for fluorescent protein tagging needs to occur in the P[acman] BAC plasmid**. Homology arms for recombineering templates encoding N- or C-terminal fluorescent protein tags are designed to integrate those tags between the start codon (“ATG”) and the next codon (shown), or the last protein-encoding codon and one of three stop codons (“TGA”, “TAG”, or “TAA”) (not shown), respectively. The schematic illustrates the selection of homology arms for N-terminal tagging of the gene encoding the synaptic versicle protein Cysteine string protein, Csp, within P[acman] BAC clone CH322–06D09 (Venken et al., 2009). (B) **Generation of recombineering templates for fluorescent protein tagging by 2-step PCR & cloning**. Cloning of recombineering templates with fluorescent protein tags for modifying the N- or C-terminus of a gene of interest begins with a primary PCR amplification of the desired cassette from one of the pre-built plasmids for fluorescent protein tagging (see Figure 3A) using primers with 20 bp of PCR-homology to the plasmid and 50 bp recombineering-homology (see A), producing a fluorescent protein tag linked to the Ampicillin resistance marker (Amp^R) flanked by *LoxP* sites, all of it bordered by 50 bp recombineering homology arms homologous to the sequence where the tag needs to be integrated (see A), as illustrated for the EGFP tag for N-terminal tagging. The product from the primary PCR amplification is then further amplified during a secondary PCR amplification, using primers with 20 to 25 bp of PCR-homology to the amplified primary PCR product and 21 bp overhangs that will include *Xho*I restriction sites for downstream release of the “fluorescent protein tagging” recombineering template as well as sequence required for GoldenBraid2.0 (GB2.0) cloning of the PCR-amplified product into plasmid pR6Kγ-A1^Spm. Plasmid pR6Kγ-A1^Spm contains a conditional origin of replication, R6Kγ, requiring a specialized bacterial *Escherichia coli* strain encoding the “PIR” protein required for plasmid maintenance. The secondary PCR-amplified product is cloned by GB2.0 cloning in plasmid pR6Kγ-A1^Spm, by combining PCR product and plasmid pR6Kγ-A1^Spm, with the Type IIs restriction enzyme *Bsa*I, T4 DNA ligase, and 10x T4 DNA ligase buffer. The assembly protocol cycles 25 to 50 times between 37°C (favoring cutting by *Bsa*I) and 16°C (favoring ligation by T4 DNA ligase). After overnight selection on bacterial plates (spectinomycin for pR6Kγ-A1^Spm), assembled plasmids are identified as white colonies that are characterized further by restriction enzyme fingerprinting and Sanger DNA sequencing (see **Text**), while religated plasmid products are blue due to the presence of the colorimetric LacZ α-fragment. A correct clone is then linearized using *Xho*I to release the recombineering template, encoding the N-terminal EGFP tag linked to the Ampicillin resistance marker (Amp^R) flanked by *LoxP* sites for fluorescent protein tagging, from the pR6Kγ-A1^Spm plasmid backbone. Further purification steps are not required since the pR6Kγ-A1^Spm plasmid backbone cannot replicate in the recombineering strain that doesn’t encode the “PIR” protein required for maintenance of R6Kγ plasmids.

Figure 5. — (A) **Selection of homology arms where recombineering for selection genetics needs to occur in the P[acman] BAC plasmid**. Homology arms for recombineering templates encoding any of the resistance markers for selection genetics are designed to replace the chloramphenicol promoter and resistance marker present in the P[acman] BAC plasmid backbone used to create both the CHORI-322 and CHORI-321 P[acman] BAC libraries (Venken et al., 2009). (B) **Generation of recombineering templates for selection genetics by 2-step PCR & cloning**. Cloning of recombineering templates with selection markers for selection genetics in *Drosophila melanogaster* begins with a primary PCR amplification of the desired cassette from one of the pre-built plasmids for selection genetics (see Figure 3B) using primers with 20 bp of PCR-homology to the plasmid and 50 bp recombineering-homology (see A), producing a selection/resistance marker flanked by recombineering homology arms homologous to the sequence within the P[acman] BAC plasmid backbone where the marker needs to be integrated (see A), as illustrated for any of the selection/resistance marker cassettes. Since all cassettes for selection genetics start with the *Hsp70* promoter from *Drosophila melanogaster* and end with the minimal polyadenylation signal of the *thymidine kinase* gene from herpes simplex virus (see Figure 3B), this exact strategy can be applied to all selection/resistance markers. The product from the primary PCR amplification is further amplified during a secondary PCR amplification, using primers with 20 to 23 bp of PCR-homology to the amplified primary PCR product and 21 bp overhangs that will include *Xba*I restriction sites for downstream release of the “selection genetics” recombineering template as well as sequence required for GoldenBraid 2.0 (GB2.0) cloning of the PCR product into the plasmid pR6Kγ-A1^Spm. Plasmid pR6Kγ-A1^Spm contains a conditional origin of replication, R6Kγ, requiring a specialized bacterial *Escherichia coli* strain encoding the “PIR” protein required for plasmid maintenance. The secondary PCR-amplified product is cloned by GB2.0 cloning in plasmid pR6Kγ-A1^Spm, by combining PCR product and plasmid pR6Kγ-A1^Spm, with the Type IIs restriction enzyme *Bsa*I, T4 DNA ligase, and 10x T4 DNA ligase buffer. The assembly protocol cycles 25 to 50 times between 37°C (favoring cutting by *Bsa*I) and 16°C (favoring ligation by T4 DNA ligase). After overnight selection on bacterial plates (spectinomycin for pR6Kγ-A1^Spm), assembled plasmids are identified as white colonies that are characterized further by restriction enzyme fingerprinting and Sanger DNA sequencing (see **Text**), while religated plasmid products are blue due to the presence of the colorimetric LacZ α-fragment. A correct clone is then linearized using *Xba*I to release the recombineering template encoding the resistance marker for selection genetics, from the pR6Kγ-A1^Spm plasmid backbone. Further purification steps are not required since the pR6Kγ-A1^Spm plasmid backbone cannot replicate in the recombineering strain that doesn’t encode the “PIR” protein required for maintenance of R6Kγ plasmids.

Materials

Reagents, solutions, and starting samples or test organisms/cells

1x of each plasmid containing a cassette to generate recombineering templates for fluorescent protein tagging (Figure 3A):
- pEGFP-N-Terminal-Tagging (Addgene, cat. no. 165868) (Matinyan et al., 2021b) (Table 1)
- pEGFP-C-Terminal-Tagging (Addgene, cat. no. 165869) (Matinyan et al., 2021b) (Table 1)
- pmCherry-N-Terminal-Tagging (Addgene, cat. no. 165870) (Matinyan et al., 2021b) (Table 1)
- pmCherry-C-Terminal-Tagging (Addgene, cat. no. 165871) (Matinyan et al., 2021b) (Table 1)
1x of each plasmid containing a cassette to generate recombineering templates for selection genetics (Figure 3B):
- pHSP70B-CP6-nptII (Addgene, cat. no. 165876) (Matinyan et al., 2021b) (Table 1)
- pHSP70B-CP6-pac (Addgene, cat. no. 165877) (Matinyan et al., 2021b) (Table 1)
- pHSP70B-CP6-bsr (Addgene, cat. no. 165878) (Matinyan et al., 2021b) (Table 1)
- pHSP70B-CP6-hph (Addgene, cat. no. 165879) (Matinyan et al., 2021b) (Table 1)
Standard cloning vector backbone (Figure 4 and Figure 5) for GB2.0 synthetic assembly cloning (Sarrion-Perdigones et al., 2013, 2019; Sarrion-Perdigones et al., 2020; Sarrion-Perdigones et al., 2022; Matinyan et al., 2021b):
- pGB2-R6Kγ-A1^Spm (Addgene 165866) (Matinyan et al., 2021b) (Table 1)
1xLB agar (see Reagents and Solutions section for recipe)
Kanamycin sulfate powder (VWR, cat. no. 45000–640) to make a 1,000x stock solution in MilliQ H₂O, followed by filter sterilization (30 mg/ml) (Table 2)
MilliQ H₂O, sterilized by autoclaving
Ampicillin powder (VWR, cat. no. IC19014605) to make a 1,000x stock solution in 50% EtOH diluted with MilliQ H₂O, followed by filter sterilization (100 mg/ml) (Table 2)

Ampicillin powder is first dissolved in ½ volume of MilliQ H₂O and then diluted with ½ volume of 100% EtOH
Absolute ethanol (VWR, cat. no. 89125–188)
Puromycin dihydrochloride, powder (VWR, cat. no. 97064–280) to make a 1,000x stock solution in MilliQ H₂O, followed by filter sterilization (100 mg/ml) (Table 2)
Blasticidin S hydrochloride, powder (VWR, cat. no. 71002–676) to make a 1,000x stock solution in MilliQ H₂O, followed by filter sterilization (100 mg/ml) (Table 2)
Hygromycin B, powder (VWR, cat. no. AAJ60681–03) to make a 1,000x stock solution in MilliQ H₂O, followed by filter sterilization (75 mg/ml) (Table 2)
Spectinomycin sulphate powder (VWR, cat. no. IC0215899301) to make a 1,000x stock solution in MilliQ H₂O, followed by filter sterilization (50 mg/ml) (Table 2)
2xLB-0.5 medium (see Reagents and Solutions section for recipe)
Glycerol (Fisher Scientific, cat. no. BP229–1) to make a 40% glycerol solution in MilliQ H₂O, sterilized by autoclaving
QIAprep spin miniprep kit (QIAGEN, cat. no. 27106) for plasmid purification
10x rCutSmart Buffer for restriction enzyme digestions (NEB B6004S)
Restriction enzymes for restriction enzyme DNA fingerprinting: EcoRI-HF (New England Biolabs, cat. no. R3101L) and BsaI-HFv2 (New England Biolabs, cat. no. R3733L)
Primers for Sanger DNA sequencing, see below (Sigma-Aldrich)
Custom primers for PCR amplification and synthetic assembly DNA cloning, see below (Sigma-Aldrich)
dNTP nucleotide mix (Thermo Scientific, R1121)
Phusion high-fidelity DNA polymerase and 5x Buffer HF (NEB M0350S or M0350L)
DNA Clean and Concentrator kit for purification of PCR-amplified DNA products (Zymogen D4033 or D4034)
EB buffer (10 mM Tris-Cl, pH 8.5) from QIAprep spin miniprep kit (see above)
BsaI-HFv2 restriction enzyme for synthetic assembly DNA cloning (New England Biolabs, cat. no. R3733L)
T4 DNA ligase and 10x T4 DNA ligase buffer (Promega, cat. no. M1804)
Home-made chemocompetent Escherichia coli cells (Sarrion-Perdigones et al., 2020) of the “PIR” protein-encoding TransforMax EC100D pir-116 strain (Lucigen Corporation, cat. no. EC6P095H) needed to maintain plasmids with the conditional origin of replication (R6Kγ), pGB2-R6Kγ-A1^Spm (see above)
X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) powder (VWR, cat. no. 97061–648) to make a 1,000x stock solution in dimethyl sulfoxide (DMSO) (2%)
Restriction enzymes for plasmid linearization: XbaI (New England Biolabs, cat. no. R0145L), and XhoI (New England Biolabs, cat. no. R0146L).

Table 2. Summary of antibiotics used in this work.

Antibiotic name, master stock concentration, working stock concentration, and ordering information, vendor including catalog number, are indicated for all antibiotics mentioned in this work.

Antibiotic name	Master stock concentration	Working stock concentration	Ordering information (Vendor, Catalog #)
Ampicillin	100 mg/ml in 50% EtOH (First dissolved in ½ volume of MilliQ H₂O and then diluted with ½ volume of 100% EtOH)	100 μg/ml (High copy) 50 μg/ml (Low copy)	VWR, cat. no. IC19014605
Blasticidin S	100 mg/ml in MilliQ H₂O	100 μg/ml	VWR, cat. no. 71002–676
Chloramphenicol	12.5 mg/ml in 100% EtOH	12.5 μg/ml	VWR, cat. no. 45000–618
Hygromycin B	75 mg/ml in MilliQ H₂O	75 μg/ml	VWR, cat. no. AAJ6068103
Kanamycin	30 mg/ml in MilliQ H₂O	30 μg/ml (High copy) 15 μg/ml (Low copy)	VWR, cat. no. 45000–640
Puromycin	100 mg/ml in MilliQ H₂O	100 μg/ml	VWR, cat. no. 97064–280
Spectinomycin	100 mg/ml in MilliQ H₂O	50 μg/ml	VWR, cat. no. IC0215899301

Open in a new tab

Hardware and instruments

Disposable inoculating loops (VWR, cat. no. 12000–806)
Bacterial plates (VWR, cat. no. 25384–092)
37°C incubator (VWR, cat. no. 89409–216)
14-ml disposable culture tubes (VWR, cat. no. 60818–689)
32°C incubator-shaker (Amerex Instruments, cat. no. 747/747R)
1.7-ml microcentrifuge tubes (VWR, cat. no. 20170–038)
Refrigerated tabletop centrifuge that can accommodate 14-ml tubes (Fisher Scientific, cat. no. 75230115)
Tabletop microcentrifuge that can accommodate 1.7-ml tubes (Fisher Scientific, cat. no. 75002435)
Spectrophotometer (DeNovix, cat. no. DS-11+)
Reagents and equipment for agarose gel electrophoresis (Voytas, 2001)
Gel documentation system
0.2-ml PCR strip tubes with individually attached caps (VWR, cat. no. 53509–304)
PCR machine (Applied Biosystems, cat. no. 4375786)
Ice bucket
Dry bead bath (Lab Armor, cat. no. 74309–706), set at 42°C for bacterial transformation
Glass spreading beads (VWR, cat. no. 26396–508)

Protocol steps

Obtaining and preparing plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster

1
Order the necessary plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging (pEGFP-N-Terminal-Tagging, pEGFP-C-Terminal-Tagging, pmCherry-N-Terminal-Tagging, and/or pmCherry-C-Terminal-Tagging) (Figure 3A), and selection genetics (pHSP70B-CP6-nptII, pHSP70B-CP6-pac, pHSP70B-CP6-bsr, and/or pHSP70B-CP6-hph) (Figure 3B), as well as the standard GB2.0 cloning vector backbone (pGB2-R6Kγ-A1Spm) used to clone recombineering templates for fluorescent protein tagging (Figure 4) and selection genetics (Figure 5), from Addgene (www.addgene.org). Plasmids ordered from Addgene will arrive as agar stabs.

If the necessary strains are already present in the lab, identify the glycerol stocks.
2
Using a disposable inoculating loop, streak out each agar stab (or glycerol stock) to single colonies on bacterial plates containing 1xLB agar and the appropriate antibiotic:
- Plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging (pEGFP-N-Terminal-Tagging, pEGFP-C-Terminal-Tagging, pmCherry-N-Terminal-Tagging, and/or pmCherry-C-Terminal-Tagging): 30 μg/ml kanamycin and 100 μg/ml ampicillin.
- Plasmids containing cassettes to generate recombineering templates for selection genetics: 30 μg/ml kanamycin (pHSP70B-CP6-nptII), 100 μg/ml Puromycin HCl (pHSP70B-CP6-pac), 100 μg/ml Blasticidin S (pHSP70B-CP6-bsr), or 75 μg/ml Hygromycin B (pHSP70B-CP6-hph).
- Standard GB2.0 cloning vector backbone (pGB2-R6Kγ-A1^Spm): 50 μg/ml spectinomycin.
3
Incubate plates overnight in a 37°C incubator.
4
For each plasmid, pick a single colony using a disposable inoculation loop and inoculate into a 14-ml disposable culture tube containing 5 ml of 2xLB-0.5 medium supplemented with appropriate antibiotic:
- Plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging (pEGFP-N-Terminal-Tagging, pEGFP-C-Terminal-Tagging, pmCherry-N-Terminal-Tagging, and/or pmCherry-C-Terminal-Tagging): 30 μg/ml kanamycin and 100 μg/ml ampicillin.
- Plasmids containing cassettes to generate recombineering templates for selection genetics: 30 μg/ml kanamycin (pHSP70B-CP6-nptII), 100 μg/ml Puromycin HCl (pHSP70B-CP6-pac), 100 μg/ml Blasticidin S (pHSP70B-CP6-bsr), or 75 μg/ml Hygromycin B (pHSP70B-CP6-hph).
- Standard GB2.0 cloning vector backbone (pGB2-R6Kγ-A1^Spm): 50 μg/ml spectinomycin.
5
Grow the cultures overnight in a shaking incubator at 32°C. Angle tubes for maximal aeration.
6
For each plasmid for which you don’t yet have a glycerol stock, separate 0.25 ml of the overnight grown culture in a 1.7-ml microcentrifuge tube and add 0.25 ml of 40% glycerol to make a glycerol stock. Move glycerol stock to ultrafreezer at −80°C.
7
Spin down remaining portion of each culture for 5 minutes at 4,000 × g using a refrigerated tabletop centrifuge that can accommodate 14-ml tubes. Decant the supernatant.

OPTIONAL: Freeze pellet at −20°C or −80°C for at least 30 minutes prior to proceeding to the next step. Freezing the pellet will simplify resuspension of bacterial pellet for DNA isolation purposes.
8
Isolate plasmid DNA using the QIAprep spin miniprep kit according to manufacturer’s instruction, and a tabletop microcentrifuge that can accommodate 1.7-ml tubes.
9
Elute DNA in 50 μl of EB buffer. Measure the concentration using a spectrophotometer.
10
Verify the identity of isolated plasmids containing cassettes to generate recombineering templates (for both fluorescent protein tagging and selection genetics) via restriction enzyme DNA fingerprinting using the restriction enzyme EcoRI-HF, followed by agarose gel electrophoresis and gel documentation, resulting in two distinct bands, one corresponding to the plasmid backbone and the other to the insert:
- 400 ng of plasmid
- 2.5 μl of rCutSmart buffer
- 0.5 μl of EcoRI-HF
- MilliQ H₂O up to 25 μl
  
  Alternatively, plasmids containing cassettes to generate recombineering templates (for both fluorescent protein tagging and selection genetics) can be verified using Sanger DNA sequencing and the following DNA sequencing primers:
- SeqFOR: CTTTTTACGGTTCCTGGCCTTTTG
- SeqREV: AATGAGCTGATTTAACAAAAATTTAACGCG
11
Verify the identity of the standard GB2.0 cloning vector backbone (pGB2-R6Kγ-A1^Spm) via restriction enzyme DNA fingerprinting using the restriction enzyme BsaI-HFv2, followed by agarose gel electrophoresis and gel documentation, resulting in two distinct bands, one corresponding to the plasmid backbone and the other band to the LacZ stuffer containing the colorimetric LacZ α-fragment (Figure 4 and Figure 5):
- 400 ng of plasmid
- 2.5 μl of rCutSmart buffer
- 0.5 μl of BsaI-HFv2
- MilliQ H₂O up to 25 μl
  
  Alternatively, plasmid pGB2-R6Kγ-A1^Spm can be verified using Sanger DNA sequencing and the following DNA sequencing primers:
- R6K-SeqFOR: CTTCATCCGTTTCCACGGTGTGCG
- R6K-SeqREV: CGTTAGCCATGAGGGTTTAGTTCG
12
Once you have verified the identities of all plasmids, dilute each plasmid containing cassettes to generate recombineering templates (for both fluorescent protein tagging and selection genetics) with MilliQ H₂O to a final concentration of 1 ng/μl. Similarly, dilute the standard GB2.0 cloning vector (pGB2-R6Kγ-A1^Spm) with MilliQ H₂O to a final concentration of 75 ng/μl.

Designing primers for PCR amplification of cassettes to generate recombineering templates for fluorescent protein tagging in Drosophila melanogaster

13
Design two primer pairs to generate a recombineering template for fluorescent protein tagging by 2-step PCR amplification using one of the plasmids with a “fluorescent protein tagging” cassette as PCR template: plasmid pEGFP-N-Terminal-Tagging or pEGFP-C-Terminal-Tagging to tag a gene of interest with the fluorescent protein EGFP at the N- or C-terminus, respectively, or plasmid mCherry-N-Terminal-Tagging or mCherry-C-Terminal-Tagging to tag a gene of interest with the fluorescent protein mCherry at the N- or C-terminus, respectively (Figure 3A and Figure 4).
- For EGFP-tagging at the N-terminus of your gene of interest (GOI), design primers for primary PCR-amplification of the “EGFP-N-Terminal-Tagging” cassette as follows:
  - GOI-EGFP-N-RECO-1-F: (Nx50)ATGGTGAGCAAGGGCGAGGAG
  - GOI-EGFP-N-RECO-1-R: (Nx50)GCTGCCGCCGCTACCTCC
    
    These primers have 18 to 21 bp of PCR-homology to the plasmid with the “EGFP-N-Terminal-Tagging” cassette (shown in bold black) (Figure 3A), and 50 bp of recombineering-homology (Nx50) homologous to the sequence of your gene of interest within the P[acman] BAC plasmid backbone where the EGFP fluorescent protein tag needs to be integrated at the N-terminus (shown in bold dark purple) (Figure 4A).
    
    Design primers for secondary PCR-amplification of the primary “EGFP-N-Terminal-Tagging” PCR product as follows:
  - GOI-EGFP-N-RECO-2-F: CGCGGGTCTCTGGAGCTCGAG (Nx20to25)
  - GOI-EGFP-N-RECO-2-R: CGCGGGTCTCTAGCGCTCGAG (Nx20to25)
    
    These primers have 20 to 25 bp of PCR-homology (Nx20to25) to the primary PCR-amplified “EGFP-N-Terminal-Tagging” product (shown in bold dark purple), as well as 21 bp overhangs that will add XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1^Spm backbone (shown in bold light purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black) (Figure 4B).
- For EGFP-tagging at the C-terminus of your gene of interest (GOI), design primers for primary PCR-amplification of the “EGFP-C-Terminal-Tagging” cassette as follows:
  - GOI-EGFP-C-RECO-1-F: (Nx50)GGAGGTTCCGGTGGAAGC
  - GOI-EGFP-C-RECO-1-R: (Nx50)TTACTTGTATAGCTCGTCCATG
    
    These primers have 18 to 22 bp of PCR-homology to the plasmid with the “EGFP-C-Terminal-Tagging” cassette (shown in bold black) (Figure 3A), and 50 bp of recombineering-homology (Nx50) homologous to the sequence of your gene of interest within the P[acman] BAC plasmid backbone where the EGFP fluorescent protein tag needs to be integrated at the C-terminus (shown in bold purple).
    
    Design primers for secondary PCR-amplification of the primary “EGFP-C-Terminal-Tagging” PCR product as follows:
  - GOI-EGFP-C-RECO-2-F: CGCGGGTCTCTGGAGCTCGAG(Nx20to25)
  - GOI-EGFP-C-RECO-2-R: CGCGGGTCTCTAGCGCTCGAG(Nx20to25)
    
    These primers have 20 to 25 bp of PCR-homology (Nx20to25) to the primary PCR-amplified “EGFP-C-Terminal-Tagging” product (shown in bold purple), as well as 21 bp overhangs that will add XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1^Spm backbone (shown in bold purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black).
- For mCherry-tagging at the N-terminus of your gene of interest (GOI), design primers for primary PCR-amplification of the “mCherry-N-Terminal-Tagging” cassette as follows:
  - GOI-mCherry-N-RECO-1-F: (Nx50)ATGGTGTCCAAGGGAGAAGAG
  - GOI-mCherry-N-RECO-1-R: (Nx50)GCTGCCGCCGCTACCTCC
    
    These primers have 18 to 21 bp of PCR-homology to the plasmid with the “mCherry -N-Terminal-Tagging” cassette (shown in bold black) (Figure 3A), and 50 bp of recombineering-homology (Nx50) homologous to the sequence of your gene of interest within the P[acman] BAC plasmid backbone where the mCherry fluorescent protein tag needs to be integrated at the N-terminus (shown in bold purple).
    
    Design primers for secondary PCR-amplification of the primary “mCherry-N-Terminal-Tagging” PCR product as follows:
  - GOI- mCherry-N-RECO-2-F: CGCGGGTCTCTGGAGCTCGAG (Nx20to25)
  - GOI- mCherry-N-RECO-2-R: CGCGGGTCTCTAGCGCTCGAG (Nx20to25)
    
    These primers have 20 to 25 bp of PCR-homology (Nx20to25) to the primary PCR-amplified “mCherry-N-Terminal-Tagging” product (shown in bold purple), as well as 21 bp overhangs that will add XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1^Spm backbone (shown in bold purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black).
- For mCherry-tagging at the C-terminus of your gene of interest (GOI), design primers for primary PCR-amplification of the “mCherry-C-Terminal-Tagging” cassette as follows:
  - GOI-mCherry-C-RECO-1-F: (Nx50)GGAGGTTCCGGTGGAAGC
  - GOI-mCherry-C-RECO-1-R: (Nx50)TTACTTGTACAGCTCATCCATGC
    
    These primers have 18 to 22 bp of PCR-homology to the plasmid with the “mCherry-C-Terminal-Tagging” cassette (shown in bold black) (Figure 3A), and 50 bp of recombineering-homology (Nx50) homologous to the sequence of your gene of interest within the P[acman] BAC plasmid backbone where the mCherry fluorescent protein tag needs to be integrated at the C-terminus (shown in bold purple).
    
    Design primers for secondary PCR-amplification of the primary “mCherry-C-Terminal-Tagging” PCR product as follows:
  - GOI-mCherry-C-RECO-2-F: CGCGGGTCTCTGGAGCTCGAG (Nx20to25)
  - GOI-mCherry-C-RECO-2-R: CGCGGGTCTCTAGCGCTCGAG (Nx20to25)
    
    These primers have 20 to 25 bp of PCR-homology (Nx20to25) to the primary PCR-amplified “mCherry-C-Terminal-Tagging” product (shown in bold purple), as well as 21 bp overhangs that will add XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1^Spm backbone (shown in bold purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black).
- To apply the principles described above to a practical example, primers to modify the CH322–06D09 P[acman] BAC clone covering the gene encoding Cysteine string protein (Csp) using an N-terminal EGFP tag for gene expression analysis are as follows (Figure 4B):
  Primers for primary PCR-amplification of the “EGFP-N-Terminal-Tagging” cassette are:
  - Csp-EGFP-N-RECO-1-F: ATCGCTAGTGCAAGTTACCCGTTCGCAGTCAAAGTGACACAGGCATCAGGATGGTGAGCAAGGGCGAGGAG
  - Csp-EGFP-N-RECO-1-R: GCACTACAAAATACTTACGACAGTTTTCTCTTGTCCATGCCAGGTGCGCTGCTGCCGCCGCTACCTCC
    
    Primers for secondary PCR-amplification of the primary “EGFP-N-Terminal-Tagging” PCR product are:
  - Csp-EGFP-N-RECO-2-F: CGCGGGTCTCTGGAGCTCGAGATCGCTAGTGCAAGTTACCCGTTCG
  - Csp-EGFP-N-RECO-2-R: CGCGGGTCTCTAGCGCTCGAGGCACTACAAAATACTTACGACAG
14
Order all needed primers from your preferred vendor.

We order primers from Sigma, but other vendors can be pursued as well.
15
Once primers are received lyophilized, prepare a master and working stock of 100 μM (100 pmol/μl) and 10 μM (10 pmol/μl), respectively, for each, using MilliQ H₂O.

Designing primers for PCR amplification of cassettes to generate recombineering templates for selection genetics in Drosophila melanogaster

16
To generate a recombineering template for selection genetics by 2-step PCR amplification using one of the plasmids with the “selection genetics” cassettes, plasmid pHSP70B-CP6-nptII, pHSP70B-CP6-pac, pHSP70B-CP6-bsr, or pHSP70B-CP6-hph (Figure 3B and Figure 5), use the following universal two primer pairs:
Primers for the primary PCR-amplification are:
- Selection-RECO-1-F: CTGGTGTCCCTGTTGATACCGGGAAGCCCTGGGCCAACTTTTGGCGAAACTAGAATCCCAAAACAAACTG
- Selection-RECO-1-R: GCGTAGCAACCAGGCGTTTAAGGGCACCAATAACTGCCTTAAAAAAAGAACAAACGACCCAACACCCGTG
  
  These primers have 21 to 23 bp of PCR-homology to the plasmids with the “selection genetics” cassettes (shown in bold black) (Figure 3B), and 47 to 49 bp of recombineering homology to the sequence within the P[acman] BAC plasmid backbone where the marker needs to be integrated (shown in bold yellow) (Figure 5A). Since all cassettes for selection genetics start with the Hsp70 promoter from Drosophila melanogaster and end with the minimal polyadenylation signal of the thymidine kinase gene from herpes simplex virus (Figure 3B), the same primers can be used for any selection/resistance markers (Kan^R/G418^R, Puro^R, Blast^R, or Hygro^R).
  
  Primers for the secondary PCR-amplification of the primary “selection genetics” PCR product are:
- Selection-RECO-2-F: CGCGGGTCTCTGGAGTCTAGACTGGTGTCCCTGTTGATACC
- Selection-RECO-2-R: CGCGGGTCTCTAGCGTCTAGAGCGTAGCAACCAGGCGTTTAAGG
  
  These primers have 20 to 23 bp of PCR-homology to the primary PCR-amplified product (shown in bold yellow), as well as 21 bp overhangs that will add XbaI restriction sites for downstream release of the “selection genetics” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1^Spm backbone (shown in bold purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black) (Figure 5B).
- Since the vector backbone used to build both P[acman] BAC libraries CHORI-322 and CHORI-321, the primers shown above can also be used to modify the CH322–06D09 P[acman] BAC clone that covers Csp using a G418 sulfate-selectable marker for selection transgenesis (Figure 5B).
17
Order all needed primers from your preferred vendor.
18
Once primers are received lyophilized, prepare a master and working stock of 100 μM (100 pmol/μl) and 10 μM (10 pmol/μl), respectively, for each, using MilliQ H₂O.

PCR amplification of cassettes to generate recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster

19
Using the appropriate “RECO-1” primer pair, amplify the desired “fluorescent protein tagging” (Figure 3A) or “selection genetics” (Figure 3B) cassette by primary PCR (Figure 4B and Figure 5B), using the Phusion high-fidelity DNA polymerase by aliquoting the following components in a 0.2-ml PCR strip tube with individually attached cap:
- Diluted plasmid template DNA (1 ng/μl): 1 μl (see above)
- RECO-1-F primer (10 pmol/μl): 2.5 μl
- RECO-1-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
- MilliQ H₂O: up to 50 μl
  
  To apply the principles described above to a practical example, the primary PCR to modify the CH322–06D09 P[acman] BAC clone covering Csp using the N-terminal EGFP tag for gene expression analysis is as follows:
- Diluted plasmid template DNA (pEGFP-N-Terminal-Tagging) (1 ng/μl): 1 μl (see above)
- Csp-EGFP-N-RECO-1-F primer (10 pmol/μl): 2.5 μl
- Csp-EGFP-N-RECO-1-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
- MilliQ H₂O: up to 50 μl
  
  The primary PCR to modify the CH322–06D09 P[acman] BAC clone with a G418 sulfate-selectable marker for selection transgenesis is as follows:
- Diluted plasmid template DNA (pHSP70B-CP6-nptII) (1 ng/μl): 1 μl (see above)
- Selection-RECO-1-F primer (10 pmol/μl): 2.5 μl
- Selection-RECO-1-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
- MilliQ H₂O: up to 50 μl
20
Briefly spin tubes and place into a PCR machine. Amplify the “fluorescent protein tagging” (EGFP-N-Terminal-Tagging) or “selection genetics” cassettes (HSP70B-CP6-nptII) using the following cycling conditions:
- Initial denaturation at 98°C for 30 seconds
- 30 amplification cycles consisting of a denaturation step at 98°C for 10 seconds, primer annealing at 64°C for 30 seconds (calculate annealing temperature when preferred), and a polymerization step at 72° for 30 seconds/kilobase
- Final extension at 72°C for 10 minutes
- Hold at 16°C until ready for further processing
21
Remove amplified samples from PCR machine. Gently flick tubes followed by briefly spinning down samples.
22
Do a post-PCR amplification DNA clean-up using the DNA Clean and Concentrator kit according to manufacturer’s instruction and elute sample in 20 μl of EB Buffer.
23
Measure the DNA concentration using a spectrophotometer.
24
Check 2 μl of purified primary “fluorescent protein tagging” (EGFP-N-Terminal-Tagging) and “selection genetics” (HSP70B-CP6-nptII) PCR-amplified cassettes using agarose gel electrophoresis and gel documentation to verify fragment integrity and size.
25
The resulting primary PCR products are GOI-EGFP-N-Terminal-Tagging-1 and GOI-HSP70B-CP6-nptII-1.

For Csp, the resulting primary PCR products are Csp-EGFP-N-Terminal-Tagging-1 and Csp-HSP70B-CP6-nptII-1.
26
Make a diluted aliquot of PCR product(s) to a final concentration of 1 ng/μl.
27
Using the appropriate “RECO-2” primer pair, amplify the obtained primary “fluorescent protein tagging” (GOI-EGFP-N-Terminal-Tagging-1) (Figure 4B) or “selection genetics” (GOI-HSP70B-CP6-nptII-1) (Figure 5B) PCR-amplified product by secondary PCR (Figure 4B and Figure 5B), using the Phusion high-fidelity DNA polymerase by aliquoting the following components in a 0.2-ml PCR strip tube with individually attached cap:
- Diluted primary PCR product (1 ng/μl): 1 μl
- RECO-2-F primer (10 pmol/μl): 2.5 μl
- RECO-2-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
- MilliQ H₂O: up to 50 μl
  
  In our example, the secondary PCR to modify the CH322–06D09 P[acman] BAC clone that covers Csp using the N-terminal EGFP tag is as follows:
- Diluted primary PCR product (Csp-EGFP-N-Terminal-Tagging-1) (1 ng/μl): 1 μl
- Csp-EGFP-N-RECO-2-F primer (10 pmol/μl): 2.5 μl
- Csp-EGFP-N-RECO-2-Rprimer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
- MilliQ H₂O: up to 50 μl
  
  The secondary PCR to modify the CH322–06D09 P[acman] BAC clone with a G418 sulfate-selectable marker for selection transgenesis is as follows:
- Diluted primary PCR product (Csp-HSP70B-CP6-nptII-1) (1 ng/μl): 1 μl
- Selection-RECO-2-F primer (10 pmol/μl): 2.5 μl
- Selection-RECO-2-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
- MilliQ H₂O: up to 50 μl
28
Briefly spin tubes and place into PCR machine. Amplify primary “fluorescent protein tagging” or “selection genetics” PCR product using the following cycling conditions:
- Initial denaturation at 98°C for 30 seconds
- 30 amplification cycles consisting of a denaturation step at 98°C for 10 seconds, primer annealing at 64°C for 30 seconds (calculate annealing temperature when preferred), and a polymerization step at 72° for 30 seconds/kilobase
- Final extension at 72°C for 10 minutes
- Hold at 16°C until ready for further processing
29
Remove sample from PCR machine. Gently flick tubes followed by briefly spinning down samples.
30
Do a post-PCR amplification DNA clean-up using the DNA Clean and Concentrator kit according to manufacturer’s instruction and elute sample in 20 μl of EB Buffer.
31
Measure the DNA concentration using a spectrophotometer.
32
Check 2 μl of purified secondary “fluorescent protein tagging” (EGFP-N-Terminal-Tagging) and “selection genetics” (HSP70B-CP6-nptII) PCR-amplified products using agarose gel electrophoresis and gel documentation to verify fragment integrity and size.
33
The final PCR products are GOI-EGFP-N-Terminal-Tagging-2 and GOI-HSP70B-CP6-nptII-2. Dilute both samples with MilliQ H₂O to a final concentration of 40 ng/μl.

For Csp, the final PCR products are Csp-EGFP-N-Terminal-Tagging-2 and Csp-HSP70B-CP6-nptII-2.

Cloning of recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster using a plasmid containing a conditional origin of replication

34
In a 0.2-ml PCR strip tube with individually attached cap, add secondary “fluorescent protein tagging” (GOI-EGFP-N-Terminal-Tagging-2) or “selection genetics” (GOI-HSP70B-CP6-nptII-2) PCR-amplified product, standard GB2.0 cloning vector (pR6Kγ-A1^Spm) and enzymes according to the following recipe for GB2.0 synthetic assembly DNA cloning:
- 40 ng PCR-amplified DNA part
- 75 ng standard GB2.0 cloning vector (pR6Kγ-A1^Spm)
- 1 μl BsaI-HFv2
- 1 μl of T4 DNA ligase
- 2 μl of 10x T4 DNA ligase buffer
- MilliQ H₂O up to 20 μl
  
  To apply the principles described above to our example, the reactions to clone Csp-EGFP-N-Terminal-Tagging-2 and Csp-HSP70B-CP6-nptII-2 in pR6Kγ-A1^Spm are:
- 40 ng Csp-EGFP-N-Terminal-Tagging-2 or Csp-HSP70B-CP6-nptII-2
- 75 ng standard GB2.0 cloning vector (pR6Kγ-A1^Spm)
- 1 μl BsaI-HFv2
- 1 μl of T4 DNA ligase
- 2 μl of 10x T4 DNA ligase buffer
- MilliQ H₂O up to 20 μl
35
Briefly vortex and spin down tube contents and place into a PCR machine. Use the following GB2.0 cloning protocol to drive the synthetic DNA assembly cloning reaction. We recommend at least 25 cycles for efficient cloning (Figure 4B and Figure 5B):
- 25 to 50 reaction cycles of BsaI-HFv2-mediated cutting at 37°C for 2 minutes followed by T4 DNA ligase-mediated ligation at 16°C for 5 minutes
- Heat inactivation of enzymes at 85°C for 20 minutes
- Hold at 16°C until ready for further processing
36
Keep sample cool at 16°C in the PCR machine or move to refrigerator (4°C) until ready to transform. Transform sample within 24 to 48 hours of assembly reaction. Do not freeze.
37
On ice, thaw a microcentrifuge tube containing 50 μl aliquot of home-made chemocompetent TransforMax EC100D pir-116 E. coli cells (Sarrion-Perdigones et al., 2020).

TransforMax EC100D pir-116 E. coli cells express the “PIR” protein required for the maintenance of plasmids containing a conditional origin of replication, R6Kγ. Other “PIR” protein-expressing E. coli strains can be used.
38
Add 2 μl of GB2.0 synthetic DNA assembly reaction and incubate on ice for 10 to 15 minutes.
39
Heat shock cells by transferring the tube into a dry bead bath, set at 42°C for bacterial transformation, for 45 seconds.
40
Immediately after heat shocking the cells, transfer them to ice and incubate for an additional 2 minutes.
41
After 2 minutes, add 450 μl of 2xLB-0.5 liquid media (without antibiotics) to the microcentrifuge tube containing transformed cells and transfer to the 32°C shaking incubator, by taping the microcentrifuge tube to the shaker at an angle to ensure maximal aeration of culture.
42
Allow cells to recover shaking at 32°C for 45 minutes.
43
Plate 50 μl of recovered cells onto bacterial plates containing 1xLB agar supplemented with spectinomycin (50 μg/ml) and X-Gal using glass spreading beads.
44
Remove glass spreading beads and place plates into a 37°C incubator and let grow overnight. This should yield plenty of colonies. Depending on the efficiency of the cloning reaction, most colonies should be white (Figure 4B and Figure 5B). The presence of lots of blue colonies indicates a lower cloning efficiency.
45
Pick two white colonies using a fresh disposable inoculation loop for each colony and inoculate into a 14-ml disposable culture tubes containing 5 ml of 2xLB-0.5 medium supplemented with spectinomycin (50 μg/ml).
46
Grow the cultures overnight in a shaking incubator at 32°C. Angle tubes for maximal aeration.
47
Separate 0.25 ml of the overnight grown cultures in a 1.7-ml microcentrifuge tube each and add 0.25 ml of 40% glycerol to make a glycerol stock. Move glycerol stock to ultrafreezer at −80°C.
48
Spin down remaining portion of the cultures for 5 minutes at 4,000g using a refrigerated tabletop centrifuge that can accommodate 14-ml tubes. Decant the supernatant.

OPTIONAL: Freeze pellet at −20°C or −80°C for at least 30 minutes prior to proceeding to the next step. Freezing the pellet will simplify resuspension of bacterial pellet for DNA isolation purposes.
49
Isolate plasmid DNA using the QIAprep spin miniprep kit according to manufacturer’s instruction, and a tabletop microcentrifuge that can accommodate 1.7-ml tubes.
50
Elute DNA in 50 μl of EB buffer. Measure the concentration using a spectrophotometer.

Verification of cloned recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster

51
Verify the identity of assembled plasmid via restriction enzyme DNA fingerprinting, followed by agarose gel electrophoresis and gel documentation. Digest 400 ng of the plasmids with the restriction enzyme XhoI (Plasmids containing recombineering templates for fluorescent protein tagging) or XbaI (Plasmids containing recombineering templates for selection genetics) resulting in 2 distinct bands corresponding to the plasmid backbone (pR6Kγ-A1^Spm) and cloned insert (DNA part):
- 400 ng of plasmid
- 2.5 μl of rCutSmart buffer
- 0.5 μl of XhoI (Plasmids containing recombineering templates for fluorescent protein tagging) or XbaI (Plasmids containing recombineering templates for selection genetics)
- MilliQ H₂O up to 25 μl
  
  Perform uncut digestion in parallel:
- 400 ng of plasmid
- MilliQ H₂O up to 25 μl
  
  We recommend using a DNA manipulation software package to simulate the enzyme digest before performing the experimental digestions. We use the SnapGene software (SnapGene, https://www.snapgene.com/) to help us plan our digests, though several alternatives are available.
52
Digest plasmids at 37°C for at least one hour.
53
After digestion, briefly vortex and spin down samples.
54
Add DNA loading buffer.
55
Run your samples on a 1% agarose gel and after visualization using a gel documentation system, confirm by comparing the actual enzyme digest to the one in silico predicted by Snapgene.
56
Using a commercial service, confirm plasmids by Sanger DNA sequencing using the DNA sequencing primers, R6K-SeqFOR and R6K-SeqREV (see Step 11 for primer sequences), to ensure that no errors are present that were potentially introduced during PCR amplification.
57
Separate DNA samples and glycerol stocks of confirmed synthetically assembled DNA constructs for long term storage at −20°C and −80°C, respectively.
58
These are plasmids pCsp-EGFP-N and pCsp-Kan/G418 encoding recombineering templates for modifying the CH322–06D09 P[acman] BAC clone that covers Csp with an N-terminal EGFP tag for gene expression analysis and a G418 sulfate-selectable marker for selection transgenesis, respectively.

Preparation of recombineering templates to perform serial recombineering cloning to build both selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster

59
Digest plasmids encoding recombineering templates for fluorescent protein tagging (pCsp-EGFP-N) and selection genetics (pCsp-Kan/G418) to release the recombineering templates according to the following recipe:
- 800 ng of plasmid (pCsp-EGFP-N or pCsp-Kan/G418)
- 2.5 μl of rCutSmart buffer
- 1 μl of XhoI (pCsp-EGFP-N) or XbaI (pCsp-Kan/G418)
- MilliQ H₂O up to 25 μl
60
Digest plasmids at 37°C for 90 minutes.
61
After digestion, briefly vortex and spin down samples.
62
Do a post-enzymatic reaction DNA clean-up using the DNA Clean and Concentrator kit according to manufacturer’s instruction and elute sample in 20 μl of EB Buffer.

Further purification steps to remove vector backbone are not required since the pR6Kγ-A1^Spm plasmid backbone cannot replicate in the recombineering strain which doesn’t encode the “PIR” protein required for maintenance of R6Kγ plasmids.
63
Resulting products are the recombineering templates for fluorescent protein tagging (Csp-EGFP-N) and selection genetics (Csp-Kan/G418). Store sample at −20°C until needed in Basic Protocol 3.

BASIC PROTOCOL 2