Abstract
Transgenes with genomic DNA fragments that encompass genes of interest are the gold standard for complementing null alleles in rescue experiments in the fruit fly Drosophila melanogaster. Of particular interest are genomic DNA clones available as bacterial artificial chromosomes (BACs) or fosmids from publicly available genomic DNA libraries. Genes contained within BAC and fosmid clones can be easily modified by recombineering cloning to insert peptide or protein tags to localize, visualize, or manipulate gene products, and to create point mutations or deletions for structure-function analysis of the inserted genes. However, since transgenesis efficiency is inversely correlated with transgene size, obtaining transgenic animals for increasingly larger BAC and fosmid clones requires increasingly laborious screening efforts using the transgenesis marker commonly used for these transgenes, the dominant eye color marker white+. We recently described a drug-based selectable genetic platform for Drosophila melanogaster, which included four resistance markers that allow direct selection of transgenic animals, eliminating the need to identify transgenic progeny by laborious phenotypic screening. By integrating these resistance markers into BAC transgenes, we were able to isolate animals containing large transgenes by direct selection, avoiding laborious screening. Here we present procedures on how to upgrade BAC clones by serial recombineering cloning to build both selectable and tagged BAC transgenes, for selection transgenesis and functional gene analysis, respectively. We illustrate these procedures using a BAC clone encompassing the gene encoding the synaptic versicle protein Cysteine string protein. We demonstrate that the modified BAC clone, serially recombineered with a selectable marker for selection transgenesis and an N-terminal green fluorescent protein tag for gene expression analysis, is functional by showing the expression pattern obtained after successful selection transgenesis. The protocols cover: 1) cloning and preparation of the recombineering templates needed for serial recombineering cloning to incorporate selectable markers and protein tags; 2) preparing electrocompetent cells needed to perform serial recombineering cloning; and 3) the serial recombineering workflow to generate both selectable and tagged genomic BAC reporter transgenes for selection transgenesis and functional gene analysis in Drosophila melanogaster. The protocols we describe can be easily adapted to incorporate any of four selectable markers, protein tags or any other modification for structure-function analysis of the genes present within any of the BAC or fosmid clones. A protocol for generating transgenic animals using serially recombineered BAC clones is presented in an accompanying Current Protocols article (Current Protocols #1).
Basic Protocol 1:
Cloning and preparation of recombineering templates used for serial recombineering cloning.
Basic Protocol 2:
Making electrocompetent cells of the bacterial strains used to perform serial recombineering cloning or induction of plasmid copy number.
Basic Protocol 3:
Serial recombineering cloning to generate both selectable and tagged genomic P[acman] BAC reporter transgenes for selection transgenesis and gene expression analysis in Drosophila melanogaster.
Keywords: Serial recombineering cloning, Selection, Bacterial Artificial Chromosome, P[acman], Transgenesis, Drosophila melanogaster, gene expression analysis
INTRODUCTION
The gold standard to prove that a null allele is responsible for specific phenotypes in any model organism, including Drosophila melanogaster, is to complement, or “rescue”, the presumably phenotype-causing mutation using a transgene containing a genomic DNA fragment that covers the candidate causal gene of interest for the observed phenotype (Venken and Bellen, 2007, 2012, 2014; Venken et al., 2011, 2016, 2006, 2009, 2010). Such transgenic clones can be engineered (Venken et al., 2006; Venken and Bellen, 2007), or chosen from genome-wide libraries (Ejsmont et al., 2009; Venken et al., 2009), to contain sufficient endogenous genomic context to recapitulate most if not all developmental aspects of the gene of interest across space and time (Venken et al., 2006; Venken and Bellen, 2007; Venken et al., 2009; Ejsmont et al., 2009). Ideally, such transgenes revert most if not all mutant phenotypes caused by the underlying null genotype, and therefore provide proof the null genotype is responsible for most if not all observed phenotypes (Venken et al., 2006, 2009, 2010).
A useful resource for such genomic rescue experiments are genomic DNA clones available as bacterial artificial chromosomes (BACs). Three publicly available libraries exist: the CHORI-322 and the CHORI-321 P[acman] BAC libraries consisting of genomic DNA clones with insert sizes averaging 21 and 83 kilobases respectively (Venken et al., 2009), and the FlyFos fosmid library consisting of genomic DNA clones with insert sizes averaging 36 kilobases (Ejsmont et al., 2009). These libraries represent a 15-fold coverage of the fly genome and cover more than 95% of annotated genes in the reference genome (Venken et al., 2009; Ejsmont et al., 2009). Moreover, genes contained within P[acman] BACs and FlyFos fosmid clones can be easily modified by recombineering cloning (Thomason et al., 2014, 2007; Sharan et al., 2009). Commonly used modifications are the insertion of tags for protein manipulation, localization, and visualization (Venken et al., 2009, 2008; Ejsmont et al., 2009; Sarov et al., 2016; Avellaneda and Schnorrer, 2022; Kanca et al., 2017; Gohl et al., 2017; Venken and Bellen, 2014; Venken et al., 2016; Dunst and Tomancak, 2019), as well as the incorporation of point mutations or deletions for structure-function analyses (Pepple et al., 2008; Leonardi et al., 2011; Leonardi and Jafar-Nejad, 2014). However, the efficiency of transgenesis with P[acman] BAC and FlyFos fosmid clones decreases as their size increases making it more laborious to screen for the commonly used dominant eye color marker white+ (Venken et al., 2006, 2009, 2010; Ejsmont et al., 2009).
Recently, we developed a drug-based selection transgenesis strategy that eliminates screening for the white+ marker, by coupling a drug resistance marker to transgenes (Matinyan et al., 2021a, 2021b), including P[acman] BAC clones (Matinyan et al., 2021b). This strategy introduced four different drug resistance markers adapted for use in Drosophila melanogaster. Each marker confers robust and exclusive resistance to its corresponding drug, one of four commonly-used, universally toxic antibiotics (Matinyan et al., 2021b). The four selectable markers encompass the genes encoding Neomycin phosphotransferase II, Puromycin HCl N-acetyltransferase, Blasticidin S-resistance, and Hygromycin B phosphotransferase, and provide animal resistance against G418 sulfate, Puromycin HCl, Blasticidin S, and Hygromycin B, respectively (Matinyan et al., 2021b). Since selection-based transgenic strategies provide an easier and more cost-effective method for isolating low-frequency transgesis events when working with genomic P[acman] BAC clones, integrating these resistance markers into P[acman] BAC transgenes allowed us to isolate animals containing these transgenes by direct selection, avoiding laborious screening (Matinyan et al., 2021b). These results demonstrate that the incorporation of resistance markers into P[acman] BAC transgenes facilitates the isolation of these often difficult-to-obtain transgenic animals (Matinyan et al., 2021b).
In this work, we describe how to implement serial recombineering to build both selectable and tagged genomic P[acman] BAC reporter transgenes for selection transgenesis and functional gene analysis in Drosophila melanogaster. We illustrate these protocols using a P[acman] BAC clone that covers the gene that encodes the synaptic versicle protein Cysteine string protein, Csp (Figure 1). From the available clones present within the CHORI-321 (83-kilobase average insert) and CHORI-322 (21-kilobase average insert) P[acman] BAC libraries, we selected a suitable P[acman] BAC clone that covers the Csp gene surrounded by at least 5 kilobases of upstream and downstream regulatory sequence (CH322–06D09) (Figure 1A) (Venken et al., 2009). We modified this clone using recombineering cloning (Figure 1B) to add an N-terminal enhanced green fluorescent protein (EGFP) tag for gene expression analysis and a G418 sulfate-selectable marker for selection transgenesis.
Figure 1. P[acman] BAC libraries for recombineering-mediated modifications of large transgenes for gene analysis in Drosophila melanogaster.

(A) P[acman] BAC clones covering the genetic locus encoding the synaptic vesicle protein Cysteine string protein (Csp) as an example. A 60-kb Drosophila melanogaster genome interval covering the gene that encodes the synaptic vesicle protein Cysteine string protein (Csp), shows clones from both the CHORI-322 (top, shown in dark green) and CHORI-321 (bottom, shown in light green) P[acman] BAC libraries with average insert sizes of 21 and 83 kilobases, respectively. Clone CH322–06D09 (shown in dark blue), containing Csp, was picked for serial recombineering cloning to build a selectable, tagged genomic P[acman] BAC reporter transgene for gene expression analysis of Csp. Genes contained within this 60-kb region, and transcript variants just for Csp, are indicated below the P[acman] BAC clones. This genome interval was obtained through the webpage for Csp in FlyBase, version FB2022_04 (https://flybase.org/reports/FBgn0004179) (Gramates et al., 2022), and linking to the Gbrowse genome map of Csp. After selecting a 60-kb genome interval, this interval was exported as an editable svg image and edited using Adobe Illustrator, Adobe Creative Cloud. (B) P[acman] BAC modifications by recombineering cloning: tagging the synaptic vesicle protein Cysteine string protein (Csp) with a fluorescent protein for expression analysis. Simplified schematic overview illustrating P[acman] BAC modifications by recombineering cloning of clone CH322–06D09 to generate an N-terminally EGFP-tagged version of the synaptic vesicle protein Csp for downstream expression analysis.
We provide step-by-step protocols on how to build both selectable and tagged genomic P[acman] BAC reporter transgenes for selection transgenesis and functional gene analysis in Drosophila melanogaster, using P[acman] BAC clone CH322–06D09 covering Csp as an example (Venken et al., 2009) (Figure 2). We begin by describing how to clone and prepare recombineering templates needed for serial recombineering cloning to incorporate selectable markers and protein tags during the workflow, focused on N-terminal tagging of Csp using the EGFP tag for gene expression analysis and the G418 sulfate-selectable marker for selection transgenesis (Basic Protocol 1). We then describe how to make electrocompetent cells for the EL350 bacterial strain that provides orthogonally inducible recombineering and Cre recombinase functions needed to perform the serial recombineering workflow, as well as the EPI300 bacterial strain that allows plasmid copy number toggling between very low (basal state) and high (after induction using a simple sugar solution) copy numbers (Basic Protocol 2). Finally, we explain the serial recombineering workflow itself to generate a G418 sulfate-selectable and N-terminal green fluorescent protein tagged genomic P[acman] BAC reporter transgene for gene expression analysis of Csp in Drosophila melanogaster (Basic Protocol 3). The protocols we present can be easily adapted to incorporate any of the four selectable markers, different protein tags or any other modification for structure-function analysis of the genes present within any P[acman] BAC (Venken et al., 2009) or FlyFos fosmid (Ejsmont et al., 2009) clone. By the end of this protocol, the user should be able to modify P[acman] BACs starting from original BACs to modified versions for sophisticated genetic applications. A protocol to generate transgenic animals using modified P[acman] BAC clones, as described here, is presented in an accompanying Current Protocols article (Current Protocols #1).
Figure 2. Simplified schematic overview of the experimental steps during serial recombineering cloning to build selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster: the synaptic vesicle protein Cysteine string protein (Csp) as an example.

The first step in this protocol describes how to decide on homology arms for recombineering followed by cloning those homology arms to make recombineering templates that are then prepared for recombineering (Basic Protocol 1). First, the user selects homology arms where recombineering needs to occur within the P[acman] BAC clone encompassing Csp to make both upgrades: one location surrounding the chloramphenicol marker (ChlR) embedded in the P[acman] clone to make the clone selectable for downstream Drosophila transgenesis (see Current Protocols 1#), and a second location to generate a tagged version of the gene of interest for downstream expression analysis, N-terminally (as shown for Csp) or C-terminally (not shown). Next, the selected homology arms for recombineering are cloned to make the necessary recombineering templates: one pair of homology arms for recombineering is cloned together with a cassette for fluorescent protein tagging (see Figure 3A) to generate a plasmid encoding the “fluorescent protein tagging” recombineering template (see Figure 4), while the second pair of homology arms for recombineering is cloned together with a cassette for selection genetics (see Figure 3B) to generate a plasmid encoding the “selection genetics” recombineering template (see Figure 5). After verification by Sanger DNA sequencing, plasmids encoding both recombineering templates are prepared and linearized to release the templates from their respective plasmid backbones for downstream recombineering. The second step in this protocol describes how to prepare electrocompetent cells for the different bacterial strains needed during the course of this protocol, including the EL350 strain that provides orthogonally inducible recombineering and Cre recombinase functions needed during the different steps of the serial recombineering protocol, as well as the EPI300 strain that allows plasmid copy number induction to produce a high concentration of BAC clone plasmid (see below) (Basic Protocol 2 and Figure 6). The third and final step in this protocol describes the serial recombineering protocol (Basic Protocol 3, Figure 7 and Figure 8). A first round of modifications (done by recombineering) upgrades the P[acman] BAC clone with the Csp gene using the linearized “fluorescent protein tagging” recombineering template encoding the N-terminal EGFP tag linked to the ampicillin resistance marker (AmpR) flanked by LoxP sites. A second round of modifications (done by recombineering as well) upgrades the clone using the linearized “selection genetics” recombineering template encoding the selection marker that provides resistance to kanamycin (KanR) in bacteria for bacterial clone selection and G418 sulfate (G418R) in flies for downstream selectable transgenesis (see Current Protocols 1#). During the last round of modifications, Cre recombinase removes the floxed ampicillin marker leaving just the N-terminal EGFP tag plus peptide linker behind, resulting in the final selectable, tagged genomic P[acman] BAC reporter plasmid for Csp. The final plasmid is then isolated from the EL350 strain and transformed in electrocompetent EPI300 cells prepared as described above (Basic Protocol 2 and Figure 6) to induce plasmid copy number towards high copy to facilitate plasmid purification for downstream selectable transgenesis and gene expression analysis of the Csp gene, respectively (Figure 9).
BASIC PROTOCOL 1
Cloning and preparation of recombineering templates used for serial recombineering cloning.
Introductory paragraph
This protocol describes cloning and template preparation needed for serial recombineering cloning to build selectable, tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster. We will first explain where to obtain and how to prepare plasmids containing cassettes for fluorescent protein tagging and selection genetics in Drosophila melanogaster (Table 1). For this purpose, we generated four plasmids for fluorescent protein tagging as recombineering templates to modify the N- or C-terminus of a protein with a green (EGFP) or red (mCherry) fluorescent protein (Figure 3A) and four plasmids for selection genetics in Drosophila melanogaster, as recombineering templates to confer resistance to a different antibiotic (Figure 3B). The selection cassettes contain the KanR/G418R, PuroR, BlastR, or HygroR resistance markers that encode Neomycin phosphotransferase II (nptII), Puromycin HCl N-acetyltransferase (pac), Blasticidin S deaminase (bsr), and Hygromycin B phosphotransferase (hph), respectively. They can be used to select with kanamycin in bacteria or G418 sulfate in flies, or with Puromycin HCl, Blasticidin S, or Hygromycin B in both bacteria and flies. Next, we will explain how to perform PCR amplification of the “fluorescent protein tagging” (Figure 4) and “selection genetics” (Figure 5) cassettes using primers that add sequences homologous to the target regions in the P[acman] BAC for the recombineering event. We will then describe cloning and verification of these recombineering templates in a plasmid with a conditional origin of replication that aids recombineering (see Basic Protocol 3) using GoldenBraid 2.0 (GB2.0) synthetic assembly cloning (Sarrion-Perdigones et al., 2013, 2019; Sarrion-Perdigones et al., 2020; Sarrion-Perdigones et al., 2022; Matinyan et al., 2021b). Finally, we will explain how to prepare the recombineering templates (Figure 4 and Figure 5), that will then be used for serial recombineering cloning to generate both selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis (see Basic Protocol 3). We will apply the principles described above to modify the P[acman] BAC clone CH322–06D09 covering the Cysteine string protein gene (Csp) with an N-terminal EGFP tag and a G418 sulfate-selectable marker. By the end of this protocol, the user should understand how to create recombineering templates that can be used to generate modifications in P[acman] BAC plasmids using serial recombineering cloning.
Table 1. Summary of vectors described in this work.
Plasmid name, brief description, vector backbone, vector backbone resistance, Addgene stock number, and bibliographic reference are indicated for all plasmids mentioned in this work.
| Plasmid name | Description | Vector backbone1 | Vector backbone resistance | Addgene2 | Reference |
|---|---|---|---|---|---|
| pEGFP-N-Terminal-Tagging | PCR template for the EGFP N-terminal tagging cassette | ColE1 | KanamycinR, AmpicillinR | 165868 | (Matinyan et al., 2021b) |
| pEGFP-C-Terminal-Tagging | PCR template for the EGFP C-terminal tagging cassette | ColE1 | KanamycinR, AmpicillinR | 165869 | (Matinyan et al., 2021b) |
| pmCherry-N-Terminal-Tagging | PCR template for the mCherry N-terminal tagging cassette | ColE1 | KanamycinR, AmpicillinR | 165870 | (Matinyan et al., 2021b) |
| pmCherry-C-Terminal-Tagging | PCR template for the mCherry C-terminal tagging cassette | ColE1 | KanamycinR, AmpicillinR | 165871 | (Matinyan et al., 2021b) |
| pHSP70B-CP6-nptII | PCR template for the G418R resistance marker encoding the protein Neomycin phosphotransferase II (nptII) that can be selected for using Kanamycin (Bacteria) and G418 sulfate (Flies) | ColE1 | KanamycinR | 165876 | (Matinyan et al., 2021b) |
| pHSP70B-CP6-pac | PCR template for the PuroR resistance marker encoding the protein Puromycin HCl N-acetyltransferase (pac) that can be selected for using Puromycin HCl (Bacteria and flies) | ColE1 | KanamycinR, Puromycin HClR | 165877 | (Matinyan et al., 2021b) |
| pHSP70B-CP6-bsr | PCR template for the BlastR resistance marker encoding the protein Blasticidin S deaminase (bsr) that can be selected for using Blasticidin S (Bacteria and flies) | ColE1 | KanamycinR | 165878 | (Matinyan et al., 2021b) |
| pHSP70B-CP6-hph | PCR template for the HygroR resistance marker encoding the protein Hygromycin B phosphotransferase (hph) that can be selected for using Hygromycin B (Bacteria and flies) | ColE1 | KanamycinR | 165879 | (Matinyan et al., 2021b) |
| pR6Kg-A1 spm | Conditionally replicative plasmid backbone for GoldenBraid 2.0 cloning | R6Kγ | SpectinomycinR | 165866 | (Matinyan et al., 2021b) |
| P[acman] BAC CH322–06D09 | P[acman] BAC clone containing the genomic locus encompassing the gene Cysteine string protein (Csp) | BAC/OriV | ChloramphenicolR | NA | (Venken et al., 2009) |
ColE1, high-copy number plasmid backbone; R6Kγ, conditionally replicative plasmid backbone requiring the PIR1 or PIR2 Escherichia coli strain for plasmid maintenance; BAC/OriV, conditionally amplifiable copy number plasmid backbone requiring the EPI300 Escherichia coli strain for plasmid copy number control.
NA, not applicable.
Figure 3. Schematic overview of plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster.

(A) Plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging. Overview of plasmids with “fluorescent protein tagging” cassettes to generate recombineering templates for modifying either the N- (Left) or C-terminus (Right) of a protein encoded by the gene of interest covered by a P[acman] BAC clone, using either the green fluorescent protein EGFP (Top) or the red fluorescent protein mCherry (Bottom) (see Figure 4). (B) Plasmids containing cassettes to generate recombineering templates for selection genetics. Overview of plasmids with one of four different “selection genetics” cassettes to generate recombineering templates for selection genetics in Drosophila melanogaster, each conferring resistance to a different antibiotic: the KanR/G418R resistance marker encodes the protein Neomycin phosphotransferase II (nptII) that can be used for selection with kanamycin in bacteria or G418 sulfate in flies (Top left), the PuroR resistance marker encodes the protein Puromycin HCl N-acetyltransferase (pac) for selection with Puromycin HCl in both bacteria and flies (Top right), the BlastR resistance marker encodes the protein Blasticidin S deaminase (bsr) for selection with Blasticidin S in both bacteria and flies (Bottom left), and the HygroR resistance marker encodes the protein Hygromycin B phosphotransferase (hph) for selection with Hygromycin B resistance in both bacteria and flies (Bottom right) (see Figure 5). Each marker contains a fusion promoter with eukaryotic and prokaryotic activities, a gene encoding the selection/resistance marker, and the minimal terminator of the thymidine kinase gene of the herpes simplex virus. The fusion promoter consists of the eukaryotic promoter of the Drosophila melanogaster Hsp70 gene for optimal transcription in flies, followed by the prokaryotic synthetic Escherichia coli CP6 promoter for optimal transcription in bacteria. At the 3’ end of the CP6 promoter are a prokaryotic Shine-Dalgarno sequence for optimal translational in bacteria, followed by a eukaryotic Kozak/Cavener sequence for optimal translational in flies. Hence, for bacterial cloning purposes, CP6-stimulated transcription and Shine-Dalgarno-stimulated translation of the resistance marker provides bacterial selection (see this Current Protocols and Current Protocols #2), while for fly genetics purposes, Hsp70-stimulated transcription and Kozak/Cavener-stimulated translation of the resistance marker provides larval and fly selection (see Current Protocols 1#).
Figure 4. Cloning and preparation of recombineering templates for fluorescent protein tagging by serial recombineering cloning to build both selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster.

(A) Selection of homology arms where recombineering for fluorescent protein tagging needs to occur in the P[acman] BAC plasmid. Homology arms for recombineering templates encoding N- or C-terminal fluorescent protein tags are designed to integrate those tags between the start codon (“ATG”) and the next codon (shown), or the last protein-encoding codon and one of three stop codons (“TGA”, “TAG”, or “TAA”) (not shown), respectively. The schematic illustrates the selection of homology arms for N-terminal tagging of the gene encoding the synaptic versicle protein Cysteine string protein, Csp, within P[acman] BAC clone CH322–06D09 (Venken et al., 2009). (B) Generation of recombineering templates for fluorescent protein tagging by 2-step PCR & cloning. Cloning of recombineering templates with fluorescent protein tags for modifying the N- or C-terminus of a gene of interest begins with a primary PCR amplification of the desired cassette from one of the pre-built plasmids for fluorescent protein tagging (see Figure 3A) using primers with 20 bp of PCR-homology to the plasmid and 50 bp recombineering-homology (see A), producing a fluorescent protein tag linked to the Ampicillin resistance marker (AmpR) flanked by LoxP sites, all of it bordered by 50 bp recombineering homology arms homologous to the sequence where the tag needs to be integrated (see A), as illustrated for the EGFP tag for N-terminal tagging. The product from the primary PCR amplification is then further amplified during a secondary PCR amplification, using primers with 20 to 25 bp of PCR-homology to the amplified primary PCR product and 21 bp overhangs that will include XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template as well as sequence required for GoldenBraid2.0 (GB2.0) cloning of the PCR-amplified product into plasmid pR6Kγ-A1Spm. Plasmid pR6Kγ-A1Spm contains a conditional origin of replication, R6Kγ, requiring a specialized bacterial Escherichia coli strain encoding the “PIR” protein required for plasmid maintenance. The secondary PCR-amplified product is cloned by GB2.0 cloning in plasmid pR6Kγ-A1Spm, by combining PCR product and plasmid pR6Kγ-A1Spm, with the Type IIs restriction enzyme BsaI, T4 DNA ligase, and 10x T4 DNA ligase buffer. The assembly protocol cycles 25 to 50 times between 37°C (favoring cutting by BsaI) and 16°C (favoring ligation by T4 DNA ligase). After overnight selection on bacterial plates (spectinomycin for pR6Kγ-A1Spm), assembled plasmids are identified as white colonies that are characterized further by restriction enzyme fingerprinting and Sanger DNA sequencing (see Text), while religated plasmid products are blue due to the presence of the colorimetric LacZ α-fragment. A correct clone is then linearized using XhoI to release the recombineering template, encoding the N-terminal EGFP tag linked to the Ampicillin resistance marker (AmpR) flanked by LoxP sites for fluorescent protein tagging, from the pR6Kγ-A1Spm plasmid backbone. Further purification steps are not required since the pR6Kγ-A1Spm plasmid backbone cannot replicate in the recombineering strain that doesn’t encode the “PIR” protein required for maintenance of R6Kγ plasmids.
Figure 5. Cloning and preparation of recombineering templates for selection genetics by serial recombineering cloning to build selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster.

(A) Selection of homology arms where recombineering for selection genetics needs to occur in the P[acman] BAC plasmid. Homology arms for recombineering templates encoding any of the resistance markers for selection genetics are designed to replace the chloramphenicol promoter and resistance marker present in the P[acman] BAC plasmid backbone used to create both the CHORI-322 and CHORI-321 P[acman] BAC libraries (Venken et al., 2009). (B) Generation of recombineering templates for selection genetics by 2-step PCR & cloning. Cloning of recombineering templates with selection markers for selection genetics in Drosophila melanogaster begins with a primary PCR amplification of the desired cassette from one of the pre-built plasmids for selection genetics (see Figure 3B) using primers with 20 bp of PCR-homology to the plasmid and 50 bp recombineering-homology (see A), producing a selection/resistance marker flanked by recombineering homology arms homologous to the sequence within the P[acman] BAC plasmid backbone where the marker needs to be integrated (see A), as illustrated for any of the selection/resistance marker cassettes. Since all cassettes for selection genetics start with the Hsp70 promoter from Drosophila melanogaster and end with the minimal polyadenylation signal of the thymidine kinase gene from herpes simplex virus (see Figure 3B), this exact strategy can be applied to all selection/resistance markers. The product from the primary PCR amplification is further amplified during a secondary PCR amplification, using primers with 20 to 23 bp of PCR-homology to the amplified primary PCR product and 21 bp overhangs that will include XbaI restriction sites for downstream release of the “selection genetics” recombineering template as well as sequence required for GoldenBraid 2.0 (GB2.0) cloning of the PCR product into the plasmid pR6Kγ-A1Spm. Plasmid pR6Kγ-A1Spm contains a conditional origin of replication, R6Kγ, requiring a specialized bacterial Escherichia coli strain encoding the “PIR” protein required for plasmid maintenance. The secondary PCR-amplified product is cloned by GB2.0 cloning in plasmid pR6Kγ-A1Spm, by combining PCR product and plasmid pR6Kγ-A1Spm, with the Type IIs restriction enzyme BsaI, T4 DNA ligase, and 10x T4 DNA ligase buffer. The assembly protocol cycles 25 to 50 times between 37°C (favoring cutting by BsaI) and 16°C (favoring ligation by T4 DNA ligase). After overnight selection on bacterial plates (spectinomycin for pR6Kγ-A1Spm), assembled plasmids are identified as white colonies that are characterized further by restriction enzyme fingerprinting and Sanger DNA sequencing (see Text), while religated plasmid products are blue due to the presence of the colorimetric LacZ α-fragment. A correct clone is then linearized using XbaI to release the recombineering template encoding the resistance marker for selection genetics, from the pR6Kγ-A1Spm plasmid backbone. Further purification steps are not required since the pR6Kγ-A1Spm plasmid backbone cannot replicate in the recombineering strain that doesn’t encode the “PIR” protein required for maintenance of R6Kγ plasmids.
Materials
Reagents, solutions, and starting samples or test organisms/cells
- 1x of each plasmid containing a cassette to generate recombineering templates for fluorescent protein tagging (Figure 3A):
- pEGFP-N-Terminal-Tagging (Addgene, cat. no. 165868) (Matinyan et al., 2021b) (Table 1)
- pEGFP-C-Terminal-Tagging (Addgene, cat. no. 165869) (Matinyan et al., 2021b) (Table 1)
- pmCherry-N-Terminal-Tagging (Addgene, cat. no. 165870) (Matinyan et al., 2021b) (Table 1)
- pmCherry-C-Terminal-Tagging (Addgene, cat. no. 165871) (Matinyan et al., 2021b) (Table 1)
- 1x of each plasmid containing a cassette to generate recombineering templates for selection genetics (Figure 3B):
- pHSP70B-CP6-nptII (Addgene, cat. no. 165876) (Matinyan et al., 2021b) (Table 1)
- pHSP70B-CP6-pac (Addgene, cat. no. 165877) (Matinyan et al., 2021b) (Table 1)
- pHSP70B-CP6-bsr (Addgene, cat. no. 165878) (Matinyan et al., 2021b) (Table 1)
- pHSP70B-CP6-hph (Addgene, cat. no. 165879) (Matinyan et al., 2021b) (Table 1)
- Standard cloning vector backbone (Figure 4 and Figure 5) for GB2.0 synthetic assembly cloning (Sarrion-Perdigones et al., 2013, 2019; Sarrion-Perdigones et al., 2020; Sarrion-Perdigones et al., 2022; Matinyan et al., 2021b):
- pGB2-R6Kγ-A1Spm (Addgene 165866) (Matinyan et al., 2021b) (Table 1)
1xLB agar (see Reagents and Solutions section for recipe)
Kanamycin sulfate powder (VWR, cat. no. 45000–640) to make a 1,000x stock solution in MilliQ H2O, followed by filter sterilization (30 mg/ml) (Table 2)
MilliQ H2O, sterilized by autoclaving
-
Ampicillin powder (VWR, cat. no. IC19014605) to make a 1,000x stock solution in 50% EtOH diluted with MilliQ H2O, followed by filter sterilization (100 mg/ml) (Table 2)
Ampicillin powder is first dissolved in ½ volume of MilliQ H2O and then diluted with ½ volume of 100% EtOH
Absolute ethanol (VWR, cat. no. 89125–188)
Puromycin dihydrochloride, powder (VWR, cat. no. 97064–280) to make a 1,000x stock solution in MilliQ H2O, followed by filter sterilization (100 mg/ml) (Table 2)
Blasticidin S hydrochloride, powder (VWR, cat. no. 71002–676) to make a 1,000x stock solution in MilliQ H2O, followed by filter sterilization (100 mg/ml) (Table 2)
Hygromycin B, powder (VWR, cat. no. AAJ60681–03) to make a 1,000x stock solution in MilliQ H2O, followed by filter sterilization (75 mg/ml) (Table 2)
Spectinomycin sulphate powder (VWR, cat. no. IC0215899301) to make a 1,000x stock solution in MilliQ H2O, followed by filter sterilization (50 mg/ml) (Table 2)
2xLB-0.5 medium (see Reagents and Solutions section for recipe)
Glycerol (Fisher Scientific, cat. no. BP229–1) to make a 40% glycerol solution in MilliQ H2O, sterilized by autoclaving
QIAprep spin miniprep kit (QIAGEN, cat. no. 27106) for plasmid purification
10x rCutSmart Buffer for restriction enzyme digestions (NEB B6004S)
Restriction enzymes for restriction enzyme DNA fingerprinting: EcoRI-HF (New England Biolabs, cat. no. R3101L) and BsaI-HFv2 (New England Biolabs, cat. no. R3733L)
Primers for Sanger DNA sequencing, see below (Sigma-Aldrich)
Custom primers for PCR amplification and synthetic assembly DNA cloning, see below (Sigma-Aldrich)
dNTP nucleotide mix (Thermo Scientific, R1121)
Phusion high-fidelity DNA polymerase and 5x Buffer HF (NEB M0350S or M0350L)
DNA Clean and Concentrator kit for purification of PCR-amplified DNA products (Zymogen D4033 or D4034)
EB buffer (10 mM Tris-Cl, pH 8.5) from QIAprep spin miniprep kit (see above)
BsaI-HFv2 restriction enzyme for synthetic assembly DNA cloning (New England Biolabs, cat. no. R3733L)
T4 DNA ligase and 10x T4 DNA ligase buffer (Promega, cat. no. M1804)
Home-made chemocompetent Escherichia coli cells (Sarrion-Perdigones et al., 2020) of the “PIR” protein-encoding TransforMax EC100D pir-116 strain (Lucigen Corporation, cat. no. EC6P095H) needed to maintain plasmids with the conditional origin of replication (R6Kγ), pGB2-R6Kγ-A1Spm (see above)
X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) powder (VWR, cat. no. 97061–648) to make a 1,000x stock solution in dimethyl sulfoxide (DMSO) (2%)
Restriction enzymes for plasmid linearization: XbaI (New England Biolabs, cat. no. R0145L), and XhoI (New England Biolabs, cat. no. R0146L).
Table 2. Summary of antibiotics used in this work.
Antibiotic name, master stock concentration, working stock concentration, and ordering information, vendor including catalog number, are indicated for all antibiotics mentioned in this work.
| Antibiotic name | Master stock concentration | Working stock concentration | Ordering information (Vendor, Catalog #) |
|---|---|---|---|
| Ampicillin | 100 mg/ml in 50% EtOH (First dissolved in ½ volume of MilliQ H2O and then diluted with ½ volume of 100% EtOH) | 100 μg/ml (High copy) 50 μg/ml (Low copy) |
VWR, cat. no. IC19014605 |
| Blasticidin S | 100 mg/ml in MilliQ H2O | 100 μg/ml | VWR, cat. no. 71002–676 |
| Chloramphenicol | 12.5 mg/ml in 100% EtOH | 12.5 μg/ml | VWR, cat. no. 45000–618 |
| Hygromycin B | 75 mg/ml in MilliQ H2O | 75 μg/ml | VWR, cat. no. AAJ6068103 |
| Kanamycin | 30 mg/ml in MilliQ H2O | 30 μg/ml (High copy) 15 μg/ml (Low copy) |
VWR, cat. no. 45000–640 |
| Puromycin | 100 mg/ml in MilliQ H2O | 100 μg/ml | VWR, cat. no. 97064–280 |
| Spectinomycin | 100 mg/ml in MilliQ H2O | 50 μg/ml | VWR, cat. no. IC0215899301 |
Hardware and instruments
Disposable inoculating loops (VWR, cat. no. 12000–806)
Bacterial plates (VWR, cat. no. 25384–092)
37°C incubator (VWR, cat. no. 89409–216)
14-ml disposable culture tubes (VWR, cat. no. 60818–689)
32°C incubator-shaker (Amerex Instruments, cat. no. 747/747R)
1.7-ml microcentrifuge tubes (VWR, cat. no. 20170–038)
Refrigerated tabletop centrifuge that can accommodate 14-ml tubes (Fisher Scientific, cat. no. 75230115)
Tabletop microcentrifuge that can accommodate 1.7-ml tubes (Fisher Scientific, cat. no. 75002435)
Spectrophotometer (DeNovix, cat. no. DS-11+)
Reagents and equipment for agarose gel electrophoresis (Voytas, 2001)
Gel documentation system
0.2-ml PCR strip tubes with individually attached caps (VWR, cat. no. 53509–304)
PCR machine (Applied Biosystems, cat. no. 4375786)
Ice bucket
Dry bead bath (Lab Armor, cat. no. 74309–706), set at 42°C for bacterial transformation
Glass spreading beads (VWR, cat. no. 26396–508)
Protocol steps
Obtaining and preparing plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster
-
1
Order the necessary plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging (pEGFP-N-Terminal-Tagging, pEGFP-C-Terminal-Tagging, pmCherry-N-Terminal-Tagging, and/or pmCherry-C-Terminal-Tagging) (Figure 3A), and selection genetics (pHSP70B-CP6-nptII, pHSP70B-CP6-pac, pHSP70B-CP6-bsr, and/or pHSP70B-CP6-hph) (Figure 3B), as well as the standard GB2.0 cloning vector backbone (pGB2-R6Kγ-A1Spm) used to clone recombineering templates for fluorescent protein tagging (Figure 4) and selection genetics (Figure 5), from Addgene (www.addgene.org). Plasmids ordered from Addgene will arrive as agar stabs.
If the necessary strains are already present in the lab, identify the glycerol stocks.
-
2Using a disposable inoculating loop, streak out each agar stab (or glycerol stock) to single colonies on bacterial plates containing 1xLB agar and the appropriate antibiotic:
- Plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging (pEGFP-N-Terminal-Tagging, pEGFP-C-Terminal-Tagging, pmCherry-N-Terminal-Tagging, and/or pmCherry-C-Terminal-Tagging): 30 μg/ml kanamycin and 100 μg/ml ampicillin.
- Plasmids containing cassettes to generate recombineering templates for selection genetics: 30 μg/ml kanamycin (pHSP70B-CP6-nptII), 100 μg/ml Puromycin HCl (pHSP70B-CP6-pac), 100 μg/ml Blasticidin S (pHSP70B-CP6-bsr), or 75 μg/ml Hygromycin B (pHSP70B-CP6-hph).
- Standard GB2.0 cloning vector backbone (pGB2-R6Kγ-A1Spm): 50 μg/ml spectinomycin.
-
3
Incubate plates overnight in a 37°C incubator.
-
4For each plasmid, pick a single colony using a disposable inoculation loop and inoculate into a 14-ml disposable culture tube containing 5 ml of 2xLB-0.5 medium supplemented with appropriate antibiotic:
- Plasmids containing cassettes to generate recombineering templates for fluorescent protein tagging (pEGFP-N-Terminal-Tagging, pEGFP-C-Terminal-Tagging, pmCherry-N-Terminal-Tagging, and/or pmCherry-C-Terminal-Tagging): 30 μg/ml kanamycin and 100 μg/ml ampicillin.
- Plasmids containing cassettes to generate recombineering templates for selection genetics: 30 μg/ml kanamycin (pHSP70B-CP6-nptII), 100 μg/ml Puromycin HCl (pHSP70B-CP6-pac), 100 μg/ml Blasticidin S (pHSP70B-CP6-bsr), or 75 μg/ml Hygromycin B (pHSP70B-CP6-hph).
- Standard GB2.0 cloning vector backbone (pGB2-R6Kγ-A1Spm): 50 μg/ml spectinomycin.
-
5
Grow the cultures overnight in a shaking incubator at 32°C. Angle tubes for maximal aeration.
-
6
For each plasmid for which you don’t yet have a glycerol stock, separate 0.25 ml of the overnight grown culture in a 1.7-ml microcentrifuge tube and add 0.25 ml of 40% glycerol to make a glycerol stock. Move glycerol stock to ultrafreezer at −80°C.
-
7
Spin down remaining portion of each culture for 5 minutes at 4,000 × g using a refrigerated tabletop centrifuge that can accommodate 14-ml tubes. Decant the supernatant.
OPTIONAL: Freeze pellet at −20°C or −80°C for at least 30 minutes prior to proceeding to the next step. Freezing the pellet will simplify resuspension of bacterial pellet for DNA isolation purposes.
-
8
Isolate plasmid DNA using the QIAprep spin miniprep kit according to manufacturer’s instruction, and a tabletop microcentrifuge that can accommodate 1.7-ml tubes.
-
9
Elute DNA in 50 μl of EB buffer. Measure the concentration using a spectrophotometer.
-
10Verify the identity of isolated plasmids containing cassettes to generate recombineering templates (for both fluorescent protein tagging and selection genetics) via restriction enzyme DNA fingerprinting using the restriction enzyme EcoRI-HF, followed by agarose gel electrophoresis and gel documentation, resulting in two distinct bands, one corresponding to the plasmid backbone and the other to the insert:
- 400 ng of plasmid
- 2.5 μl of rCutSmart buffer
- 0.5 μl of EcoRI-HF
-
MilliQ H2O up to 25 μlAlternatively, plasmids containing cassettes to generate recombineering templates (for both fluorescent protein tagging and selection genetics) can be verified using Sanger DNA sequencing and the following DNA sequencing primers:
- SeqFOR: CTTTTTACGGTTCCTGGCCTTTTG
- SeqREV: AATGAGCTGATTTAACAAAAATTTAACGCG
-
11Verify the identity of the standard GB2.0 cloning vector backbone (pGB2-R6Kγ-A1Spm) via restriction enzyme DNA fingerprinting using the restriction enzyme BsaI-HFv2, followed by agarose gel electrophoresis and gel documentation, resulting in two distinct bands, one corresponding to the plasmid backbone and the other band to the LacZ stuffer containing the colorimetric LacZ α-fragment (Figure 4 and Figure 5):
- 400 ng of plasmid
- 2.5 μl of rCutSmart buffer
- 0.5 μl of BsaI-HFv2
-
MilliQ H2O up to 25 μlAlternatively, plasmid pGB2-R6Kγ-A1Spm can be verified using Sanger DNA sequencing and the following DNA sequencing primers:
- R6K-SeqFOR: CTTCATCCGTTTCCACGGTGTGCG
- R6K-SeqREV: CGTTAGCCATGAGGGTTTAGTTCG
-
12
Once you have verified the identities of all plasmids, dilute each plasmid containing cassettes to generate recombineering templates (for both fluorescent protein tagging and selection genetics) with MilliQ H2O to a final concentration of 1 ng/μl. Similarly, dilute the standard GB2.0 cloning vector (pGB2-R6Kγ-A1Spm) with MilliQ H2O to a final concentration of 75 ng/μl.
Designing primers for PCR amplification of cassettes to generate recombineering templates for fluorescent protein tagging in Drosophila melanogaster
-
13Design two primer pairs to generate a recombineering template for fluorescent protein tagging by 2-step PCR amplification using one of the plasmids with a “fluorescent protein tagging” cassette as PCR template: plasmid pEGFP-N-Terminal-Tagging or pEGFP-C-Terminal-Tagging to tag a gene of interest with the fluorescent protein EGFP at the N- or C-terminus, respectively, or plasmid mCherry-N-Terminal-Tagging or mCherry-C-Terminal-Tagging to tag a gene of interest with the fluorescent protein mCherry at the N- or C-terminus, respectively (Figure 3A and Figure 4).
- For EGFP-tagging at the N-terminus of your gene of interest (GOI), design primers for primary PCR-amplification of the “EGFP-N-Terminal-Tagging” cassette as follows:
- GOI-EGFP-N-RECO-1-F: (Nx50)ATGGTGAGCAAGGGCGAGGAG
-
GOI-EGFP-N-RECO-1-R: (Nx50)GCTGCCGCCGCTACCTCCThese primers have 18 to 21 bp of PCR-homology to the plasmid with the “EGFP-N-Terminal-Tagging” cassette (shown in bold black) (Figure 3A), and 50 bp of recombineering-homology (Nx50) homologous to the sequence of your gene of interest within the P[acman] BAC plasmid backbone where the EGFP fluorescent protein tag needs to be integrated at the N-terminus (shown in bold dark purple) (Figure 4A).Design primers for secondary PCR-amplification of the primary “EGFP-N-Terminal-Tagging” PCR product as follows:
- GOI-EGFP-N-RECO-2-F: CGCGGGTCTCTGGAGCTCGAG (Nx20to25)
-
GOI-EGFP-N-RECO-2-R: CGCGGGTCTCTAGCGCTCGAG (Nx20to25)These primers have 20 to 25 bp of PCR-homology (Nx20to25) to the primary PCR-amplified “EGFP-N-Terminal-Tagging” product (shown in bold dark purple), as well as 21 bp overhangs that will add XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1Spm backbone (shown in bold light purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black) (Figure 4B).
- For EGFP-tagging at the C-terminus of your gene of interest (GOI), design primers for primary PCR-amplification of the “EGFP-C-Terminal-Tagging” cassette as follows:
- GOI-EGFP-C-RECO-1-F: (Nx50)GGAGGTTCCGGTGGAAGC
-
GOI-EGFP-C-RECO-1-R: (Nx50)TTACTTGTATAGCTCGTCCATGThese primers have 18 to 22 bp of PCR-homology to the plasmid with the “EGFP-C-Terminal-Tagging” cassette (shown in bold black) (Figure 3A), and 50 bp of recombineering-homology (Nx50) homologous to the sequence of your gene of interest within the P[acman] BAC plasmid backbone where the EGFP fluorescent protein tag needs to be integrated at the C-terminus (shown in bold purple).Design primers for secondary PCR-amplification of the primary “EGFP-C-Terminal-Tagging” PCR product as follows:
- GOI-EGFP-C-RECO-2-F: CGCGGGTCTCTGGAGCTCGAG(Nx20to25)
-
GOI-EGFP-C-RECO-2-R: CGCGGGTCTCTAGCGCTCGAG(Nx20to25)These primers have 20 to 25 bp of PCR-homology (Nx20to25) to the primary PCR-amplified “EGFP-C-Terminal-Tagging” product (shown in bold purple), as well as 21 bp overhangs that will add XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1Spm backbone (shown in bold purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black).
- For mCherry-tagging at the N-terminus of your gene of interest (GOI), design primers for primary PCR-amplification of the “mCherry-N-Terminal-Tagging” cassette as follows:
- GOI-mCherry-N-RECO-1-F: (Nx50)ATGGTGTCCAAGGGAGAAGAG
-
GOI-mCherry-N-RECO-1-R: (Nx50)GCTGCCGCCGCTACCTCCThese primers have 18 to 21 bp of PCR-homology to the plasmid with the “mCherry -N-Terminal-Tagging” cassette (shown in bold black) (Figure 3A), and 50 bp of recombineering-homology (Nx50) homologous to the sequence of your gene of interest within the P[acman] BAC plasmid backbone where the mCherry fluorescent protein tag needs to be integrated at the N-terminus (shown in bold purple).Design primers for secondary PCR-amplification of the primary “mCherry-N-Terminal-Tagging” PCR product as follows:
- GOI- mCherry-N-RECO-2-F: CGCGGGTCTCTGGAGCTCGAG (Nx20to25)
-
GOI- mCherry-N-RECO-2-R: CGCGGGTCTCTAGCGCTCGAG (Nx20to25)These primers have 20 to 25 bp of PCR-homology (Nx20to25) to the primary PCR-amplified “mCherry-N-Terminal-Tagging” product (shown in bold purple), as well as 21 bp overhangs that will add XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1Spm backbone (shown in bold purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black).
- For mCherry-tagging at the C-terminus of your gene of interest (GOI), design primers for primary PCR-amplification of the “mCherry-C-Terminal-Tagging” cassette as follows:
- GOI-mCherry-C-RECO-1-F: (Nx50)GGAGGTTCCGGTGGAAGC
-
GOI-mCherry-C-RECO-1-R: (Nx50)TTACTTGTACAGCTCATCCATGCThese primers have 18 to 22 bp of PCR-homology to the plasmid with the “mCherry-C-Terminal-Tagging” cassette (shown in bold black) (Figure 3A), and 50 bp of recombineering-homology (Nx50) homologous to the sequence of your gene of interest within the P[acman] BAC plasmid backbone where the mCherry fluorescent protein tag needs to be integrated at the C-terminus (shown in bold purple).Design primers for secondary PCR-amplification of the primary “mCherry-C-Terminal-Tagging” PCR product as follows:
- GOI-mCherry-C-RECO-2-F: CGCGGGTCTCTGGAGCTCGAG (Nx20to25)
-
GOI-mCherry-C-RECO-2-R: CGCGGGTCTCTAGCGCTCGAG (Nx20to25)These primers have 20 to 25 bp of PCR-homology (Nx20to25) to the primary PCR-amplified “mCherry-C-Terminal-Tagging” product (shown in bold purple), as well as 21 bp overhangs that will add XhoI restriction sites for downstream release of the “fluorescent protein tagging” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1Spm backbone (shown in bold purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black).
-
To apply the principles described above to a practical example, primers to modify the CH322–06D09 P[acman] BAC clone covering the gene encoding Cysteine string protein (Csp) using an N-terminal EGFP tag for gene expression analysis are as follows (Figure 4B):Primers for primary PCR-amplification of the “EGFP-N-Terminal-Tagging” cassette are:
- Csp-EGFP-N-RECO-1-F: ATCGCTAGTGCAAGTTACCCGTTCGCAGTCAAAGTGACACAGGCATCAGGATGGTGAGCAAGGGCGAGGAG
-
Csp-EGFP-N-RECO-1-R: GCACTACAAAATACTTACGACAGTTTTCTCTTGTCCATGCCAGGTGCGCTGCTGCCGCCGCTACCTCCPrimers for secondary PCR-amplification of the primary “EGFP-N-Terminal-Tagging” PCR product are:
- Csp-EGFP-N-RECO-2-F: CGCGGGTCTCTGGAGCTCGAGATCGCTAGTGCAAGTTACCCGTTCG
- Csp-EGFP-N-RECO-2-R: CGCGGGTCTCTAGCGCTCGAGGCACTACAAAATACTTACGACAG
-
14
Order all needed primers from your preferred vendor.
We order primers from Sigma, but other vendors can be pursued as well.
-
15
Once primers are received lyophilized, prepare a master and working stock of 100 μM (100 pmol/μl) and 10 μM (10 pmol/μl), respectively, for each, using MilliQ H2O.
Designing primers for PCR amplification of cassettes to generate recombineering templates for selection genetics in Drosophila melanogaster
-
16
To generate a recombineering template for selection genetics by 2-step PCR amplification using one of the plasmids with the “selection genetics” cassettes, plasmid pHSP70B-CP6-nptII, pHSP70B-CP6-pac, pHSP70B-CP6-bsr, or pHSP70B-CP6-hph (Figure 3B and Figure 5), use the following universal two primer pairs:
Primers for the primary PCR-amplification are:- Selection-RECO-1-F: CTGGTGTCCCTGTTGATACCGGGAAGCCCTGGGCCAACTTTTGGCGAAACTAGAATCCCAAAACAAACTG
-
Selection-RECO-1-R: GCGTAGCAACCAGGCGTTTAAGGGCACCAATAACTGCCTTAAAAAAAGAACAAACGACCCAACACCCGTGThese primers have 21 to 23 bp of PCR-homology to the plasmids with the “selection genetics” cassettes (shown in bold black) (Figure 3B), and 47 to 49 bp of recombineering homology to the sequence within the P[acman] BAC plasmid backbone where the marker needs to be integrated (shown in bold yellow) (Figure 5A). Since all cassettes for selection genetics start with the Hsp70 promoter from Drosophila melanogaster and end with the minimal polyadenylation signal of the thymidine kinase gene from herpes simplex virus (Figure 3B), the same primers can be used for any selection/resistance markers (KanR/G418R, PuroR, BlastR, or HygroR).Primers for the secondary PCR-amplification of the primary “selection genetics” PCR product are:
- Selection-RECO-2-F: CGCGGGTCTCTGGAGTCTAGACTGGTGTCCCTGTTGATACC
-
Selection-RECO-2-R: CGCGGGTCTCTAGCGTCTAGAGCGTAGCAACCAGGCGTTTAAGGThese primers have 20 to 23 bp of PCR-homology to the primary PCR-amplified product (shown in bold yellow), as well as 21 bp overhangs that will add XbaI restriction sites for downstream release of the “selection genetics” recombineering template (shown in bold green), a pair of inverted BsaI sites that will generate overhangs required for GB2.0 cloning into the pR6Kγ-A1Spm backbone (shown in bold purple), and 4 extra nucleotides for improved restriction enzyme binding (“CGCG”, shown in bold black) (Figure 5B).
- Since the vector backbone used to build both P[acman] BAC libraries CHORI-322 and CHORI-321, the primers shown above can also be used to modify the CH322–06D09 P[acman] BAC clone that covers Csp using a G418 sulfate-selectable marker for selection transgenesis (Figure 5B).
-
17
Order all needed primers from your preferred vendor.
-
18
Once primers are received lyophilized, prepare a master and working stock of 100 μM (100 pmol/μl) and 10 μM (10 pmol/μl), respectively, for each, using MilliQ H2O.
PCR amplification of cassettes to generate recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster
-
19Using the appropriate “RECO-1” primer pair, amplify the desired “fluorescent protein tagging” (Figure 3A) or “selection genetics” (Figure 3B) cassette by primary PCR (Figure 4B and Figure 5B), using the Phusion high-fidelity DNA polymerase by aliquoting the following components in a 0.2-ml PCR strip tube with individually attached cap:
- Diluted plasmid template DNA (1 ng/μl): 1 μl (see above)
- RECO-1-F primer (10 pmol/μl): 2.5 μl
- RECO-1-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
-
MilliQ H2O: up to 50 μlTo apply the principles described above to a practical example, the primary PCR to modify the CH322–06D09 P[acman] BAC clone covering Csp using the N-terminal EGFP tag for gene expression analysis is as follows:
- Diluted plasmid template DNA (pEGFP-N-Terminal-Tagging) (1 ng/μl): 1 μl (see above)
- Csp-EGFP-N-RECO-1-F primer (10 pmol/μl): 2.5 μl
- Csp-EGFP-N-RECO-1-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
-
MilliQ H2O: up to 50 μlThe primary PCR to modify the CH322–06D09 P[acman] BAC clone with a G418 sulfate-selectable marker for selection transgenesis is as follows:
- Diluted plasmid template DNA (pHSP70B-CP6-nptII) (1 ng/μl): 1 μl (see above)
- Selection-RECO-1-F primer (10 pmol/μl): 2.5 μl
- Selection-RECO-1-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
- MilliQ H2O: up to 50 μl
-
20Briefly spin tubes and place into a PCR machine. Amplify the “fluorescent protein tagging” (EGFP-N-Terminal-Tagging) or “selection genetics” cassettes (HSP70B-CP6-nptII) using the following cycling conditions:
- Initial denaturation at 98°C for 30 seconds
- 30 amplification cycles consisting of a denaturation step at 98°C for 10 seconds, primer annealing at 64°C for 30 seconds (calculate annealing temperature when preferred), and a polymerization step at 72° for 30 seconds/kilobase
- Final extension at 72°C for 10 minutes
- Hold at 16°C until ready for further processing
-
21
Remove amplified samples from PCR machine. Gently flick tubes followed by briefly spinning down samples.
-
22
Do a post-PCR amplification DNA clean-up using the DNA Clean and Concentrator kit according to manufacturer’s instruction and elute sample in 20 μl of EB Buffer.
-
23
Measure the DNA concentration using a spectrophotometer.
-
24
Check 2 μl of purified primary “fluorescent protein tagging” (EGFP-N-Terminal-Tagging) and “selection genetics” (HSP70B-CP6-nptII) PCR-amplified cassettes using agarose gel electrophoresis and gel documentation to verify fragment integrity and size.
-
25
The resulting primary PCR products are GOI-EGFP-N-Terminal-Tagging-1 and GOI-HSP70B-CP6-nptII-1.
For Csp, the resulting primary PCR products are Csp-EGFP-N-Terminal-Tagging-1 and Csp-HSP70B-CP6-nptII-1.
-
26
Make a diluted aliquot of PCR product(s) to a final concentration of 1 ng/μl.
-
27Using the appropriate “RECO-2” primer pair, amplify the obtained primary “fluorescent protein tagging” (GOI-EGFP-N-Terminal-Tagging-1) (Figure 4B) or “selection genetics” (GOI-HSP70B-CP6-nptII-1) (Figure 5B) PCR-amplified product by secondary PCR (Figure 4B and Figure 5B), using the Phusion high-fidelity DNA polymerase by aliquoting the following components in a 0.2-ml PCR strip tube with individually attached cap:
- Diluted primary PCR product (1 ng/μl): 1 μl
- RECO-2-F primer (10 pmol/μl): 2.5 μl
- RECO-2-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
-
MilliQ H2O: up to 50 μlIn our example, the secondary PCR to modify the CH322–06D09 P[acman] BAC clone that covers Csp using the N-terminal EGFP tag is as follows:
- Diluted primary PCR product (Csp-EGFP-N-Terminal-Tagging-1) (1 ng/μl): 1 μl
- Csp-EGFP-N-RECO-2-F primer (10 pmol/μl): 2.5 μl
- Csp-EGFP-N-RECO-2-Rprimer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
-
MilliQ H2O: up to 50 μlThe secondary PCR to modify the CH322–06D09 P[acman] BAC clone with a G418 sulfate-selectable marker for selection transgenesis is as follows:
- Diluted primary PCR product (Csp-HSP70B-CP6-nptII-1) (1 ng/μl): 1 μl
- Selection-RECO-2-F primer (10 pmol/μl): 2.5 μl
- Selection-RECO-2-R primer (10 pmol/μl): 2.5 μl
- dNTP nucleotide mix: 1 μl
- Phusion high-fidelity DNA polymerase: 0.5 μl
- 5x Buffer HF: 10 μl
- MilliQ H2O: up to 50 μl
-
28Briefly spin tubes and place into PCR machine. Amplify primary “fluorescent protein tagging” or “selection genetics” PCR product using the following cycling conditions:
- Initial denaturation at 98°C for 30 seconds
- 30 amplification cycles consisting of a denaturation step at 98°C for 10 seconds, primer annealing at 64°C for 30 seconds (calculate annealing temperature when preferred), and a polymerization step at 72° for 30 seconds/kilobase
- Final extension at 72°C for 10 minutes
- Hold at 16°C until ready for further processing
-
29
Remove sample from PCR machine. Gently flick tubes followed by briefly spinning down samples.
-
30
Do a post-PCR amplification DNA clean-up using the DNA Clean and Concentrator kit according to manufacturer’s instruction and elute sample in 20 μl of EB Buffer.
-
31
Measure the DNA concentration using a spectrophotometer.
-
32
Check 2 μl of purified secondary “fluorescent protein tagging” (EGFP-N-Terminal-Tagging) and “selection genetics” (HSP70B-CP6-nptII) PCR-amplified products using agarose gel electrophoresis and gel documentation to verify fragment integrity and size.
-
33
The final PCR products are GOI-EGFP-N-Terminal-Tagging-2 and GOI-HSP70B-CP6-nptII-2. Dilute both samples with MilliQ H2O to a final concentration of 40 ng/μl.
For Csp, the final PCR products are Csp-EGFP-N-Terminal-Tagging-2 and Csp-HSP70B-CP6-nptII-2.
Cloning of recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster using a plasmid containing a conditional origin of replication
-
34In a 0.2-ml PCR strip tube with individually attached cap, add secondary “fluorescent protein tagging” (GOI-EGFP-N-Terminal-Tagging-2) or “selection genetics” (GOI-HSP70B-CP6-nptII-2) PCR-amplified product, standard GB2.0 cloning vector (pR6Kγ-A1Spm) and enzymes according to the following recipe for GB2.0 synthetic assembly DNA cloning:
- 40 ng PCR-amplified DNA part
- 75 ng standard GB2.0 cloning vector (pR6Kγ-A1Spm)
- 1 μl BsaI-HFv2
- 1 μl of T4 DNA ligase
- 2 μl of 10x T4 DNA ligase buffer
-
MilliQ H2O up to 20 μlTo apply the principles described above to our example, the reactions to clone Csp-EGFP-N-Terminal-Tagging-2 and Csp-HSP70B-CP6-nptII-2 in pR6Kγ-A1Spm are:
- 40 ng Csp-EGFP-N-Terminal-Tagging-2 or Csp-HSP70B-CP6-nptII-2
- 75 ng standard GB2.0 cloning vector (pR6Kγ-A1Spm)
- 1 μl BsaI-HFv2
- 1 μl of T4 DNA ligase
- 2 μl of 10x T4 DNA ligase buffer
- MilliQ H2O up to 20 μl
-
35Briefly vortex and spin down tube contents and place into a PCR machine. Use the following GB2.0 cloning protocol to drive the synthetic DNA assembly cloning reaction. We recommend at least 25 cycles for efficient cloning (Figure 4B and Figure 5B):
- 25 to 50 reaction cycles of BsaI-HFv2-mediated cutting at 37°C for 2 minutes followed by T4 DNA ligase-mediated ligation at 16°C for 5 minutes
- Heat inactivation of enzymes at 85°C for 20 minutes
- Hold at 16°C until ready for further processing
-
36
Keep sample cool at 16°C in the PCR machine or move to refrigerator (4°C) until ready to transform. Transform sample within 24 to 48 hours of assembly reaction. Do not freeze.
-
37
On ice, thaw a microcentrifuge tube containing 50 μl aliquot of home-made chemocompetent TransforMax EC100D pir-116 E. coli cells (Sarrion-Perdigones et al., 2020).
TransforMax EC100D pir-116 E. coli cells express the “PIR” protein required for the maintenance of plasmids containing a conditional origin of replication, R6Kγ. Other “PIR” protein-expressing E. coli strains can be used.
-
38
Add 2 μl of GB2.0 synthetic DNA assembly reaction and incubate on ice for 10 to 15 minutes.
-
39
Heat shock cells by transferring the tube into a dry bead bath, set at 42°C for bacterial transformation, for 45 seconds.
-
40
Immediately after heat shocking the cells, transfer them to ice and incubate for an additional 2 minutes.
-
41
After 2 minutes, add 450 μl of 2xLB-0.5 liquid media (without antibiotics) to the microcentrifuge tube containing transformed cells and transfer to the 32°C shaking incubator, by taping the microcentrifuge tube to the shaker at an angle to ensure maximal aeration of culture.
-
42
Allow cells to recover shaking at 32°C for 45 minutes.
-
43
Plate 50 μl of recovered cells onto bacterial plates containing 1xLB agar supplemented with spectinomycin (50 μg/ml) and X-Gal using glass spreading beads.
-
44
Remove glass spreading beads and place plates into a 37°C incubator and let grow overnight. This should yield plenty of colonies. Depending on the efficiency of the cloning reaction, most colonies should be white (Figure 4B and Figure 5B). The presence of lots of blue colonies indicates a lower cloning efficiency.
-
45
Pick two white colonies using a fresh disposable inoculation loop for each colony and inoculate into a 14-ml disposable culture tubes containing 5 ml of 2xLB-0.5 medium supplemented with spectinomycin (50 μg/ml).
-
46
Grow the cultures overnight in a shaking incubator at 32°C. Angle tubes for maximal aeration.
-
47
Separate 0.25 ml of the overnight grown cultures in a 1.7-ml microcentrifuge tube each and add 0.25 ml of 40% glycerol to make a glycerol stock. Move glycerol stock to ultrafreezer at −80°C.
-
48
Spin down remaining portion of the cultures for 5 minutes at 4,000g using a refrigerated tabletop centrifuge that can accommodate 14-ml tubes. Decant the supernatant.
OPTIONAL: Freeze pellet at −20°C or −80°C for at least 30 minutes prior to proceeding to the next step. Freezing the pellet will simplify resuspension of bacterial pellet for DNA isolation purposes.
-
49
Isolate plasmid DNA using the QIAprep spin miniprep kit according to manufacturer’s instruction, and a tabletop microcentrifuge that can accommodate 1.7-ml tubes.
-
50
Elute DNA in 50 μl of EB buffer. Measure the concentration using a spectrophotometer.
Verification of cloned recombineering templates for fluorescent protein tagging and selection genetics in Drosophila melanogaster
-
51Verify the identity of assembled plasmid via restriction enzyme DNA fingerprinting, followed by agarose gel electrophoresis and gel documentation. Digest 400 ng of the plasmids with the restriction enzyme XhoI (Plasmids containing recombineering templates for fluorescent protein tagging) or XbaI (Plasmids containing recombineering templates for selection genetics) resulting in 2 distinct bands corresponding to the plasmid backbone (pR6Kγ-A1Spm) and cloned insert (DNA part):
- 400 ng of plasmid
- 2.5 μl of rCutSmart buffer
- 0.5 μl of XhoI (Plasmids containing recombineering templates for fluorescent protein tagging) or XbaI (Plasmids containing recombineering templates for selection genetics)
-
MilliQ H2O up to 25 μlPerform uncut digestion in parallel:
- 400 ng of plasmid
-
MilliQ H2O up to 25 μlWe recommend using a DNA manipulation software package to simulate the enzyme digest before performing the experimental digestions. We use the SnapGene software (SnapGene, https://www.snapgene.com/) to help us plan our digests, though several alternatives are available.
-
52
Digest plasmids at 37°C for at least one hour.
-
53
After digestion, briefly vortex and spin down samples.
-
54
Add DNA loading buffer.
-
55
Run your samples on a 1% agarose gel and after visualization using a gel documentation system, confirm by comparing the actual enzyme digest to the one in silico predicted by Snapgene.
-
56
Using a commercial service, confirm plasmids by Sanger DNA sequencing using the DNA sequencing primers, R6K-SeqFOR and R6K-SeqREV (see Step 11 for primer sequences), to ensure that no errors are present that were potentially introduced during PCR amplification.
-
57
Separate DNA samples and glycerol stocks of confirmed synthetically assembled DNA constructs for long term storage at −20°C and −80°C, respectively.
-
58
These are plasmids pCsp-EGFP-N and pCsp-Kan/G418 encoding recombineering templates for modifying the CH322–06D09 P[acman] BAC clone that covers Csp with an N-terminal EGFP tag for gene expression analysis and a G418 sulfate-selectable marker for selection transgenesis, respectively.
Preparation of recombineering templates to perform serial recombineering cloning to build both selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster
-
59Digest plasmids encoding recombineering templates for fluorescent protein tagging (pCsp-EGFP-N) and selection genetics (pCsp-Kan/G418) to release the recombineering templates according to the following recipe:
- 800 ng of plasmid (pCsp-EGFP-N or pCsp-Kan/G418)
- 2.5 μl of rCutSmart buffer
- 1 μl of XhoI (pCsp-EGFP-N) or XbaI (pCsp-Kan/G418)
- MilliQ H2O up to 25 μl
-
60
Digest plasmids at 37°C for 90 minutes.
-
61
After digestion, briefly vortex and spin down samples.
-
62
Do a post-enzymatic reaction DNA clean-up using the DNA Clean and Concentrator kit according to manufacturer’s instruction and elute sample in 20 μl of EB Buffer.
Further purification steps to remove vector backbone are not required since the pR6Kγ-A1Spm plasmid backbone cannot replicate in the recombineering strain which doesn’t encode the “PIR” protein required for maintenance of R6Kγ plasmids.
-
63
Resulting products are the recombineering templates for fluorescent protein tagging (Csp-EGFP-N) and selection genetics (Csp-Kan/G418). Store sample at −20°C until needed in Basic Protocol 3.
BASIC PROTOCOL 2
Making electrocompetent cells of the bacterial strains used to perform serial recombineering cloning or induction of plasmid copy number.
Introductory paragraph
Clones of the CHORI-322 and CHORI-321 P[acman] BAC libraries, with average insert sizes of 21- and 83-kilobases, respectively, and 13-kilobase backbones (Venken et al., 2009) are too large for typical chemical bacterial transformation and must be transformed using electroporation instead. This protocol will demonstrate how to make electrocompetent cells of the bacterial strains for serial recombineering cloning, i.e., EL350 (Lee et al., 2001) or SW106 (Warming et al., 2005), or plasmid copy number control of P[acman] BAC plasmids, i.e., EPI300, that are highly competent (Figure 6). After making the cells, we will describe how to test their electrocompetency to ensure they are appropriately competent to transform large P[acman] BAC plasmids. The resulting electrocompetent cells can then be used to perform serial recombineering cloning or plasmid copy number control to build both selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster, illustrated through the modification of the CH322–06D09 P[acman] BAC clone encompassing the gene encoding the synaptic versicle protein Cysteine string protein using an N-terminal EGFP tag for gene expression analysis and a G418 sulfate-selectable marker for selection transgenesis (see Basic Protocol 3).
Figure 6. Making electrocompetent cells of the bacterial strains used to perform serial recombineering cloning or plasmid copy number control to build selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster.

(A) Culture growth. The “culture growth” phase starts with picking a small portion of frozen section from the glycerol stocks (or bacterial stabs) of the EL350/SW106 (used to perform serial recombineering) and EPI300 (used to enable plasmid copy number control) strains, streaking each of these portions to a single colony on a bacterial plate containing LB-agar (without antibiotic selection), and placing plate at 32°C for overnight growth. Next day, during the afternoon, a single well-grown colony for each strain is picked in 10 ml 0.5xLB medium each and grown overnight to saturation at 32°C (without antibiotic selection). Next morning, for each strain, two baffled 2-liter flasks each containing 500 ml 0.5xLB medium (without antibiotic selection) are inoculated with 5 ml of saturated culture each and grown for 3 hours at 32°C into exponential growth phase. (B) Cell washing & aliquoting. The “cell washing & aliquoting” phase starts with transferring the grown culture for each strain (1 liter total) to four 250-ml centrifugation bottles, followed by spinning down, washing each bottle with 250 ml sterile and refrigerated MilliQ H2O (4°C), followed by spinning down again, washing each bottle with 125 ml sterile and refrigerated MilliQ H2O (4°C), and spinning down again. For each strain, MilliQ H2O washed cells of each bottle are resuspended in 5 ml sterile and refrigerated 10% glycerol (4°C) and transferred to a 50-ml centrifugation tube each. For each strain, cells are spun down again and resuspended in 1 ml sterile and refrigerated 10% glycerol (4°C). For each strain, cells are combined in 4 ml total, and aliquoted to eighty 50 μl aliquots in 1.7-ml microcentrifuge tubes that can be stored in an ultrafreezer at −80°C long term. All centrifugation steps occur refrigerated (4°C).
Materials
Reagents, solutions, and starting samples or test organisms/cells
Bacterial Escherichia coli strain used to perform serial recombineering cloning: EL350 (Lee et al., 2001) or SW106, a genetically engineered derivative of EL350, which does the same for our purposes (Warming et al., 2005)
Bacterial Escherichia coli strain used to induce the plasmid copy number of P[acman] BAC plasmids: TransforMax EPI300 (Lucigen Corporation, cat. no. EC300110)
1xLB agar (see Reagents and Solutions section for recipe)
1xLB-0.5 medium (see Reagents and Solutions section for recipe)
Glycerol (Fisher Scientific, cat. no. BP229–1) to make a 40% glycerol solution in MilliQ H2O, sterilized by autoclaving
Refrigerated MilliQ H2O, sterilized by autoclaving
Glycerol (Fisher Scientific, cat. no. BP229–1) to make a refrigerated 10% glycerol solution in MilliQ H2O, sterilized by autoclaving
Dry ice (local vendor)
Absolute ethanol (VWR, cat. no. 89125–188)
pUC19 plasmid to determine electrocompetency (Thermo Fisher Scientific, cat. no. SD0061), diluted with MilliQ H2O to 10 pg/μl
SOC medium (Fisher Scientific, cat. no. AAJ60255-AE)
-
Ampicillin powder (VWR, cat. no. IC19014605) to make a 1,000x stock solution in 50% EtOH diluted with MilliQ H2O, followed by filter sterilization (100 mg/ml) (Table 2)
Ampicillin powder is first dissolved in ½ volume of MilliQ H2O and then diluted with ½ volume of 100% EtOH
Hardware and instruments
Disposable inoculating loops (VWR, cat. no. 12000–806)
Bacterial plates (VWR, cat. no. 25384–092)
32°C incubator-shaker (Amerex Instruments, cat. no. 747/747R)
Falcon 50 ml disposable culture tubes (VWR, cat. no. 21008–940)
1.7-ml microcentrifuge tubes (VWR, cat. no. 20170–038)
2-liter baffled Erlenmeyer flasks (VWR, cat. no. 89000–992)
Spectrophotometer (DeNovix, cat. no. DS-11+)
250 ml centrifuge bottles (VWR, cat. no. 21010–614)
Large rectangular ice buckets (VWR, cat. no. 75779–976)
Beckman Coulter Avanti J-25 floor centrifuge to hold a JA-14 rotor
Beckman Coulter JA-14 rotor to hold 250 ml centrifuge bottles (VWR, cat. no. BK339247)
Refrigerated tabletop centrifuge that can accommodate Falcon 50 ml disposable culture tubes (Fisher Scientific, cat. no. 75230115)
1 mm electroporation cuvettes (VWR, cat. no. 58017–890)
Electroporator with electroporation pod (VWR, cat. no. 76271–448)
Glass spreading beads (VWR, cat. no. 26396–508)
Protocol steps
Growing bacterial culture to make electrocompetent cells of the bacterial strains used to perform serial recombineering cloning or plasmid copy number control
-
1Order or request the necessary bacterial Escherichia coli strains:
- EL350 (Lee et al., 2001) or SW106 (Warming et al., 2005)
-
TransforMax EPI300 (Lucigen Corporation, cat. no. EC300110) to perform plasmid copy number controlIf the necessary strains are already present in the lab, identify the appropriate glycerol stocks.
-
2
Using a disposable inoculating loop, streak out each necessary strain from its bacterial stab (or glycerol stock) to single colonies on bacterial plates containing 1xLB agar without antibiotic (Figure 6A).
-
3
Incubate plates overnight in a 32°C incubator.
32°C incubation is mandatory for the EL350 and SW106 bacterial strains to prevent long-term induction of recombineering functions at 37°C which results in bacterial cell death.
-
4
For each strain, pick a single colony using a disposable inoculation loop and inoculate into a Falcon 50 ml disposable culture tube containing 15 ml of 1xLB-0.5 medium without antibiotic.
-
5
Grow the cultures overnight to saturation in a shaking incubator at 32°C. Angle tubes for maximal aeration.
-
6
For each strain for which you don’t yet have a glycerol stock, separate 0.25 ml of the overnight grown culture in a 1.7-ml microcentrifuge tube and add 0.25 ml of 40% glycerol to make a glycerol stock. Move glycerol stock to ultrafreezer at −80°C.
-
7
For each strain, add 5 ml of overnight culture, grown to saturation to 500 ml 1xLB-0.5 medium without antibiotic in a 2-liter baffled Erlenmeyer flask, twice (1 liter total).
-
8
Grow diluted culture up at 32°C for 3 hours to exponential phase; optical density (O.D.) or light absorbance measured using a spectrophotometer should be between 0.5 and 0.6).
Making and aliquoting electrocompetent cells of the bacterial strains used to perform serial recombineering cloning or plasmid copy number control
-
9
For each strain, decant each 500 ml of grown bacterial culture into two, separate 250 ml centrifuge bottles (4 bottles total/strain) (Figure 6B).
-
10
Chill centrifuge bottles containing bacterial culture in an ice water bath, made in a large rectangular ice bucket for 10 to 15 minutes.
-
11
For each strain, spin all four centrifuge bottles for 15 minutes at 4000g in a refrigerated Beckman Coulter Avanti J-25 floor centrifuge equipped with a Beckman Coulter JA-14 rotor.
-
12
Remove as much culture as possible, first by decanting and then removing as much of the remaining liquid as possible using a P1000 pipette.
-
13
Wash each pellet with 250 ml refrigerated MilliQ H2O. Start by first adding 50 ml of refrigerated MilliQ H2O to each pellet followed by resuspending cells using gentle tapping of the bottle against the sides of the ice bucket. Cells will initially be difficult to resuspend. Care must be taken to keep cells cold by tapping cells in 20 to 30 second bursts, returning each tube to the ice water bath in between. Once cells are completely resuspended for all four centrifuge bottles for each strain, add the remaining 200 ml of refrigerated MilliQ H2O to each bottle.
-
14
For each strain, spin all four centrifuge bottles again for 15 minutes at 4000g in a refrigerated Beckman Coulter Avanti J-25 floor centrifuge equipped with a Beckman Coulter JA-14 rotor.
-
15
Remove as much culture as possible, first by decanting and then removing as much of the remaining liquid as possible using a P1000 pipette.
-
16
Wash each pellet with 125 ml refrigerated MilliQ H2O. Start by first adding 25 ml of refrigerated MilliQ H2O to each pellet, followed by resuspending cells using gentle tapping of the bottle against the side of the ice bucket. Cells will be a bit easier to resuspend compared to the first washing step. Care must be taken to keep cells cold by tapping cells in 20 to 30 second bursts, returning each bottle to the ice water bath in between. Once cells are completely resuspended for all four centrifuge bottles for each strain, add the remaining 100 ml of refrigerated MilliQ H2O to each bottle.
-
17
For each strain, spin all four centrifuge bottles again for 15 minutes at 4000g in a refrigerated Beckman Coulter Avanti J-25 floor centrifuge equipped with a Beckman Coulter JA-14 rotor.
-
18
Remove as much culture as possible, first by decanting and then removing as much of the remaining liquid as possible using a P1000 pipette.
-
19
Wash each pellet with 5 ml of refrigerated 10% glycerol solution in refrigerated and sterilized MilliQ H2O per pellet followed by resuspending cells using gentle tapping of the bottle against the side of the ice bucket. Cells will be much easier to resuspend compared to previous washing steps. Care must be taken to keep cells cold by tapping cells in 20 to 30 second bursts, returning each bottle to the ice water bath in between.
-
20
Once cells are completely resuspended, transfer cells from each 250 ml centrifuge bottle into a Falcon 50 ml disposable culture tube. Spin tubes at 4000g in a refrigerated tabletop centrifuge that can accommodate Falcon 50 ml disposable culture tubes for 15 minutes.
-
21
Remove as much culture as possible, first by careful decanting and then removing as much of the remaining liquid as possible using a P1000 pipette.
Pellet will be fragile. Be careful during decanting.
-
22
Add 1 ml of refrigerated 10% glycerol solution in MilliQ H2O to each pellet, followed by resuspending cells using gentle tapping of the tube against the side of the ice bucket. Cells will be very easy to resuspend compared to previous washing steps. Care must be taken to keep cells cold by tapping tubes in 20 to 30 second bursts, returning each tube to the ice water bath in between.
-
23
For each strain, combine all 1 ml aliquots to a total volume of 4 ml in one of the Falcon 50 ml disposable culture tubes.
-
24
Prepare a dry ice EtOH bath, by submerging dry ice in absolute ethanol using a large rectangular ice bucket.
-
25
Let the dry ice EtOH bath temperature equilibrate for 10 to 15 minutes.
-
26
For each strain, divide cells into 80 aliquots of 50 μl each in 1.7-ml microcentrifuge tubes, pre-chilled on ice. Snap freeze each cell aliquot in a dry ice EtOH bath.
-
27
Once all aliquots are dispensed and flash frozen for each strain, transfer aliquots to a prechilled freezer box, and move to ultrafreezer at −80°C for long term storage.
Testing electrocompetency of the bacterial strains used to perform serial recombineering cloning or plasmid copy number control
-
28
For each strain, retrieve one 1.7-ml microcentrifuge tube containing a 50 μl aliquot of electrocompetent cells from the ultrafreezer (−80°C) and thaw on ice.
-
29
Add 1 μl of 10 pg/μl pUC19 plasmid DNA to each tube.
-
30
For each strain, transfer electrocompetent cell/plasmid mixture to a prechilled 1 mm electroporation cuvette.
-
31
Transfer electroporation cuvette containing electrocompetent cell/plasmid mixture to electroporation pod connected to an electroporator, and electroporate at 25 μF, 200 Ohm, and 1.8 kV.
-
32
Immediately after electroporation, add 450 μl of SOC medium to the cuvette and transfer electroporated cells back to the 1.7-ml microcentrifuge tube.
-
33
Allow cells to recover at 32°C, shaking for 1.5 hours.
-
34
Dilute recovered cells 1:10 by pipetting 50 μl of recovered cells into 450 μl of fresh SOC medium using a new 1.7-ml microcentrifuge tube. Mix by gently inverting 6 to 8 times.
-
35
Plate 50 μl of the diluted cells onto bacterial plates containing 1xLB agar supplemented with ampicillin (100 μg/ml) using glass spreading beads.
-
36
Remove glass spreading beads and place plates into a 32°C incubator and let grow overnight. This should yield plenty of colonies.
-
37
For each strain, count the colonies and multiple by 100 (cell dilution factor) and then by 105 (DNA dilution factor) to obtain the number of transformants per μg of DNA.
Good electrocompetent cells result in 108 to 109 of transformants per μg of DNA.
BASIC PROTOCOL 3
Serial recombineering cloning to generate both selectable and tagged genomic P[acman] BAC reporter transgenes for selection transgenesis and gene expression analysis in Drosophila melanogaster.
Introductory paragraph
This protocol will describe how to perform serial recombineering cloning to generate selectable, tagged genomic P[acman] BAC reporter transgenes for selection transgenesis and gene expression analysis in Drosophila melanogaster, applied to the modification of the CH322–06D09 P[acman] BAC clone encompassing the gene encoding the synaptic versicle protein Cysteine string protein using an N-terminal EGFP tag for gene expression analysis and a G418 sulfate-selectable marker for selection transgenesis (Figure 7). We will first explain where to obtain and how to prepare a P[acman] BAC clone covering the genetic locus encompassing your gene of interest for serial recombineering (Figure 1 and Table 1). Then we will describe how to transform a purified P[acman] BAC plasmid into the bacterial strain used for serial recombineering cloning, i.e., the EL350 (or SW106) strain, by electroporation using an aliquot of electrocompetent cells previously made for this strain (see Basic Protocol 2). Next, we will explain the serial recombineering cloning workflow that includes two rounds of recombineering induction, one round using a “fluorescent protein tag” recombineering template and a second round using a “selection genetics” recombineering template, both previously generated (see Basic Protocol 1), followed by a round of Cre recombinase induction to remove unwanted sequences introduced during recombineering and finalize the P[acman] BAC plasmid for fluorescent protein tagging and selection genetics in Drosophila melanogaster. Finally, we will describe how to purify the selectable and tagged P[acman] BAC plasmid from the EL350 (or SW106) recombineering strain and transform it into the bacterial strain for plasmid copy number control (i.e., EPI300) by electroporation using an aliquot of electrocompetent cells previously made for this strain, followed by high-copy number plasmid DNA purification and verification by restriction enzyme DNA fingerprinting. By the end of this protocol, the user should be able to perform serial recombineering cloning to generate modified P[acman] BAC clones for transgenic selection strategies using Drosophila melanogaster (Matinyan et al., 2021b). A protocol to generate transgenic animals using a serially recombineered P[acman] BAC clone is presented in an accompanying Current Protocols article (Current Protocols #1).
Figure 7. Schematic overview of the serial recombineering workflow to generate selectable and tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster: the synaptic vesicle protein Cysteine string protein (Csp) as an example.

The chloramphenicol-resistant (ChlR) P[acman] BAC plasmid covering the gene encoding the synaptic versicle protein Cysteine string protein (Csp) (CH322–06D09) is maintained in the EPI300 bacterial strain that allows plasmid copy number toggling between very low (basal state) and high copy (after induction). The P[acman] BAC plasmid is isolated from the EPI300 strain after plasmid copy number induction using arabinose, transferred to an aliquot of the EL350 recombineering/Cre recombinase strain (see Figure 6) and transformed into this strain by electroporation, followed by selective growth on bacterial plates using chloramphenicol (ChlR). A first round of recombineering, induced by a 15-minutes temperature shift from 32°C to 42°C, upgrades the CH322–06D09 P[acman] BAC using the linearized “fluorescent protein tagging” recombineering template encoding the N-terminal EGFP tag linked to the ampicillin resistance marker (AmpR) flanked by LoxP sites, and is selected for using chloramphenicol (ChlR) and ampicillin (AmpR). A second round of recombineering further upgrades the CH322–06D09 P[acman] BAC using the linearized “selection genetics” recombineering template encoding the selection marker that (i) provides resistance to kanamycin (KanR) in bacteria for clone selection and G418 sulfate (G418R) in flies for downstream selectable transgenesis, (ii) removes the chloramphenicol resistance marker (ChlR) that is present in the P[acman] BAC clone, and (iii) is selected for using kanamycin (KanR) and ampicillin (AmpR). During the last modification round, Cre recombinase removes the floxed ampicillin marker, resulting in the final selectable and tagged genomic P[acman] BAC reporter transgene for downstream selectable transgenesis and gene expression analysis of the Csp gene. The fully modified plasmid is then isolated from the EL350 bacterial strain, transferred to an aliquot of the EPI300 bacterial strain for plasmid copy number control (see Figure 6) and transformed into this strain by electroporation. High-copy number modified CH322–06D09 P[acman] BAC plasmid is isolated from the EPI300 strain after plasmid copy number induction using arabinose. Correct recombineering is verified by comparing the modified CH322–06D09 P[acman] BAC plasmid to the unmodified version using restriction enzyme DNA fingerprinting as well as Sanger DNA sequencing across the regions where recombineering occurred.
Materials
Reagents, solutions, and starting samples or test organisms/cells
- 1x of each P[acman] BAC clone:
- P[acman] BAC CH322–06D09 (BACPAC resources) (Venken et al., 2009) (Table 1)
1xLB agar (see Reagents and Solutions section for recipe)
Chloramphenicol powder (VWR, cat. no. 45000–618) to make a 1,000x stock solution in 100% EtOH, sterilization not required (12.5 mg/ml) (Table 2)
Absolute ethanol (VWR, cat. no. 89125–188)
2xLB-0.5 medium (see Reagents and Solutions section for recipe)
CopyControl Fosmid Autoinduction Solution (500x) (Lucigen Corporation, cat. no. AIS107F)
Glycerol (Fisher Scientific, cat. no. BP229–1) to make a 40% glycerol solution in MilliQ H2O, sterilized by autoclaving
ChargeSwitch Pro Plasmid Miniprep kit (Thermo Fisher Scientific, cat. no. CS30010)
10x rCutSmart Buffer for restriction enzyme digestions (NEB B6004S)
Restriction enzyme for restriction enzyme DNA fingerprinting of original P[acman] BAC plasmid: EcoRI-HF (New England Biolabs, cat. no. R3101L)
EB buffer (10 mM Tris-Cl, pH 8.5) from QIAprep spin miniprep kit (QIAGEN, cat. no. 27106)
Home-made electrocompetent Escherichia coli cells of the EL350 (Lee et al., 2001) or SW106 strain (Warming et al., 2005) to perform serial recombineering (see Basic Protocol 2)
1xLB-0.5 medium (see Reagents and Solutions section for recipe)
Refrigerated MilliQ H2O, sterilized by autoclaving
Linearized recombineering templates (see Basic Protocol 1): “Csp-EGFP-N” for fluorescent protein tagging of Csp contained within the CH322–06D09 P[acman] BAC, and “Csp-Kan/G418” for selection genetics of the CH322–06D09 P[acman] BAC encompassing Csp
-
Ampicillin powder (VWR, cat. no. IC19014605) to make a 1,000x stock solution in 50% EtOH diluted with MilliQ H2O, followed by filter sterilization (100 mg/ml) (Table 2)
Ampicillin powder is first dissolved in ½ volume of MilliQ H2O and then diluted with ½ volume of 100% EtOH
Room temperature MilliQ H2O, sterilized by autoclaving
Kanamycin sulfate powder (VWR, cat. no. 45000–640) to make a 1,000x stock solution in MilliQ H2O, followed by filter sterilization (30 mg/ml) (Table 2)
L-(+)-Arabinose (Millipore Sigma, cat. no. I A3256) to make a 10% stock solution in MilliQ H2O, followed by filter sterilization
Home-made electrocompetent Escherichia coli cells of the TransforMax EPI300 strain (Lucigen Corporation, cat. no. EC300110) to perform plasmid copy number control (see Basic Protocol 2)
Restriction enzymes for restriction enzyme DNA fingerprinting of modified P[acman] BAC plasmid: EcoRI-HF (New England Biolabs, cat. no. R3101L), XbaI (New England Biolabs, cat. no. R0145L), and XhoI (New England Biolabs, cat. no. R0146L)
Hardware and instruments
Disposable inoculating loops (VWR, cat. no. 12000–806)
Bacterial plates (VWR, cat. no. 25384–092)
32°C incubator-shaker (Amerex Instruments, cat. no. 747/747R)
14-ml disposable culture tubes (VWR, cat. no. 60818–689)
1.7-ml microcentrifuge tubes (VWR, cat. no. 20170–038)
Refrigerated tabletop centrifuge that can accommodate 14-ml disposable culture tubes (Fisher Scientific, cat. no. 75230115)
Tabletop microcentrifuge that can accommodate 1.7-ml tubes (Fisher Scientific, cat. no. 75002435)
Spectrophotometer (DeNovix, cat. no. DS-11+)
Reagents and equipment for agarose gel electrophoresis (Voytas, 2001)
Gel documentation system
1 mm electroporation cuvettes (VWR, cat. no. 58017–890)
Large rectangular ice bucket (VWR, cat. no. 75779–976)
Electroporator with electroporation pod (VWR, cat. no. 76271–448)
Falcon 50 ml disposable culture tubes (VWR, cat. no. 21008–940)
Refrigerated tabletop centrifuge that can accommodate Falcon 50 ml disposable culture tubes (Fisher Scientific, cat. no. 75230115)
Refrigerated tabletop microcentrifuge that can accommodate 1.7-ml tubes (Hermle, cat. no. Z216-MK)
42°C incubator-shaker (Amerex Instruments, cat. no. Gyromax 929)
Glass spreading beads (VWR, cat. no. 26396–508)
Protocol steps
Obtaining and preparing a P[acman] BAC plasmid covering the genetic locus encompassing your gene of interest for serial recombineering cloning to build both a selectable and tagged genomic transgene for gene expression analysis
-
1
To obtain a P[acman] BAC clone covering your gene(s) of interest, go to FlyBase (https://flybase.org/) (version FB2022_04) (Gramates et al., 2022) and search for your gene(s) of interest. For our purposes, we searched for the gene named Cysteine string protein (Csp): https://flybase.org/reports/FBgn0004179 (Figure 1A).
-
2
Link to the “Gbrowse” genome map of your gene(s) of interest, link to “Select Tracks”, and, for clarity, select the following tracks only: “Gene Span”, “Transcript”, “Pacman Chori-322_BAC” (P[acman] BAC library encompassing average insert sizes of 21-kilobase), and “Pacman Chori-321_BAC” (P[acman] BAC library encompassing average insert sizes of 83-kilobase).
-
3Zoom in or out to a desired genomic interval as needed to have a useful overview of available P[acman] BAC clones for your gene(s) of interest and pick a clone for each gene that covers approximately 5-kilobase upstream and downstream of your gene. Ideally, a clone of the smaller CHORI-322 P[acman] BAC library with an average insert size of 21 kilobases is available for each of your genes of interest, i.e., clones from this library are easier for retrieving transgenic animals, compared to clones of the larger CHORI-321 P[acman] BAC library with an average insert size of 83 kilobases (see Current Protocols #1) (Venken et al., 2009, 2006, 2010, 2016). If no appropriate CHORI-322 P[acman] BAC clone is available, or your gene is larger than can be contained within a CHORI-322 P[acman] BAC clone, pick a clone from the CHORI-321 P[acman] BAC library.
-
4
Order the chosen P[acman] BAC clone(s) covering your gene(s) of interest from BACPAC Resources (https://bacpacresources.org/). P[acman] BAC clones ordered from BACPAC Resources will arrive as agar stabs.
For each P[acman] BAC clone already present in the lab, identify the appropriate glycerol stock.
-
5
Using a disposable inoculating loop, streak out the P[acman] BAC clone(s) covering your gene(s) of interest from the bacterial agar stab(s), or glycerol stock(s) to single colonies on bacterial plates containing 1xLB agar supplemented with chloramphenicol (12.5 μg/ml).
-
6
Incubate plates overnight in a 32°C incubator.
-
7
For each P[acman] BAC clone, pick two single colonies using a disposable inoculation loop and inoculate into a 14-ml disposable culture tube containing 5 ml of 2xLB-0.5 medium supplemented with chloramphenicol (12.5 μg/ml), and 10 μl of CopyControl Fosmid Autoinduction Solution (Figure 7). These are the plasmid copy number induced cultures.
Two colonies are picked for each P[acman] BAC plasmid obtained from BACPAC Resources making sure a correct clone is identified, due to rare cross-contamination between wells of 384-well plates that can occur for genomic DNA libraries archived in such plates.
For each P[acman] BAC clone already present in the lab and previously characterized, picking a single colony is sufficient.
For each P[acman] BAC clone for which you don’t have a glycerol stock yet, grow up separate 14-ml disposable culture tubes containing 5 ml of 2xLB-0.5 medium supplemented with chloramphenicol (12.5 μg/ml), but without CopyControl Fosmid Autoinduction Solution. These are the plasmid copy number uninduced cultures.
-
8
Grow the cultures overnight in a shaking incubator at 32°C. Angle tubes for maximal aeration.
-
9
For each copy number induced culture, spin down overnight grown culture for 5 minutes at 4,000g using a refrigerated tabletop centrifuge that can accommodate 14-ml tubes. Decant the supernatant.
OPTIONAL: Freeze pellet at −20°C or −80°C for at least 30 minutes prior to proceeding to the next step. Freezing the pellet will simplify resuspension of bacterial pellet for DNA isolation purposes.
-
10
For each copy number uninduced culture, set aside 0.25 ml of overnight grown culture in a 1.7-ml microcentrifuge tube and add 0.25 ml of 40% glycerol to make glycerol stocks. Move glycerol stocks to an ultrafreezer at −80°C.
-
11
Isolate P[acman] BAC DNA from the plasmid copy number induced cultures using the ChargeSwitch Pro Plasmid Miniprep kit according to the manufacturer’s instructions, and a tabletop microcentrifuge that can accommodate 1.7-ml tubes (Figure 7).
-
12
Elute DNA in 100 μl of EB buffer. Measure the concentration using a spectrophotometer.
-
13Verify the identity of the isolated P[acman] BAC plasmid(s) via restriction enzyme DNA fingerprinting using the restriction enzyme EcoRI-HF, resulting in a unique DNA fingerprint for each P[acman[BAC clone:
- 400 ng of plasmid
- 2.5 μl of rCutSmart buffer
- 0.5 μl of EcoRI-HF
-
MilliQ H2O up to 25 μlWe recommend using a DNA manipulation software package to simulate the enzyme digest before performing the experimental digestions. We use the SnapGene software (SnapGene, https://www.snapgene.com/) to help us plan our digests, though several alternatives are available.
-
14
Digest plasmids at 37°C for at least one hour.
-
15
After digestion, briefly vortex and spin down samples.
-
16
Add DNA loading buffer.
-
17
Run your samples on a 0.8% agarose gel and after visualization using a gel documentation system, confirm by comparing the actual enzyme digestion to the one in silico predicted by Snapgene.
-
18Alternatively, the inserts of P[acman] BAC clone(s) can be verified using Sanger DNA sequencing and the following DNA sequencing primers (Venken et al., 2009):
- Pac-BW-F: ATCGGCATAGTATATCGGCATAG
- Pac-BW-R: GATGTGCTGCAAGGCGATTAAGT
-
19
Separate DNA samples of confirmed P[acman] BAC clones, and glycerol stocks from the plasmid copy number uninduced culture (if not yet present in the lab), for long-term storage at −20°C and −80°C, respectively.
For clones obtained from BACPAC Resources, if both colonies for each P[acman] BAC clones have the same restriction enzyme DNA fingerprinting pattern (and DNA sequencing results) that is predicted in silico by Snapgene, keep DNA sample and glycerol stock for just one of them. This is typically the case. If the restriction enzyme DNA fingerprinting pattern (and DNA sequencing results) are different between both colonies but one colony is correct, only keep the DNA sample and glycerol stock for the correct one predicted in silico by Snapgene. This happens rarely (~1/100). In case both colonies show a restriction enzyme DNA fingerprinting pattern different from the in silico predicted one by Snapgene, test two additional colonies to see if an appropriate one can be isolated, although a colony mispick from the 384-well plate or a wrong annotation may have occurred, and a correct colony will never be isolated. This happens very rarely and has so far occurred only once out of ~1,000 P[acman] BAC clones characterized by one of us (K.J.T.V.).
-
20
Dilute each P[acman] BAC clone with MilliQ H2O to a final concentration of 1 ng/μl.
From now on, this protocol will focus solely on the serial recombineering cloning of the CH322–06D09 P[acman] BAC to build both a selectable and tagged genomic P[acman] BAC reporter transgene for gene expression analysis of Csp.
Transformation of a prepared P[acman] BAC plasmid into the bacterial strain used for serial recombineering cloning
-
21
Retrieve one 1.7-ml microcentrifuge tube containing a 50 μl aliquot of electrocompetent cells for the EL350 (or SW106) recombineering strain (see Basic Protocol 2) from the ultrafreezer (−80°C) and thaw on ice in an ice bucket.
-
22
Using refrigerated MilliQ H2O, make a 1/4 to 1/8 dilution of this aliquot totaling 200 to 400 μl.
-
23
Divide diluted cells into four to eight 50 μl aliquots (depending on the number of P[acman] BAC clones being serially recombineered).
-
24
Add 1 μl of diluted CH322–06D09 P[acman] BAC plasmid to 50 μl of 1/4 to 1/8 diluted EL350 recombineering strain cells.
-
25
Transfer electrocompetent cell/plasmid mixture to a prechilled 1 mm electroporation cuvette.
-
26
Gently tap cuvette 2 to 3 times to remove any air bubbles, and wipe away any moisture on the cuvette using a Kimwipe prior to electroporation.
-
27
Transfer electroporation cuvette containing electrocompetent cell/plasmid mixture to electroporation pod connected to an electroporator, and electroporate at 25 μF, 200 Ohm, and 1.8 kV (Figure 7).
-
28
Immediately after electroporation, add 450 μl of 2xLB-0.5 medium to the cuvette, transfer electroporated cells back to the 1.7-ml microcentrifuge tube, and transfer tube to a 32°C shaking incubator, by taping microcentrifuge tube to the shaker at an angle to ensure maximal aeration of culture.
-
29
Allow cells to recover at 32°C, shaking for 1 hour.
-
30
Plate 50 μl of recovered cells onto bacterial plates containing 1xLB agar supplemented with chloramphenicol (12.5 μg/ml) using glass spreading beads.
-
31
Remove glass spreading beads and place plates into a 32°C incubator and let grow overnight. This should yield plenty of colonies.
A first round of recombineering induction to incorporate a fluorescent protein tag into a P[acman] BAC plasmid for gene expression analysis in Drosophila melanogaster
-
32
Pick a single colony of EL350 cells containing CH322–06D09 P[acman] BAC plasmid using a disposable inoculation loop and inoculate into a Falcon 50 ml disposable culture tube containing 5 ml of 1xLB-0.5, supplemented with chloramphenicol (12.5 μg/ml).
-
33
Grow the culture overnight to saturation in a shaking incubator at 32°C. Angle tube for maximal aeration.
-
34
Add 200 μl of overnight culture, grown to saturation to 13.8 ml 1xLB-0.5 supplemented with chloramphenicol (12.5 μg/ml) (1:70 dilution) into a Falcon 50 ml disposable culture tube.
-
35
Grow diluted culture up at 32°C for 2 hours and 45 minutes to exponential phase; optical density (O.D.) or light absorbance measured using a spectrophotometer should be between 0.5 and 0.6). During this growth phase, set a shaking water bath to 42°C (Figure 7).
-
36
After 2.45 hours of growth, remove the culture from the 32°C shaking incubator and place into the 42°C water bath to induce expression of recombineering proteins.
-
37
Induce cells for 15 minutes at 42°C while shaking.
-
38
Place culture immediately after induction into an ice water bath for 5 minutes.
-
39
Pellet cells by spinning the culture at 4,000g for 10 minutes using a refrigerated tabletop centrifuge that can accommodate Falcon 50 ml disposable culture tubes.
-
40
Remove as much culture as possible, first by decanting and then removing as much of the remaining liquid as possible using a P1000 pipette.
-
41
Wash cell pellet with 28 ml refrigerated MilliQ H2O. Start by first adding 1 ml of refrigerated MilliQ H2O to the cell pellet followed by resuspending cells using gently tapping of the tube against the sides of the ice bucket. Cells will initially be difficult to resuspend. Care must be taken to keep cells cold by tapping cells in 20 to 30 second bursts, returning the tube to the ice water bath in between. Once cells are completely resuspended, add the remaining 27 ml of refrigerated MilliQ H2O to the tube.
-
42
Spin culture again for 10 minutes at 4,000g using a refrigerated tabletop centrifuge that can accommodate Falcon 50 ml disposable culture tubes.
-
43
Remove as much culture as possible, first by decanting and then removing as much of the remaining liquid as possible using a P1000 pipette.
-
44
Wash pellet with 1 ml refrigerated MilliQ H2O, by resuspending cells using gentle tapping of the tube against the sides of the ice bucket. Cells will be a bit easier to resuspend compared to the first washing step. Care must be taken to keep cells cold by tapping cells in 20 to 30 second bursts, returning the tube to the ice water bath in between. Once cells are completely resuspended for each P[acman] BAC clone to be modified, transfer everything to a pre-chilled 1.7-ml microcentrifuge tube.
-
45
Spin the tube at 14,000 rpm for 30 seconds using a refrigerated tabletop microcentrifuge that can accommodate 1.7-ml tubes. Remove all supernatant with tip.
-
46
Add 160 μl refrigerated MilliQ H2O to the cell pellet and resuspend by gently pipetting cells up and down, resulting in a final volume of ~180 μl.
-
47
Divide cells into three 60 μl aliquots using fresh, pre-chilled 1.7-ml microcentrifuge tubes. Keep cells cold.
Multiple aliquots are generated to include backups in case arcing or accidents occur during downstream electroporation.
-
48
Add 2 μl of previously linearized recombineering template for fluorescent protein tagging (“Csp-EGFP-N”, see Basic Protocol 1) to one 60 μl aliquot of electrocompetent, induced EL350 strain cells, containing the CH322–06D09 P[acman] BAC clone (Figure 7).
-
49
Transfer electrocompetent cell/linearized recombineering template mixture to a prechilled 1 mm electroporation cuvette.
-
50
Gently tap cuvette 2 to 3 times to remove any air bubbles, wipe away any moisture on the cuvette using a Kimwipe prior to electroporation.
-
51
Transfer electroporation cuvette containing electrocompetent cell/plasmid mixture to electroporation pod connected to an electroporator, and electroporate at 25 μF, 200 Ohm, and 1.8 kV.
-
52
Immediately after electroporation, add 450 μl of 2xLB-0.5 medium to the cuvette, transfer electroporated cells back to the 1.7-ml microcentrifuge tube, and transfer tube to a 32°C shaking incubator, by taping microcentrifuge tube to the shaker at an angle to ensure maximal aeration of culture.
-
53
Allow cells to recover at 32°C, shaking for 1 hour.
-
54
Plate 50 μl of recovered cells onto bacterial plates containing 1xLB agar supplemented with chloramphenicol (12.5 μg/ml) and ampicillin (50 μg/ml) using glass spreading beads (Figure 7).
-
55
Remove glass spreading beads and place plates into a 32°C incubator and let grow overnight. This should yield plenty of colonies to confirm recombineering occurred.
Step 54 and Step 55 are to confirm that the serial recombineering workflow can continue. Most of the time, plenty of colonies are observed, and the workflow can continue. Rarely, no colonies are present, and the workflow will have to be repeated, starting from Step 32.
-
56
In parallel, add 250 μl of recovered cells to 2.5 ml of 1xLB-0.5 supplemented with chloramphenicol (12.5 μg/ml) and ampicillin (50 μg/ml) in a 50 ml conical tube. Grow the inoculated culture overnight shaking at 32°C. Angle the conical for maximal aeration.
-
57
Check the plate grown at 32°C for the presence of colonies.
-
58
Dilute the overnight culture by adding 50 μl to 5 ml of 1xLB-0.5 supplemented with chloramphenicol (12.5 μg/ml) and ampicillin (50 μg/ml) in a 50 ml conical tube (1:100 dilution). Grow the inoculated culture a second time with overnight shaking at 32°C. Angle the conical for maximal aeration.
A second round of recombineering induction to incorporate a resistance marker into a P[acman] BAC plasmid for selection genetics in Drosophila melanogaster
-
59
Add 200 μl of overnight culture, grown to saturation to 13.8 ml 1xLB-0.5 medium supplemented with chloramphenicol (12.5 μg/ml) and ampicillin (50 μg/ml) (1:70 dilution) into a Falcon 50 ml disposable culture tube.
-
60
Grow diluted culture up at 32°C for 2.45 hours to exponential phase; optical density (O.D.) or light absorbance measured using a spectrophotometer should be between 0.5 and 0.6). During this growth phase, set a shaking water bath to 42°C.
-
61
After 2.45 hours of growth, remove the culture from the 32°C shaking incubator and place into the 42°C water bath to induce expression of recombineering proteins (Figure 7).
-
62
Induce cells for 15 minutes at 42°C, shaking.
-
63
Place culture immediately after induction into an ice water bath for 5 minutes.
-
64
Pellet cells by spinning the culture at 4,000g for 10 minutes using a refrigerated tabletop centrifuge that can accommodate Falcon 50 ml disposable culture tubes.
-
65
Remove as much culture as possible, first by decanting and then removing as much of the remaining liquid as possible using a P1000 pipette.
-
66
Wash pellet with 28 ml refrigerated MilliQ H2O. Start by first adding 1 ml of refrigerated MilliQ H2O to the pellet followed by resuspending cells while gently tapping the tube against the sides of the ice bucket. Cells will initially be difficult to resuspend. Care must be taken to keep cells cold by tapping cells in 20 to 30 second bursts, returning the tube to the ice water bath in between. Once cells are completely resuspended, add the remaining 27 ml of refrigerated MilliQ H2O to the tube.
-
67
Spin culture again for 10 minutes at 4,000g using a refrigerated tabletop centrifuge that can accommodate Falcon 50 ml disposable culture tubes.
-
68
Remove as much culture as possible, first by decanting and then removing as much of the remaining liquid as possible using a P1000 pipette.
-
69
Wash the pellet with 1 ml refrigerated MilliQ H2O, by resuspending cells using gentle tapping of the tube against the sides of the ice bucket. Cells will be a bit easier to resuspend compared to the first washing step. Care must be taken to keep cells cold by tapping cells in 20 to 30 second bursts, returning the tube to the ice water bath in between. Once cells are completely resuspended, transfer everything to a pre-chilled 1.7-ml microcentrifuge tube.
-
70
Spin the tube at 14,000 rpm for 30 seconds using a refrigerated tabletop microcentrifuge that can accommodate 1.7-ml tubes. Remove all supernatant with tip.
-
71
Add 160 μl refrigerated MilliQ H2O to the pellet and resuspend by gently pipetting cells up and down, resulting in a final volume of ~180 μl.
-
72
Divide cells into three 60 μl aliquots using fresh, pre-chilled 1.7-ml microcentrifuge tubes. Keep cells cold.
Multiple aliquots are generated to include backups in case arcing or accidents occur during downstream electroporation.
-
73
Add 2 μl of previously linearized recombineering template for selection genetics (“Csp-Kan/G418”, see Basic Protocol 1) to one 60 μl aliquot of electrocompetent, induced EL350 strain cells, containing the P[acman]-ChlR BAC clone already modified with the “Csp-EGFP-N” recombineering template.
-
74
Transfer electrocompetent cell/linearized recombineering template mixture to a prechilled 1 mm electroporation cuvette.
-
75
Gently tap cuvette 2 to 3 times to remove any air bubbles, and wipe away any moisture on the cuvette using a Kimwipe prior to electroporation.
-
76
Transfer electroporation cuvette containing electrocompetent cell/plasmid mixture to an electroporation pod connected to an electroporator, and electroporate at 25 μF, 200 Ohm, and 1.8 kV (Figure 7).
-
77
Immediately after electroporation, add 450 μl of 2xLB-0.5 medium to the cuvette, transfer electroporated cells back to the 1.7-ml microcentrifuge tube, and transfer tube to a 32°C shaking incubator, by taping microcentrifuge tube to the shaker at an angle to ensure maximal aeration of culture.
-
78
Allow cells to recover at 32°C, shaking for 1 hour.
-
79
Plate 50 μl of recovered cells onto bacterial plates containing 1xLB agar supplemented with kanamycin (15 μg/ml) and ampicillin (50 μg/ml) using glass spreading beads (Figure 7).
Recombineering using linearized recombineering templates encoding other resistance/selection markers will require supplementation with antibiotics appropriate for their respective resistance markers:- Template encoding the PuroR resistance marker requires Puromycin HCl (100 μg/ml).
- Template encoding the BlastR resistance marker requires Blasticidin S (100 μg/ml).
- Template encoding the HygroR resistance marker requires Hygromycin B (75 μg/ml).
-
80
Remove glass spreading beads and place plates into a 32°C incubator and let grow overnight. This should yield plenty of colonies to confirm recombineering occurred.
Step 79 and Step 80 are to confirm that the serial recombineering workflow can continue. Most of the times, plenty of colonies are observed, and the workflow can continue. Rarely, no colonies are present, and the workflow will have to be repeated, starting from Step 32.
-
81
In parallel, add 250 μl of recovered cells to 2.5 ml of 1xLB-0.5 supplemented with kanamycin (15 μg/ml) and ampicillin (50 μg/ml) in a 50 ml conical tube. Grow the inoculated culture overnight shaking at 32°C. Angle the conical for maximal aeration.
Recombineering using linearized recombineering templates encoding other resistance/selection markers will require supplementation with antibiotics, appropriate for their respective resistance markers as in Step 79.
-
82
Check the plate grown at 32°C for colonies.
-
83
Dilute the overnight culture by adding 50 μl to 5 ml of 1xLB-0.5 supplemented with kanamycin (15 μg/ml) and ampicillin (50 μg/ml) in a 50 ml conical tube (1:100 dilution). Grow the inoculated culture a second time overnight shaking at 32°C. Angle the conical tube for maximal aeration.
Recombineering using linearized recombineering templates encoding other resistance/selection markers will require supplementation with antibiotics, appropriate for their respective resistance markers as in Step 79.
Cre recombinase induction to remove unwanted sequences introduced during recombineering and finalize a P[acman] BAC plasmid for fluorescent protein tagging and selection genetics in Drosophila melanogaster
-
84
Add 500 μl of saturated culture to 4.5 ml of fresh 1xLB-0.5 supplemented with kanamycin (15 μg/ml) and 50 μl of 10% L-(+)-Arabinose in a 50 ml conical tube (1:100 dilution) (Figure 7). Do NOT add ampicillin, since Cre recombinase will catalyze recombination between both LoxP sites flanking the ampicillin resistance marker and remove it.
Previously used recombineering templates encoding other resistance/selection markers will require supplementation with antibiotics, appropriate for their respective resistance markers as mentioned above in Step 79.
-
85
Grow the diluted culture for 5 hours shaking at 32°C. Angle the conical tube for maximal aeration.
Purification of a selectable and tagged P[acman] BAC plasmid from the recombineering strain
-
86
Spin down each culture for 5 minutes at 4,000g using a refrigerated tabletop centrifuge that can accommodate 14-ml tubes. Decant the supernatant.
OPTIONAL: Freeze pellet at −20°C or −80°C for at least 30 minutes prior to proceeding to the next step. Freezing the pellet will simplify resuspension of bacterial pellet for DNA isolation purposes.
-
87
Isolate the serially recombineered CH322–06D09 P[acman] BAC DNA using the ChargeSwitch Pro Plasmid Miniprep kit according to the manufacturer’s instructions, and a tabletop microcentrifuge that can accommodate 1.7-ml tubes (Figure 7).
-
88
Elute DNA in 100 μl of EB buffer. Measure the concentration using a spectrophotometer.
-
89
Dilute the serially recombineered CH322–06D09 P[acman] BAC clone with MilliQ H2O to a final concentration of 1 ng/μl.
Transformation of the selectable and tagged P[acman] BAC plasmid into the bacterial strain for plasmid copy number control
-
90
Retrieve one 1.7-ml microcentrifuge tube containing a 50 μl aliquot of electrocompetent cells for the bacterial strain for plasmid copy number control (EPI300) (see Basic Protocol 2) from the ultrafreezer (−80°C) and thaw on ice in ice bucket.
-
91
Using refrigerated MilliQ H2O, make a 1/4 to 1/8 dilution of this aliquot totaling 200 to 400 μl.
-
92
Divide diluted cells in four to eight 50 μl aliquots (depending on the number of P[acman] BAC clones being serially recombineered).
-
93
Add 1 μl of diluted serially recombineered CH322–06D09 P[acman] BAC plasmid to 50 μl of diluted, chilled EPI300 plasmid copy control strain cells.
-
94
Transfer electrocompetent cell/plasmid mixture to a prechilled 1 mm electroporation cuvette.
-
95
Gently tap cuvette 2 to 3 times to remove any air bubbles, and wipe away any moisture on the cuvette using a Kimwipe prior to electroporation.
-
96
Transfer electroporation cuvette containing electrocompetent cell/plasmid mixture to electroporation pod connected to an electroporator, and electroporate at 25 μF, 200 Ohm, and 1.8 kV (Figure 7).
-
97
Immediately after electroporation, add 450 μl of 2xLB-0.5 medium to the cuvette, transfer electroporated cells back to the 1.7-ml microcentrifuge tube, and transfer tube to a 32°C shaking incubator, by taping microcentrifuge tube to the shaker at an angle to ensure maximal aeration of culture.
-
98
Allow cells to recover at 32°C, shaking for 1 hour.
-
99
Plate 50 μl of recovered cells onto bacterial plates containing 1xLB agar supplemented with kanamycin (50 μg/ml) using glass spreading beads.
Previously used recombineering templates encoding other resistance/selection markers will require supplementation with antibiotics, appropriate for their respective resistance markers:- Template encoding the PuroR resistance marker requires Puromycin HCl (100 μg/ml).
- Template encoding the BlastR resistance marker requires Blasticidin S (100 μg/ml).
- Template encoding the HygroR resistance marker requires Hygromycin B (75 μg/ml).
-
100
Remove glass spreading beads and place plates into a 32°C incubator and let grow overnight. This should yield plenty of colonies.
High-copy number purification and verification of a selectable and tagged P[acman] BAC plasmid for fluorescent protein tagging and selection genetics in Drosophila melanogaster
-
101
Pick two single colonies using a disposable inoculation loop and inoculate into a 14-ml disposable culture tube containing 5 ml of 2xLB-0.5 medium supplemented with kanamycin (15 μg/ml), and 10 μl of CopyControl Fosmid Autoinduction Solution (Figure 7). These are the plasmid copy number induced cultures.
Previously used recombineering templates encoding other resistance/selection markers will require supplementation with antibiotics, appropriate for their respective resistance markers as in Step 99.
Grow up separate 14-ml disposable culture tubes containing 5 ml of 2xLB-0.5 medium supplemented with kanamycin (15 μg/ml), but without CopyControl Fosmid Autoinduction Solution. These are the plasmid copy number uninduced cultures and will be used to make glycerol stocks.
-
102
Grow the cultures overnight in a shaking incubator at 32°C. Angle tubes for maximal aeration.
-
103
For each plasmid copy number induced culture, spin down overnight grown culture for 5 minutes at 4,000g using a refrigerated tabletop centrifuge that can accommodate 14-ml tubes. Decant the supernatant.
OPTIONAL: Freeze pellet at −20°C or −80°C for at least 30 minutes prior to proceeding to the next step. Freezing the pellet will simplify resuspension of bacterial pellet for DNA isolation purposes.
-
104
For each plasmid copy number uninduced culture, set aside 0.25 ml of each overnight grown culture in a 1.7-ml microcentrifuge tube and add 0.25 ml of 40% glycerol to make glycerol stocks. Move glycerol stocks to an ultrafreezer at −80°C.
-
105
Isolate serially recombineered CH322–06D09 P[acman] BAC DNA from the plasmid copy number induced cultures using the ChargeSwitch Pro Plasmid Miniprep kit according to the manufacturer’s instructions, and a tabletop microcentrifuge that can accommodate 1.7-ml tubes (Figure 7).
-
106
Elute DNA in 100 μl of EB buffer. Measure the concentration using a spectrophotometer.
-
107Verify the identity of the isolated serially recombineered CH322–06D09 P[acman] BAC plasmid via restriction enzyme DNA fingerprinting using restriction enzymes that result in unique DNA fingerprinting patterns when compared to the unmodified P[acman] BAC plasmid (Figure 7 and Figure 8):
- 400 ng of plasmid
- 2.5 μl of rCutSmart buffer
- 0.5 μl of EcoRI-HF, XhoI, or XbaI
-
MilliQ H2O up to 25 μlWe recommend using a DNA manipulation software package to simulate the enzyme digest before performing the experimental digestions. We use the SnapGene software (SnapGene, https://www.snapgene.com/) to help us plan our digests, though several alternatives are available.
-
108
Digest plasmids at 37°C for at least one hour.
-
109
After digestion, briefly vortex and spin down samples.
-
110
Add DNA loading buffer.
-
111
Run your samples on a 0.8% agarose gel and after visualization using a gel documentation system, confirm by comparing the actual enzyme digest to the one in silico predicted by Snapgene.
-
112
Perform Sanger DNA sequencing across recombineered sections of the plasmid, i.e., entire recombineering templates, to ensure no mutations occurred during oligo synthesis of the primers for PCR amplification and/or the PCR amplification of the recombineering templates.
-
113
Separate DNA samples and glycerol stocks of confirmed serially recombineered CH322–06D09 P[acman] BAC clones for long term storage at −20°C and −80°C, respectively.
-
114
The final plasmid is the serially recombineered KanR/G418R-selectable CH322–06D09 P[acman] BAC containing N-terminally EGFP-tagged Csp (Figure 9A).
-
115
Perform drug-based selection transgenesis as detailed in an accompanying Current Protocols article (Current Protocols #1).
-
116
Determine gene expression patterns (Figure 9B).
Figure 8. Verification of the serially recombineered KanR/G418R-selectable CH322–06D09 P[acman] BAC containing the N-terminally EGFP-tagged synaptic vesicle protein, Cysteine string protein (Csp).

(Top) Simplified schematics of the unmodified and modified CH322–06D09 P[acman] BAC clone covering the gene encoding the synaptic versicle protein Cysteine string protein (Csp). P[acman] BAC library clones contain a ФC31 attB attachment site for site-specific transgenesis into genomic docking sites containing ФC31 attP attachment sites located in the Drosophila melanogaster genome. Transgenesis events can be screened for using the dominant eye color marker, white+. Serial recombineering introduces a resistance marker (G418R) for selectable transgenesis, and an N-terminal fluorescent protein tag (EGFP) for gene expression and proteomic analysis. (Bottom) Simulated gels showing restriction enzyme DNA fingerprinting for the unmodified and modified CH322–06D09 P[acman] BAC clone. Restriction enzymes EcoRI-HF (Left), XhoI (Middle), and XbaI (Right) were chosen to produce distinct differences in DNA bands, as highlighted, once digested plasmids were visualized on a 0.8% agarose gel. In addition to digested plasmids, uncut original and modified clones are shown. Though not visually distinct, the uncut lanes provide information on any potential contaminant DNA or other gross defects in the DNA preparation. Simulated agarose gels were produced using the SnapGene cloning software (v6.1, www.snapgene.com).
Figure 9. Example of gene expression patterns obtained after serial recombineering cloning to generate selectable, tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster: the synaptic vesicle protein Cysteine string protein (Csp) as an example.

(A) Simplified schematic of the experimental workflow to obtain a gene expression pattern from a transgenic fly containing a serially recombineered P[acman] BAC: The synaptic vesicle protein Cysteine string protein (Csp) as an example. A transgenic fly of the serially recombineered CH322–06D09 P[acman] BAC, covering Csp, is generated by microinjection, followed by transgenic animal selection with G418 sulfate (see Current Protocols #1), and gene expression analysis. (B) Expression analysis of a transgenic fly containing a serially recombineered P[acman] BAC: The synaptic vesicle protein Cysteine string protein (Csp) as an example. Expression patterns obtained from the transgenic fly containing the serially recombineered CH322–06D09 P[acman] BAC reporter transgene for Csp shows protein expression in both the larval (B1’-B1”’) and adult (B2’-B2”’) central nervous system (CNS). Panels on the left represent staining against EGFP (B1’ and B2’), panels in the middle represent staining against the Drosophila melanogaster Cysteine string protein (dCSP) (B1” and B2”), and panels on the right represent the merge between the two staining patterns (B1”’ and B2”’). Csp is involved in synaptic vesicle release and stains the neuropil very broadly in both larval (B1’-B1”’) and adult (B2’-B2”’) CNS. The staining pattern of the EGFP tag is nearly identical to monoclonal antibody staining against dCSP in both larval (B1”’) and adult CNS (B2”’). Scale bars represent 50 μm. Primary antibodies used are polyclonal rabbit anti-GFP (Invitrogen A-11122, 1/500) and mouse monoclonal anti-dCSP (Developmental Studies Hybridoma Bank, Ab49, 1/100). Secondary antibodies are chicken anti-rabbit AlexaFluor 488 (Invitrogen A-21441, 1/500) and goat anti-mouse AlexaFluor568 (Invitrogen A-11004, 1/500). The images represent maximum intensity projection stacks obtained on a Zeiss Axio Imager M2 with an ApoTome2 and processed using Zen software Blue Version 2.3 pro HWL. Detailed staining protocols are described elsewhere (Matinyan et al., 2021b; Gnerer et al., 2015).
REAGENTS AND SOLUTIONS
1xLB bacterial agar solution for bacterial plates (per liter):
10 g tryptone (VWR, cat. no. 97063–390)
5 g yeast extract (Alfa Aesar, cat. no. H26769–22)
5 g NaCl (Alfa Aesar, cat. no. A12313–0B)
10 g agar (Fisher Scientific, cat. no. BP1423–2)
Deionized water up to 1 liter
Sterilize by autoclaving
1xLB-0.5 bacterial growth medium (per liter):
10 g tryptone (WVR, cat. no. 97063–390)
5 g yeast extract (Alfa Aesar, cat. no. H26769–22)
5 g NaCl (Alfa Aesar, cat. no. A12313–0B)
Deionized water up to 1 liter
Sterilize by autoclaving
2xLB-0.5 bacterial growth medium (per liter):
20 g tryptone (WVR, cat. no. 97063–390)
10 g yeast extract (Alfa Aesar, cat. no. H26769–22)
5 g NaCl (Alfa Aesar, cat. no. A12313–0B)
Deionized water up to 1 liter
Sterilize by autoclaving
COMMENTARY
Background information
Since the identification of the white eye mutant by Thomas Hunt Morgan (Morgan, 1910; Bellen and Yamamoto, 2015), the fruit fly Drosophila melanogaster has served as a key animal model system for the study of basic biology and, more recently, human disease (Bellen et al., 2019; Bier, 2005; Venken et al., 2016; Venken and Bellen, 2007, 2014; Verheyen, 2022; Venken et al., 2011; Link et al., 2020; Mirzoyan et al., 2019; Harnish et al., 2021; Yamaguchi and Yoshida, 2018; Sonoshita and Cagan, 2017). These studies have greatly benefitted from a continuously expanding genetic toolkit that makes sophisticated genetic manipulation through transgenesis and genome engineering strategies unrivaled by any other animal model system (Venken et al., 2016; Venken and Bellen, 2007, 2014, 2005; Venken et al., 2011; Venken and Bellen, 2012; Zirin et al., 2021; Bier et al., 2018; Korona et al., 2017; Kanca et al., 2017; Bilder and Irvine, 2017).
One type of genetic approach, called genomic “rescue” transgenesis, is critical to prove that a mutation in a gene, obtained through forward or reverse genetics, is responsible for the observed phenotypes (Venken and Bellen, 2007, 2014, 2012; Venken et al., 2016). This approach uses a transgene with a genomic DNA fragment covering the wildtype counterpart of the mutated gene to complement the endogenous mutant version of the gene (Venken and Bellen, 2007, 2014, 2012; Venken et al., 2016). If complementation is successful, the rescue construct can be further manipulated for downstream applications, such as protein tagging to determine protein expression across tissues or establish subcellular protein distribution, or mutagenesis to perform structure/function analysis by testing different mutant variants in a null mutant background (Venken and Bellen, 2007, 2014). Traditionally, such rescue experiments were only done for small genes with genomic DNA fragments up to 10 to 20 kilobases (Venken and Bellen, 2007, 2014).
The opportunities for genomic rescue expanded significantly after the introduction of the P/ФC31 artificial chromosome for manipulation or the P[acman] transgenesis platform (Venken et al., 2006). By combining three powerful technologies, recombineering (Sharan et al., 2009; Thomason et al., 2007, 2014), conditionally amplifiable BACs (Wild et al., 2002), and ФC31 site-specific integration (Groth et al., 2004; Bischof et al., 2007), the P[acman] approach made it possible to site-specifically integrate transgenes with inserts up to 133 kilobases at defined sites in the fly genome (Venken et al., 2006). Recombineering allowed the retrieval and cloning of genomic DNA inserts up to 133 kb (Venken et al., 2006). The conditionally amplifiable BAC backbone ensured the stability of large constructs at low copy number but conveniently allowed artificial induction towards high copy number (Wild et al., 2002), facilitating DNA purification for verification and microinjection purposes (Venken et al., 2006). The ФC31 integrase allowed the site-specific integration of attB containing P[acman] BAC clones into defined attP docking sites located in the fly genome (Venken et al., 2006; Groth et al., 2004; Bischof et al., 2007; Markstein et al., 2008).
The utility of the P[acman] system was further expanded by creating three genomic DNA libraries for Drosophila melanogaster: the CHORI-322 and CHORI-321 P[acman] libraries, with insert sizes averaging 21 and 83 kilobases, respectively (Venken et al., 2009), and the FlyFos library, with an insert size averaging 36 kilobases (Ejsmont et al., 2009). The three libraries were end-sequenced and annotated onto the reference fly genome, providing a 15-fold genome coverage, and allowing rescue of more than 95% of all annotated fly genes. The functionality of the three libraries was tested by integrating numerous clones into attP docking sites and showing that they rescue phenotypes associated with known mutations in the corresponding region of interest (Venken et al., 2009, 2010; Ejsmont et al., 2009; Sarov et al., 2016).
Moreover, the amplifiable plasmid copy-number nature of P[acman] and FlyFos clones greatly facilitates the introduction of modifications by recombineering (Thomason et al., 2014, 2007; Sharan et al., 2009). Modifications, such as tags and mutations, are introduced at low copy number and fixed within a bacterial colony prior to plasmid copy number amplification for plasmid purification for microinjection. Recombineering has been used with P[acman] and FlyFos to introduce mutations in essential codons or deletions of regulatory elements for structure/function analysis (Pepple et al., 2008; Perry et al., 2010; Enneking et al., 2013; Cassidy et al., 2013; Leonardi et al., 2011; Leonardi and Jafar-Nejad, 2014), incorporate protein tags for visualization of protein expression or acute protein inactivation (Verstreken et al., 2005; Venken et al., 2008, 2009; Verstreken et al., 2009; Nègre et al., 2011; Ejsmont et al., 2009; Sarov et al., 2016; Avellaneda and Schnorrer, 2022) and integrate binary factors (e.g., GAL4 or QF) for cellular labeling (Stowers, 2011).
The introduction of transgenes, such as P[acman] and FlyFos clones, in the fly begins with microinjection of the plasmid containing the transgene coupled to a dominant physical screening marker into early-stage embryos targeting the future germline (Venken and Bellen, 2007). Resulting adult flies may carry transformed germ cells that upon crossing will produce transgenic offspring identifiable via marker expression. Transgenic animals are collected by manually screening all progeny for visual signs of the marker which, depending on the efficiency of the transgenesis, can be laborious (Venken et al., 2006, 2009; Venken and Bellen, 2007; Venken et al., 2010). This is especially true in the case of transgenesis involving large transgenes such as P[acman] BAC (Venken et al., 2006, 2010, 2009) and FlyFos fosmid transgenes (Ejsmont et al., 2009), since transgenesis efficiency is inversely correlated with transgene size.
An alternative to visual screening markers, is the use of drug resistance gene markers which allow for drug-based selection for transgenic, drug-resistant progeny (Matinyan et al., 2021b, 2021a; Steller and Pirrotta, 1985). Only transgenic animals expressing the resistance marker survive selection, eliminating the need to manually screen for putative transgenic progeny (Steller and Pirrotta, 1985; Matinyan et al., 2021a, 2021b). In addition, as drug resistance markers are exogenous to the fly, drug-based selection can be used in any genetic background, unlike many physical screening markers that require the use of marker null allele genotypes (Matinyan et al., 2021a, 2021b; Venken and Bellen, 2007). Since their advent in Drosophila in the form of a P-element transposon, selection makers have been used to great effect as part of drug-selectable transgenesis strategies in several model and non-model organisms (Cornes et al., 2014; Giordano-Santini et al., 2010; Kandul et al., 2020; Matinyan et al., 2021a, 2021b; Semple et al., 2010; Steller and Pirrotta, 1985; Volohonsky et al., 2015).
We recently described four selectable markers that provide drug resistance, for a variety of genetic manipulation workflows using Drosophila melanogaster (Matinyan et al., 2021a, 2021b). Each marker is integrated within a compact expression cassette that encompasses a fusion promoter with both eukaryotic and prokaryotic properties, a gene encoding the selection/resistance, and a minimal transcriptional terminator (see Current Protocols #1) (Matinyan et al., 2021b). The four selection markers integrated within this compact expression cassette are the genes encoding Neomycin phosphotransferase II, Puromycin HCl N-acetyltransferase, Blasticidin S-resistance, and Hygromycin B phosphotransferase, providing animal resistance against G418 sulfate, Puromycin HCl, Blasticidin S, and Hygromycin B, respectively (see Current Protocols #1) (Matinyan et al., 2021b). By integrating these resistance markers into P[acman] BAC transgenes, we were able to isolate animals containing these large transgenes by direct selection, avoiding laborious screening (Matinyan et al., 2021b).
Critical parameters
Good-quality nicked circular or supercoiled, freshly purified P[acman] BAC DNA is necessary for electroporating into the EL350 recombineering or any other bacterial strain. This becomes increasingly more important for larger plasmids: DNA purified for clones from the CHORI-321 library (insert size averaging 83 kilobases) are more sensitive compared to DNA purified for clones from the CHORI-322 library (insert size averaging 21 kilobases). Always store purified P[acman] BAC DNA at −20°C.
Pick two to three colonies from each recombineering reaction, and you will likely find a correctly recombineered clone after restriction enzyme DNA fingerprinting.
Find good and cheap restriction enzymes (e.g., EcoRI, XhoI, XbaI, and BamHI) to verify recombineering reactions by restriction enzyme DNA fingerprinting. This is key for verification of correctly recombineered clones using the unmodified P[acman] BAC clone as control. You should do at least two parallel digestions that cut your recombineered product into very distinctive DNA fragments. Recombineering reactions using larger P[acman] BAC plasmids need more parallel digestions to confirm correct recombineering.
Run uncut DNA while you run the different plasmid digestions during agarose gel electrophoresis. Uncut plasmid produces two bands on a gel, representing the open-circular (i.e., nicked) and supercoiled DNA (i.e., uncut). At the same overall size, supercoiled DNA runs faster than open circular DNA. A relaxed plasmid configuration (i.e., cut) is likely present as well for P[acman] BAC plasmids, generating a third band running between supercoiled and open circular DNA for clones obtained from the CHORI-322 library, since regular agarose gel electrophoreses can’t distinguish between bands that are larger than 30 to 40 kilobase, i.e., a linearized 30 kilobase plasmid will essentially run at the same height of a linearized 40 kilobase plasmid, and so on. Uncut DNA will inform you of unwanted plasmid dimerization, which will produce bands of a larger size than expected.
Troubleshooting
Issues with PCR amplification of recombineering cassettes
The protocol we provide should result in efficient, reproducible PCR amplification from any of the pre-built cassette template plasmids. If you encounter difficulties amplifying the cassettes, make sure that your primers are well designed with matching or nearly matching melting temperatures (Tm), end in G/C clamp, and have a GC% content ranging from 40 – 60 percent. Increasing the number of cycles in each step may result in better PCR yield as will increasing the amount of starting template DNA.
Issues with electrocompetency of the EL350 strain
If you find that your cells are not competent or are only slightly competent (i.e., good electrocompetent cells result in 108 to 109 of transformants per μg of DNA), it is likely that you allowed the cells to warm up too much during production of the cells, requiring that this step be redone. When making competent cells, it is critical to maintain the cells as cold as possible throughout the process. This can be a bit cumbersome as it requires that all solutions, reagents, and equipment are kept ice-cold at around 4°C. We routinely pre-chill microcentrifuge tubes, serological pipettes, bottles, solutions, and centrifuges. While growing up the cells, initially in baffled flasks, we routinely set the centrifuges spinning at 4°C to ensure that they will maintain an appropriate temperature when we spin down the cells. Cooling the centrifuge while it is stationary will result in a modest warming of the cells due to the friction of the spinning rotor.
Issues with DNA electroporation
Electroporation of DNA into electrocompetent cells should be smooth and highly efficient. If you encounter difficulties such as arcing during the electroporation this may mean that your cells were insufficiently washed and contain excess salts. Make sure that during making electrocompetent cells all supernatant is removed as much as possible before moving to the next step (see Basic Protocol 2). Other causes may be air bubbles trapped between the cuvette plates because of pipetting. Cuvettes should be gently tapped to remove any air bubbles prior to electroporation. Additionally, make sure that the external surfaces of the cuvette are free of moisture as this will also lead to arcing. Additional cause of arcing may be an excessive amount of added DNA, i.e., high ng (500 ng/μl) or low μg (1 μg/μl) amounts. Try diluting your DNA to low ng amounts (10 to 100 ng/μl) and attempting again or otherwise running a DNA clean-up step prior to electroporation.
Understanding results
Successful cloning and preparation of recombineering templates using GB2.0 assembly DNA cloning should yield white colonies containing the desired assembly product as verified by Type II restriction enzyme DNA fingerprinting and/or Sanger DNA sequencing. Besides DNA fingerprinting, we also encourage the user to run uncut plasmid in an additional lane for each of the cloned recombineering template plasmids to verify that there are no gross defects with the DNA prep. While rare, it is possible to see a correct DNA banding pattern after digestion but have the uncut lane show the vector to be the incorrect size. This happens when more than one assembled insert is cloned into a single vector backbone. Running uncut plasmid will help identify and discard these rare but anomalous outcomes. After an electroporation reaction, good quality electrocompetent cells should result in 108 to 109 of transformed bacteria per μg of DNA. Successful serial recombineering of P[acman] BAC clones should yield an aliquot of pure, concentrated modified BAC DNA. Verification is critical in assessing the quality and success of your recombineering attempts. Design enzymatic digestions that provide clear differences in banding patterns between the original and the modified P[acman] BAC clones. We typically perform two to four different restriction enzyme digestions of the plasmid DNA after recombineering reactions. Similarly, as above, we encourage the user to run uncut plasmid to ensure that there are no gross defects with the DNA prep.
Time considerations
The entirety of this protocol can be accomplished in approximately three weeks when organizing some overlap between the different Basic Protocols (Figure 10). While this may seem complicated, many of the protocol steps involve inoculating a culture or plating cells and growing them overnight, allowing for other steps to be accomplished concurrently.
Figure 10. Expected timeline to perform serial recombineering cloning to generate selectable, tagged genomic P[acman] BAC reporter transgenes for gene expression analysis in Drosophila melanogaster.

Gantt chart illustrating tasks and milestones for the three protocols (Basic Protocol 1, Basic Protocol 2, and Basic Protocol 3), as well as working days across 3 calendar weeks (D1 to D5), except for week 2, when weekend work is necessary (D6 and D7).
After necessary primers and plasmids arrive, the preparation of recombineering templates for fluorescent tagging and selection genetics (Basic Protocol 1, Figure 4, and Figure 5) can be accomplished in about 5 days: one day for the 2-step PCR amplification of recombineering cassettes for fluorescent protein tagging and selection genetics (Day 1); one day to set up the GoldenBraid 2.0 synthetic assembly cloning of the PCR-amplified recombineering cassettes, perform chemical transformation of the assembly reaction, and plate the transformation to single colonies (Day 2); one day to get single colonies on plates and start cultures for isolation of plasmids encoding recombineering templates (Day 3); one day for plasmid isolation, plasmid verification by restriction enzyme DNA fingerprinting, and submission for Sanger DNA sequencing (Day 4); and one day to analyze the results from Sanger DNA sequencing and linearize recombineering templates (Day 5).
The generation of electrocompetent cells for the EL350/SW106 and EPI300 bacterial strains (Basic Protocol 2) can be achieved in about 4 days during the same week set aside for Basic Protocol 1: one day to streak agar stabs and/or glycerol stocks for the EL350/SW106 and EPI300 bacterial strains to single colonies (Day 1), one day to get single colonies on plates and start cultures to make electrocompetent cells (Day 2), one day to make electrocompetent cells, test for electrocompetency, and plate to single colonies (Day 3), and one day to get colonies on plates to calculate electrocompetency (Day 4).
The serial recombineering workflow (Basic Protocol 3) can be accomplished in about 12 days spread over two weeks, including the weekend in between: one day to streak agar stabs and/or glycerol stocks for P[acman] BAC clones to single colonies (Day 1); one day to get single colonies on plates and start cultures for P[acman] BAC plasmid isolation (Day 2); one day for plasmid isolation, plasmid verification by restriction enzyme DNA fingerprinting, plasmid electroporation in the EL350/SW106 bacterial strain, and plating of the electroporation reaction (Day 3); one day to get single colonies on plates and start cultures for the EL350/SW106 strain containing P[acman] BAC clones (Day 4); one day to make electrocompetent cells, perform a first round of recombineering using the “fluorescent protein tagging” recombineering template and grow single recombineered cultures (Day 5); one day to dilute single recombineered cultures and allow for additional growth (Day 6); one day to make electrocompetent cells, perform a second round of recombineering using the “selection genetics” recombineering template and grow dual recombineered cultures (Day 7); one day to dilute the dual recombineered cultures and allow for additional growth (Day 8); one day to dilute the dual recombineered cultures a second time, perform Cre recombinase reduction of the dual recombineered cultures, isolate the dual-recombineered P[acman] BAC clone, electroporate into the EPI300 bacterial strain, and plate the electroporation reaction to single colonies (Day 9); one day to get single colonies on plates and start cultures for plasmid isolation of the dual recombineered P[acman] BAC clone (Day 10); one day for plasmid isolation, plasmid verification by restriction enzyme DNA fingerprinting, and submission for Sanger DNA sequencing (Day 11); and a final day to analyze the results from Sanger DNA sequencing (Day 12).
ACKNOWLEDGMENTS
This research was supported by external grants from the Foundation For Angelman Syndrome Therapeutics grant FT2016-002 (K.J.T.V.), the Cancer Prevention and Research Institute of Texas grant R1313 (K.J.T.V.), and the National Institutes of Health grants T32GM008231 (N.M.) R21HG006726 (K.J.T.V.), R21GM110190 (K.J.T.V.), R21OD022981 (K.J.T.V.), and R01MH107474, (H.A.D.).
Besides external grant funding, this work was additionally supported by internal start-up and seed funds kindly provided by Baylor College of Medicine (K.J.T.V.), the Albert and Margaret Alkek Foundation (K.J.T.V.), and the McNair Medical Institute at The Robert and Janice McNair Foundation (K.J.T.V.).
Footnotes
CONFLICT OF INTEREST STATEMENT
The authors declare no conflict of interest.
DATA AVAILABILITY STATEMENT
Data sharing is not applicable to this article as no new data were created or analyzed in this study.
LITERATURE CITED
- Avellaneda J, and Schnorrer F 2022. Tagging Drosophila Proteins with Genetically Encoded Fluorophores. Methods in Molecular Biology 2540:251–268. [DOI] [PubMed] [Google Scholar]
- Bellen HJ, Wangler MF, and Yamamoto S 2019. The fruit fly at the interface of diagnosis and pathogenic mechanisms of rare and common human diseases. Human Molecular Genetics 28:R207–R214. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bellen HJ, and Yamamoto S 2015. Morgan’s Legacy: Fruit Flies and the Functional Annotation of Conserved Genes. Cell 163:12–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bier E 2005. Drosophila, the golden bug, emerges as a tool for human genetics. Nature Reviews Genetics 6:9–23. [DOI] [PubMed] [Google Scholar]
- Bier E, Harrison MM, O’Connor-Giles KM, and Wildonger J 2018. Advances in Engineering the Fly Genome with the CRISPR-Cas System. Genetics 208:1–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bilder D, and Irvine KD 2017. Taking Stock of the Drosophila Research Ecosystem. Genetics 206:1227–1236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bischof J, Maeda RK, Hediger M, Karch F, and Basler K 2007. An optimized transgenesis system for Drosophila using germ-line-specific ϕC31 integrases. Proceedings of the National Academy of Sciences 104:3312–3317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cassidy JJ, Jha AR, Posadas DM, Giri R, Venken KJT, Ji J, Jiang H, Bellen HJ, White KP, and Carthew RW 2013. miR-9a Minimizes the Phenotypic Impact of Genomic Diversity by Buffering a Transcription Factor. Cell 155:1556–1567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cornes E, Quéré CAL, Giordano-Santini R, and Dupuy D 2014. Applying antibiotic selection markers for nematode genetics. Methods 68:403–408. [DOI] [PubMed] [Google Scholar]
- Dunst S, and Tomancak P 2019. Imaging Flies by Fluorescence Microscopy: Principles, Technologies, and Applications. Genetics 211:15–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ejsmont RK, Sarov M, Winkler S, Lipinski KA, and Tomancak P 2009. A toolkit for high-throughput, cross-species gene engineering in Drosophila. Nature Methods 6:435–437. [DOI] [PubMed] [Google Scholar]
- Enneking E-M, Kudumala SR, Moreno E, Stephan R, Boerner J, Godenschwege TA, and Pielage J 2013. Transsynaptic Coordination of Synaptic Growth, Function, and Stability by the L1-Type CAM Neuroglian. PLoS Biology 11:e1001537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Giordano-Santini R, Milstein S, Svrzikapa N, Tu D, Johnsen R, Baillie D, Vidal M, and Dupuy D 2010. An antibiotic selection marker for nematode transgenesis. Nature Methods 7:721–723. [DOI] [PubMed] [Google Scholar]
- Gnerer JP, Venken KJT, and Dierick HA 2015. Gene-specific cell labeling using MiMIC transposons. Nucleic Acids Research 43:e56–e56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gohl DM, Morante J, and Venken KJT 2017. Decoding Neural Circuit Structure and Function, Cellular Dissection Using Genetic Model Organisms. Decoding Neural Circuit Structure and Function, Cellular Dissection Using Genetic Model Organisms:3–39. [Google Scholar]
- Gramates LS, Agapite J, Attrill H, Calvi BR, Crosby MA, Santos G. dos, Goodman JL, Goutte-Gattat D, Jenkins VK, Kaufman T, et al. 2022. FlyBase: a guided tour of highlighted features. Genetics 220:iyac035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Groth AC, Fish M, Nusse R, and Calos MP 2004. Construction of Transgenic Drosophila by Using the Site-Specific Integrase From Phage C31. Genetics 166:1775–1782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harnish JM, Link N, and Yamamoto S 2021. Drosophila as a Model for Infectious Diseases. International Journal of Molecular Sciences 22:2724. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kanca O, Bellen HJ, and Schnorrer F 2017. Gene Tagging Strategies To Assess Protein Expression, Localization, and Function in Drosophila. Genetics 207:389–412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kandul NP, Liu J, Hsu AD, Hay BA, and Akbari OS 2020. A drug-inducible sex-separation technique for insects. Nature Communications 11:2106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Korona D, Koestler SA, and Russell S 2017. Engineering the Drosophila Genome for Developmental Biology. Journal of Developmental Biology 5:16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee E-C, Yu D, Velasco J. M. de, Tessarollo L, Swing DA, Court DL, Jenkins NA, and Copeland NG 2001. A Highly Efficient Escherichia coli-Based Chromosome Engineering System Adapted for Recombinogenic Targeting and Subcloning of BAC DNA. Genomics 73:56–65. [DOI] [PubMed] [Google Scholar]
- Leonardi J, Fernandez-Valdivia R, Li Y-D, Simcox AA, and Jafar-Nejad H 2011. Multiple O-glucosylation sites on Notch function as a buffer against temperature-dependent loss of signaling. Development 138:3569–3578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leonardi J, and Jafar-Nejad H 2014. Structure-Function Analysis of Drosophila Notch Using Genomic Rescue Transgenes. Methods in Molecular Biology 1187:29–46. [DOI] [PubMed] [Google Scholar]
- Link N, Bellen HJ, Dunwoodie S, and Wallingford J 2020. Using Drosophila to drive the diagnosis and understand the mechanisms of rare human diseases. Development 147:dev191411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Markstein M, Pitsouli C, Villalta C, Celniker SE, and Perrimon N 2008. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nature Genetics 40:476–483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Matinyan N, Gonzalez Y, Dierick HA, and Venken KJT 2021a. Determining effective drug concentrations for selection and counterselection genetics in Drosophila melanogaster. STAR Protocols 2:100783. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Matinyan N, Karkhanis MS, Gonzalez Y, Jain A, Saltzman A, Malovannaya A, Sarrion-Perdigones A, Dierick HA, and Venken KJT 2021b. Multiplexed drug-based selection and counterselection genetic manipulations in Drosophila. Cell Reports 36:109700–109700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mirzoyan Z, Sollazzo M, Allocca M, Valenza AM, Grifoni D, and Bellosta P 2019. Drosophila melanogaster: A Model Organism to Study Cancer. Frontiers in Genetics 10:51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morgan TH 1910. Sex Limited Inheritance in Drosophila. Science 32:120–122. [DOI] [PubMed] [Google Scholar]
- Nègre N, Brown CD, Ma L, Bristow CA, Miller SW, Wagner U, Kheradpour P, Eaton ML, Loriaux P, Sealfon R, et al. 2011. A cis-regulatory map of the Drosophila genome. Nature 471:527–531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pepple KL, Atkins M, Venken K, Wellnitz K, Harding M, Frankfort B, and Mardon G 2008. Two-step selection of a single R8 photoreceptor: a bistable loop between senseless and rough locks in R8 fate. Development 135:4071–4079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perry MW, Boettiger AN, Bothma JP, and Levine M 2010. Shadow Enhancers Foster Robustness of Drosophila Gastrulation. Current Biology 20:1562–1567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarov M, Barz C, Jambor H, Hein MY, Schmied C, Suchold D, Stender B, Janosch S, KJ VV, Krishnan R, et al. 2016. A genome-wide resource for the analysis of protein localisation in Drosophila. eLife 5:e12068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarrion-Perdigones A, Chang L, Gonzalez Y, Gallego-Flores T, Young DW, and Venken KJT 2019. Examining multiple cellular pathways at once using multiplex hextuple luciferase assaying. Nature Communications 10:5710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarrion-Perdigones A, Gonzalez Y, and Venken KJT 2020. Rapid and Efficient Synthetic Assembly of Multiplex Luciferase Reporter Plasmids for the Simultaneous Monitoring of Up to Six Cellular Signaling Pathways. Current Protocols in Molecular Biology 131:e121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarrion-Perdigones A, Gonzalez Y, and Venken KJT 2022. Synthetic Assembly DNA Cloning of Multiplex Hextuple Luciferase Reporter Plasmids. Methods in Molecular Biology 2524:409–432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarrion-Perdigones A, Vazquez-Vilar M, Palací J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, and Orzaez D 2013. GoldenBraid 2.0: A Comprehensive DNA Assembly Framework for Plant Synthetic Biology. Plant Physiology 162:1618–1631. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Semple JI, Garcia-Verdugo R, and Lehner B 2010. Rapid selection of transgenic C. elegans using antibiotic resistance. Nature Methods 7:725–727. [DOI] [PubMed] [Google Scholar]
- Sharan SK, Thomason LC, Kuznetsov SG, and Court DL 2009. Recombineering: a homologous recombination-based method of genetic engineering. Nature Protocols 4:206–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sonoshita M, and Cagan RL 2017. Modeling Human Cancers in Drosophila. Current Topics in Developmental Biology 121:287–309. [DOI] [PubMed] [Google Scholar]
- Steller H, and Pirrotta V 1985. A transposable P vector that confers selectable G418 resistance to Drosophila larvae. The EMBO Journal 4:167–171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stowers RS 2011. An efficient method for recombineering GAL4 and QF drivers. Fly 5:371–378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thomason LC, Sawitzke JA, Li X, Costantino N, and Court DL 2014. Recombineering: Genetic Engineering in Bacteria Using Homologous Recombination. Current Protocols in Molecular Biology 106:1.16.1–1.16.39. [DOI] [PubMed] [Google Scholar]
- Thomason L, Court DL, Bubunenko M, Costantino N, Wilson H, Datta S, and Oppenheim A 2007. Recombineering: Genetic Engineering in Bacteria Using Homologous Recombination. Current Protocols in Molecular Biology 78:1.16.1–1.16.24. [DOI] [PubMed] [Google Scholar]
- Venken KJT, and Bellen HJ 2014. Chemical mutagens, transposons, and transgenes to interrogate gene function in Drosophila melanogaster. Methods 68:15–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Venken KJT, and Bellen HJ 2005. Emerging technologies for gene manipulation in Drosophila melanogaster. Nature Reviews Genetics 6:167–178. [DOI] [PubMed] [Google Scholar]
- Venken KJT, and Bellen HJ 2012. Genome-wide manipulations of Drosophila melanogaster with transposons, Flp recombinase, and ϕC31 integrase. Methods in Molecular Biology 859:203–228. [DOI] [PubMed] [Google Scholar]
- Venken KJT, and Bellen HJ 2007. Transgenesis upgrades for Drosophila melanogaster. Development (Cambridge, England) 134:3571–84. [DOI] [PubMed] [Google Scholar]
- Venken KJT, Carlson JW, Schulze KL, Pan H, He Y, Spokony R, Wan KH, Koriabine M, Jong P. J. de, White KP, et al. 2009. Versatile P[acman] BAC libraries for transgenesis studies in Drosophila melanogaster. Nature methods 6:431–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Venken KJT, He Y, Hoskins RA, and Bellen HJ 2006. P[acman]: A BAC Transgenic Platform for Targeted Insertion of Large DNA Fragments in D. melanogaster. Science 314:1747–1751. [DOI] [PubMed] [Google Scholar]
- Venken KJT, Kasprowicz J, Kuenen S, Yan J, Hassan BA, and Verstreken P 2008. Recombineering-mediated tagging of Drosophila genomic constructs for in vivo localization and acute protein inactivation. Nucleic Acids Research 36:e114–e114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Venken KJT, Popodi E, Holtzman SL, Schulze KL, Park S, Carlson JW, Hoskins RA, Bellen HJ, and Kaufman TC 2010. A Molecularly Defined Duplication Set for the X Chromosome of Drosophila melanogaster. Genetics 186:1111–1125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Venken KJT, Sarrion-Perdigones A, Vandeventer PJ, Abel NS, Christiansen AE, and Hoffman KL 2016. Genome engineering: Drosophila melanogaster and beyond. Wiley Interdisciplinary Reviews: Developmental Biology 5:233–267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Venken KJT, Simpson JH, and Bellen HJ 2011. Genetic Manipulation of Genes and Cells in the Nervous System of the Fruit Fly. Neuron 72:202–230. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Verheyen EM 2022. The power of Drosophila in modeling human disease mechanisms. Disease Models & Mechanisms 15:dmm049549. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Verstreken P, Ly CV, Venken KJT, Koh T-W, Zhou Y, and Bellen HJ 2005. Synaptic Mitochondria Are Critical for Mobilization of Reserve Pool Vesicles at Drosophila Neuromuscular Junctions. Neuron 47:365–378. [DOI] [PubMed] [Google Scholar]
- Verstreken P, Ohyama T, Haueter C, Habets RLP, Lin YQ, Swan LE, Ly CV, Venken KJT, Camilli PD, and Bellen HJ 2009. Tweek, an Evolutionarily Conserved Protein, Is Required for Synaptic Vesicle Recycling. Neuron 63:203–215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Volohonsky G, Terenzi O, Soichot J, Naujoks DA, Nolan T, Windbichler N, Kapps D, Smidler AL, Vittu A, Costa G, et al. 2015. Tools for Anopheles gambiae Transgenesis. G3: Genes|Genomes|Genetics 5:1151–1163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Voytas D 2001. Agarose gel electrophoresis. Current Protocols in Molecular Biology Chapter 2:2.5A.1–2.5A.9. [DOI] [PubMed] [Google Scholar]
- Warming S, Costantino N, Court DL, Jenkins NA, and Copeland NG 2005. Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Research 33:e36–e36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wild J, Hradecna Z, and Szybalski W 2002. Conditionally Amplifiable BACs: Switching From Single-Copy to High-Copy Vectors and Genomic Clones. Genome Research 12:1434–1444. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yamaguchi M, and Yoshida H 2018. Drosophila as a Model Organism. Advances in Experimental Medicine and Biology 1076:1–10. [DOI] [PubMed] [Google Scholar]
- Zirin J, Bosch J, Viswanatha R, Mohr SE, and Perrimon N 2021. State-of-the-art CRISPR for in vivo and cell-based studies in Drosophila. Trends in Genetics 38:437–453. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data sharing is not applicable to this article as no new data were created or analyzed in this study.
