Abstract
Background:
Breast Cancer (BC) is a genetically and clinically heterogeneous disease including complex interactions between gene-gene and gene-environment components. This study aimed, to explore whether the Glutathione S- transferase (GSTs) gene polymorphism has role in BC susceptibility. We further evaluated the frequency of four subtypes of BC based on molecular classification followed by microscopic histological analysis to study the grades of invasive ductal carcinoma (IDC).
Materials and Method:
Polymorphism in GST genes in North-Indian BC patients was assessed by multiplex-PCR and PCR-RFLP methods. 105 BC patients and 145 healthy controls were enrolled for this study. Data was analyzed by calculating the odds ratio (OR) and 95% CI from logistic regression analyses.
Results:
Our findings revealed that GSTM1 null genotype (OR = 2.231; 95% CI = 1.332–3.737; p-value= 0.002) is significantly associated to BC risk in ethnic North- Indian population. However, the risk for BC susceptibility in North–Indians does not appear to be associated with GSTT1 null genotype. The GSTP1 (Val/Val) genotype (OR=1.545; CI=0.663-3.605; p-value= 0.314) was also found to be susceptible for BC risk. Combination of three high risk GST genotypes association exhibiting gene-gene interaction further confirmed the increased risk to BC in this region.
Conclusions:
The results of present study indicated that polymorphism in GSTM1 and rs1695 of GSTP1 genes may influence BC development among North-Indian women. Thus, the screening of GSTM1 and GSTP1 gene should be recommended for the earlier investigation for BC as a precautionary measure.
Key Words: Breast Cancer, Genetic Polymorphism, Ductal carcinoma, GST
Introduction
Breast cancer (BC) remains a major health care problem throughout the world, affecting more than 1.15 million women annually (Siegel RL et al., 2017). Studies performed in China, India and Russia revealed that BC is the second most widespread cancer in females after Lung cancer (Goss et al., 2014). This disease is accountable for more than 23% of all cancer cases and 14% of cases in women representing the highest incidence among all cancers and topmost cause of cancer-associated death (6.8%) in women (Barrios 2022). Timely diagnosis of markers of BC can raise the chances of positive outcomes of the disease, leading to enhanced survival rates and improved quality of life.
BC is considered to be a multifactorial disorder. Epidemiological studies have shown that genetic factors together with environmental factors (such as carcinogens, xeno-estrogens and chemical mutagens) are involved in BC pathogenesis. Some of the most powerful carcinogens involved in mammary gland carcinogenesis are polycyclic aromatic hydrocarbons present in tobacco smoke, benzo(a)pyrene, poly-chlorinated biphenyls(PCBs), and heterocyclic aromatic amines present in the diet (Lee et al., 2019). The existence of genetic variations in the nucleotide sequences of metabolic genes concerned in DNA repair, transcription control, chromatin remodeling and cell cycle regulation amplify the risk of different types of cancers in some individuals (Dunning et al., 1999). Heredity plays a vital role in BC progression, misregulation and inherited mutations in some specific highly penetrant genes such as BRCA1, BRCA2, CHEK 2, STK11, CDH1, TP53 or PTEN leads to the accumulation of genetic alterations, with an average cumulative lifetime risk of developing BC is about 80% (Naeem et al., 2019, Yang et al., 2019). Non-hereditary causes of BC which may play an interacting part with predisposing genes are race and ethnicity, advanced age, personal medical or family history of BC and lifestyle factors namely, (alcohol intake, smoking, high fat intake, low-fibre diet, and physical inactivity) (Osei-Afriyie et al., 2021). Having long-term exposure to estrogen via early menarche (< 12) , delayed menopause (>55), late age at first birth (≥30), nulliparity and nonstop use of oral hormonal contraceptives are some of the reproductive factors that enhance the chances of BC ( Feng et al., 2018; Anderson et al., 2014).
BC is a heterogeneous disease featuring different histological, molecular and clinical phenotypes. Breast tumors are classified into four main subtypes depending on their status of hormone receptors: estrogen receptor (ER), progesterone receptor (PR) and expression of HER2; luminal A, luminal B, triple-negative/basal-like and HER2. One of the most frequently observed histological tumour type is invasive ductal carcinoma (IDC), followed by invasive lobular carcinoma (ILC) (Loibl et al., 2021).
Cells perform essential functions in a pro-oxidant condition that counter excess formation of free radicals and other reactive species which stem from both mitochondrial metabolism and exogenous processes. The system of biotransformation and elimination of these reactive species is classified into phases I and II. The phase I system includes components of the P450 cytochrome enzyme system and phase II constitutes the glutathione S-transferases (GSTs) enzymes (Pacholak et al., 2021). The Phase II detoxifying enzymes are stimulated under conditions of oxidative stress and catalyse the detoxifcation of xenobiotics, including chemotherapeutic drugs involved in BC treatment by glutathione conjugation that are obtained from the process of oxidation carried out by the phase I enzymes resulting in the formation of less water-soluble conjugates (Jancova et al., 2010;Lee et al. 2020). Moreover, the GSTs also participate in numerous cellular procedures, for example, they are involved in cell proliferations, stress response, apoptosis and drug resistance (Oliveira et al., 2010). Because oxidative DNA damage and mutations guide the process of tumor formation, numerous presumed functional genetic polymorphisms in GSTs were investigated in this study for plausible association with BC.
The GST gene family comprises of overwhelmingly important genes, which are considered to be significant in various disease manifestations (Chatterjee & Gupta 2018). The GST gene family in human is highly polymorphic and their frequency varies in population to population. GSTM1 and GSTT1 genes are deleted in approximately 40-45 % of the Caucasian population, respectively with a significant loss of enzyme function (Ranjbar et al., 2018). Polymorphism in GST genes can aggravate the aggregation of reactive metabolites in the body, enhancing the probability of interaction with biomolecules in the cells which triggers the oncogenesis process (Datkhile et al., 2019;Henkler et al., 2012). Previous reports on polymorphisms in GSTT1 and GSTM1 genes demonstrated the presence of 49.4% of GSTM1 (null) and 28.6% of GSTT1(null) in Italy, 28% of GSTM1(null) and 46.7% of GSTT1(null) in Cameroun, 48.8% of GSTM1(null) and 37.8% of GSTT1(null) in Ethiopia, 55.8% of GSTM1(null) and 27.6% of GSTT1(null) in Spain (Kiendrebeogo et al., 2019).
GSTP1 acts as a tumor suppressor enzyme. It has a distinguished genetic variation entitled rs1695 single nucleotide polymorphism (SNP) (Farmohammadi et al., 2020). GSTP1 has a polymorphic site, where an adenosine (A) to guanosine (G) transition leads to (Ile)→(Val) substitution at codon 105 in exon 5 (Yadav et al., 2020). Individuals with the mutated Val genotype have considerably lowered enzyme activity towards its substrate (Millar et al. 1999). Thus, it is practical to contemplate that xenobiotic metabolizing enzymes (XMEs) with reduced enzymatic activity may be associated with a prominent risk of developing cancer.
Functional polymorphisms in GSTM1, GSTT1 and GSTP1 genes have been scanned in numerous studies, looking for new markers for susceptibility to BC development (Van Emburgh et al., 2008; Sohail et al., 2013). It is estimated that about 45-50% Caucasian and about 30% of South Indians lacked the GSTM1 gene due to inherited homozygous deletion of both alleles (Naveen et al., 2004). Several scientific studies have exhibited the association of polymorphisms in GSTT1 and GSTM1 with elevated BC risk in Asians, particularly in Chinese populations (Tang et al., 2015; Kalacas et al., 2019). The GSTM1 null genotype was found to be significantly associated with BC risk in post-menopausal women (Ambrosone et al., 1995; Mitrunen et al., 2001).
Majority of the available data found no or fewer association, but these discrepancies in the findings could be due to the differences in study populations, risk factor distributions, and potential confounders. These factors might result in false-negative conclusions thus; there is a need to study polymorphism of breast-cancer-susceptibility genes in different populations.
Materials and Methods
Study population
The study population comprised of 105 histo-pathologically confirmed BC patients, treated at Kamala Nehru Memorial Cancer Hospital, Prayagraj, Uttar Pradesh, India between March 2018 till July 2020. Age matched control subjects (n=145) were randomly chosen from the general population. Both cases and controls came from the similar ethnic background to counteract the impact of ethnicity. Inclusion and exclusion criteria for BC patients and controls are as follows: Inclusion criteria for cases: (a) Women in the age group range of 18 to 65 with histo-pathologically confirmed BC were included in this study (b) Patients diagnosed with any other malignancies were excluded. Inclusion criteria for controls: (a) No personal history of cancer (b) No relatives with breast or ovarian cancer. The following data was collected from medical records: age at diagnosis, family history of BC, menopausal status, marital status, ethnicity, smoking status and alcohol use and tumor stage. From the histopathologic report, following data were collected: the expression of hormone receptors (estrogen and progesterone), HER-2 overexpression, subtypes, and histopathological grade.
Consent to Participate and Ethical Statement
All the volunteers included this study signed a written informed consent form before sample collection. Our research proposal was reviewed and approved by the Population Resource and Research centre, Prayagraj, Institute Ethical Committee (IERB Reference: 18/9.39).
Molecular analyses of GSTM1, GSTT1 and GSTP1 gene polymorphisms
Blood sampling and DNA Isolation
Around (2ml) blood was collected from all the study volunteers in EDTA vials and genomic DNA was extracted from blood leukocytes by using DNA blood mini isolation kit following the manufacturers’ protocol (Qaigen GmbH, Hilden, Germany). NanoDrop™ spectrophotometer ( Thermo Scientific, Wilmington, Delaware, USA) was used to quantitatively assess and determine DNA purity at 260/280 nm wavelengths and stored at -20° C prior to analysis.
Genotyping Protocol
The screening for GSTT1 and GSTM1 null genotypes was accomplished simultaneously by using multiplex-PCR procedure proposed by (Abdel-Rahman et al. 1996). Cytochrome P450 1A1 gene (CYP1A1) was used as internal control of the reaction for confirming successful PCR amplifcation. Primer sequences utilized for GSTT1 and GSTM1 genotypes detection are mentioned in Table 1. PCR amplification was carried out in a 25 µl multiplex reaction mixture containing about 1X PCR master mixes, 100-150 ng of template DNA and 10 pmol of each primers of GSTM1 and GSTT1. The thermocycling procedure was done in a thermal cycler (Eppendorf AG, Hamburg, Germany). PCR amplification started with 5min of initial denaturation at 94°C, followed by 35 cycles of denaturation at 94° C for 30 sec, annealing at 64° C for 1 min and extension at 72 °C. A final extension was performed at 72 °C for 10 min. The amplified PCR products for the genotyping of polymorphisms were then separated on 1.5% agarose gel with ethidium bromide (EtBr) and documented in Geldoc XR+ system (Biorad System, Canada). Fragments of 215 and 480 bp were observed, respectively, in GSTM1 and GSTT1 active individuals, and the CYP1A1 fragment was 312 bp in size. The electrophoretic profile of the polymorphisms GSTM1 and GSTT1 is represented in Figure 1.
Figure 1.
Electrophoretic Profile for the Polymorphisms of GSTT1 and GSTM1 Genes, Showing Bands at 480 bp and 215bp Respectively. CYP1A1 (315bp) serving as internal control. Lane ʽʽMʼʼrepresents 100bp marker (Ladder), lane 1,2,3,4 and 6 shows the presence of both GSTT1 and GSTM1. Lane 5 shows absence of GSTM1
GSTP1 (Ile 105→Val) gene polymorphism was determined by PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) as previously illustrated by (Harries et al., 1997). Primer sequences used for amplification of GSTP1 variants are mentioned in Table 1. PCR cycling conditions were as follows: early denaturation at 95° C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 sec, primer annealing at 59° C for 45 sec and a final extension at 72° C for 5 min. The amplified product of 176bp was checked by electrophoreses on 1.5% agarose gel. The 176bp PCR products (12 ml) were then digested with 5 units BsmA1 restriction enzyme (Fermentas, Germany) at 37 °C for 16hrs. The detection of the different alleles was performed by horizontal EtBr 10% native polyacrylamide gel electrophoresis. Persons with homozygous wild type allele (Ile/Ile) exhibited a single band of 176 bp, while those with homozygous mutant allele (Val/Val) exhibited two bands of 91bp and 85 bp. Individuals with the heterozygous variant allele (Ile/Val) exhibit three bands (176 bp corresponding to Ile; and 91 and 85 bp corresponding to Val).
Histopathological study of BC tissue
Histological type and grade was evaluated by microscopic examination of Hematoxylin and Eosin stained tissue sections. The slides obtained from the hospital were examined under the light microscope at 10 X and 40 X magnifications to observe the histological grades of Invasive Ductal Carcinoma of breast.
Data analysis
Data analysis was carried out using Statistical software package, SPSS 16.00 (SPSS In; Chicago, IL, USA). Genetic association analysis between BC and GST gene polymorphism was evaluated by calculating the odds ratio (OR) and 95% CI from logistic regression analyses (P-values <0.05 significant).
Results
The current case–control study was conducted on 105 BC patients (age: 45.1±9.26 years), and 145 healthy controls (age: 40.4±9.75 years), unrelated to the patients.
Table 2 depicts clinicopathological and demographic characteristics of BC patients and controls enrolled for this study. As per the clinicopathological characteristics of participants, 25.7% of the BC patients were diagnosed in Early Stage (T1+T2) and 74.2% of the patients were diagnosed in Late Stage (T3+T4). With regards to the tumor size, 54.3% of patients had tumors ranging between 1.5 and 3.0 centimeters (cm) in size while 35.2% of patients had tumors greater than 3.0 cm. The result showed that lymph node metastasis occurred in 35.2% of patients.
In the present study of North-Indian region , the highest number of cases of IDC (81.9%) were found followed by (8.5%) cases of ILC, (1.9%) cases of medullary carcinoma, (5.7%) cases of apocrine carcinoma, (0.9%) case of malignant phyllodes and (0.9%) of invasive papillary as shown in (Table 3). Out of the 86 cases of IDC, 50 (58.13%) cases were of Luminal A type, 5 (5.81%) cases were of Luminal B type, 9 (10.46%) cases were of HER2 over expression type and 22 cases (25.58%) were basal like. Of the 9 ILC cases, 6 (66.66%) cases were of Luminal A type and 3 (33.33%) cases were basal like. No cases of ILC in the Luminal B type or the HER2 over expression type was found. Of the 6 cases of apocrine carcinoma, 5 (83.33%) cases were of luminal A type and 1 (16.66%) was luminal B. Of the 2 cases of medullary carcinoma, 1 case (50%) was of HER2 positive type and 1 (50%) case was of Basal-like. The single cases of malignant phyllodes and invasive papillary carcinoma were found to be of Luminal A type (Figure 2).
Figure 2.
Comparison between Molecular Subtypes and Hhistopathological Types of Breast Cancer
Figure 3 shows the histological grades of IDC. In this study we found that maximum number of tumors were moderately differentiated grade II showing less tubule formation, accounting 57 (54.2 %) of total cases, followed by 26 (24.7%) tumors with well differentiated grade I consisting of small angulated glands with fairly uniform nuclei and 22 (20.9%) tumors with poorly differentiated grade III showing no tubule formation, marked pleomorphism and prominent mitotic figures.
Figure 3.
(a) Histologic Grade I Invasive Ductal Carcinoma: Well differentiated carcinoma consisting of small angulated glands with fairly uniform nuclei and mitotic figures are rarely seen (b) Histologic Grade II Invasive Ductal Carcinoma: Moderately differentiated carcinoma showing less tubule formation and some solid nests of cells with pleomorphic nuclei. Occasional mitotic figures are seen (HE stain, 40X). (c) and (d) Histologic Grade III Invasive Ductal Carcinoma: Poorly differentiated carcinoma showing absence of tubules, marked pleomorphism and prominent mitotic figures (HE stain, X40)
(Table 4) presents genotype frequencies for the GSTM1 and GSTT1. The genotype frequencies in BC patients obtained for GSTM1 (non-null, 36.19%), GSTM1 (null, 63.81%) and in controls GSTM1 (non-null, 55.86%), GSTM1 (null, 44.14%). The GSTM1 null genotype was most commonly found in the cases (63.81%) when compared with the controls (44.14%) indicating strong association between incidence of BC and GSTM1 gene deletion. However, no significant variation in genotype frequencies of GSTT1 was found between controls and BC cases. The odd ratios found for GSTM1 (OR= 2.231; 95% CI= 1.332-3.737; p-value = 0.002) exhibited strong association whereas GSTT1 (OR = 1.368; 95% CI =0.806- 2.319; p-value = 0.245), does not appear to influence BC susceptibility in the tested North-Indian population.
The genotypic results of GSTP1 are presented in Table 5. Among BC patients, 51.4% were homozygous for the (Ile/Ile) wild type allele, 32.4% were heterozygous (Ile/Val) and 16.2% homozygous for the mutant allele (Val/Val). In the control group, 37.2% of the subjects were homozygous for the GSTP1 wild type allele, 55.17% were heterozygous and 7.6% homozygous for the mutant allele. The GSTP1 (Val/Val) genotype (OR=1.545; CI=0.663-3.605; p-value= 0.314) was found to enhance the risk BC but the association was not statistically significant.
Table 6 presents the relation between GST polymorphisms and menopausal status. The results obtained from our study demonstrated that GSTM1 gene deletion increased the risk for predisposition of BC in pre-menopausal women (OR = 4.068; 95% CI = 1.641-10.089; p-value = 0.002), but it showed a protective effect in post - menopausal women (OR = 0.134; 95% CI = 0.065–0.278; p-value = 0.0001). However, in our study no significant association was observed when comparing GSTT1 gene deletion with risk of BC among pre- and post-menopausal women. The GSTP1 (Ile/Val+Val/Val) genotype caused a six-fold increase in BC risk among post-menopausal women (OR=6.065; CI=2.937-12.523; p-value= 0.0001) whereas in case of pre-menopausal women it reduced the risk of BC (OR= 0.251; CI= 0.105-0.597; p-value= 0.001).
We also evaluated gene–gene interaction study to further examine whether the GSTs genotypes are associated with BC risk. Table 7 shows the risk of BC with each genotype combination. The reference group included individuals with all three putative low-risk genotypes, that is, the presence of GSTM1 and GSTT1 genotypes and the homozygous Ile/Ile genotype for GSTP1. We found six times increased BC risk in individuals who carry three high risk genotypes GSTM1 null, GSTT1 null and GSTP1 Ile/Val+ Val/Val (OR = 6.500; 95% CI = 1.570-26.918; p-value= 0.005) and three times more risk of developing BC in individuals lacking GSTM1 and having at least one mutant allele in GSTP1 (OR = 3.014; 95% CI = 1.390-6.536; p-value= 0.005). Individuals with wild type genotype in GSTM1 and GSTP1 and with missing GSTT1 were found to be at lower risk for BC (OR= 0.722; 95% CI=0.204-2.551; p-value= 0.615).
Table 1.
PCR Primers and Electrophoretic Separation Pattern for GSTM1, GSTT1 and GSTP1
| Polymorphism | Primer sequence | Restriction enzyme | PCR Product |
|---|---|---|---|
| GSTM1 | F -5’GAACTCCCTGAAAAGCTAAAGC3’ | _ | 215bp |
| R-5’GTTGGGCTCAAATATACGGTGG3’ | |||
| GSTT1 | F- 5’TTCCTTACTGGTCCTCACATCTC3’ | _ | 480bp |
| R- 5’TCACCGGATCATGGCCAGCA3’ | |||
| CYP1A1 | F- 5’GAACTGCCACTTCAGCTGTCT3’ | _ | 312bp |
| R- 5’CAGCTGCATTTGGAAGTGCTC3’ | |||
| GSTP1 (rs 1695) | F- 5’ACCCCAGGGCTCTATGGGAA3’ | BsmA1 | Ile/Ile :176bp |
| R- 5’TGAGGGCACAAGAAGCCCCT3’ | Ile/Val:176bp,91bp,85bp | ||
| Val/Val : 91bp, 85bp |
Table 2.
Clinicopathological and Demographic Characteristics of BC Patients (n=105) and Controls Subjects (n=145)
| Characteristics | Cases n (%) | Control n (%) | p-value | OR (95% CI) |
|---|---|---|---|---|
| Age (Range) | 18-70yrs | 18-65yrs | ||
| Mean± SD | 45.1±9.26 | 40.4±9.75 | ||
| Menopausal status | ||||
| Pre-menopause | 43 (40.9) | 54 (37.2) | 1 | 1 |
| Post-menopause | 62 (59%) | 91 (62.7) | 0.552 | 1.169 (0.699-1.955) |
| Marital status | ||||
| Unmarried | 30 (28.5) | 43 (29.6) | 1 | 1 |
| Married | 65 (61.9) | 87 (60) | 0.813 | 1.071 (0.608-1.887) |
| Divorced | 10 (9.5) | 15 (10.3) | 0.924 | 0.956 (0.378-2.412) |
| Ethnicity | ||||
| Rural | 70 (66.6) | |||
| Urban | 35 (33.3) | |||
| Family History | ||||
| No | 74 (70.4) | |||
| Yes | 31 (29.5) | |||
| Smoking history | ||||
| No | 58 (55.2) | |||
| Yes | 47 (44.7) | |||
| Tumor stage | ||||
| Early (T1+T2) | 27 (25.7) | |||
| Late (T3+T4) | 78 (74.2) | |||
| Tumor size | ||||
| <1.5 cm | 11 (10.4) | |||
| 1.5-3.0 cm | 57 (54.3) | |||
| >3.0 cm | 37 (35.2) | |||
| Histopathological grade | ||||
| I | 26 (24.7) | |||
| II | 57 (54.2) | |||
| III | 22 (21) | |||
| Lymph node metastasis | ||||
| Absent | 68 (64.7) | |||
| Present | 37 (35.2) |
*All p-values <0.05 were considered statistically significant.
Table 3.
Histopathological Subtypes Diagnosed in Patients (n=105) with Breast Carcinoma
| Histopathological subtypes | No. of cases n (%) |
|---|---|
| InvasiveDuctal carcinoma (IDC) | 86 ( 81.9) |
| InvasiveLobular carcinoma (ILC) | 9 (8.5) |
| Medullary carcinoma | 2 (1.9) |
| Apocrine carcinoma | 6 (5.7) |
| Malignant phyllodes | 1 (0.9) |
| Invasive papillary carcinoma | 1 (0.9) |
| Total | 105 |
Table 4.
Frequency Distribution of the GSTM1 and GSTT1 Genotypes in BC Patients and Healthy Controls
| Genotype frequency | GSTM1(Null) | GSTM1(Non-Null) | p-value | OR (95% CI) |
|---|---|---|---|---|
| Control (%) | 64 (44.13) | 81 (55.86) | 1 | 1 |
| Case (%) | 67 (63.80) | 38 (36.19) | 0.002 | 2.231(1.332-3.737) |
| GSTT1 (Null) | GSTT1 (Non-null) | |||
| Control (%) | 45 (31.03) | 100 (68.96) | 1 | 1 |
| Cases (%) | 40 (38.09) | 65 (61.90) | 0.245 | 1.368 (0.806-2.319) |
*All p-values <0.05 were considered statistically significant.
Table 5.
Genotype Frequency of GSTP1 with Odds Ratio
| Genotype Frequency | Control n (%) | Cases n (%) | p-value | OR (95% CI) |
|---|---|---|---|---|
| GSTP1 (Ile/Ile) | 54 (37.2) | 54 (51.4) | 1 | 1 |
| GSTP1 (Ile/ Val) | 80 (55.17) | 34 (32.4) | 0.002 | 0.425 (0.245-0.737) |
| GSTP1 (Val/Val) | 11 (7.6) | 17 (16.2) | 0.314 | 1.545 (0.663-3.605) |
*All p-values <0.05 were considered statistically significant.
Table 6.
Frequency Distribution and Association between the GSTs Genotypes in Control and BC Patients on the Basis of Menopausal Status
| Genotype | Cases n (%) | Control n (%) | p-value | OR ( 95% CI) |
|---|---|---|---|---|
| Pre-menopause | ||||
| GSTM1 | ||||
| Null | 34 (79.1) | 26 (48.1) | 0.002* | 4.068 (1.641-10.089) |
| Non-null | 9 (20.9) | 28 (51.9) | 1 | 1 |
| GSTT1 | ||||
| Null | 20 (46.5) | 30 (55.6) | 0.377 | 0.696 (0.311-1.555) |
| Non-null | 23 (53.5) | 24 (44.4) | 1 | 1 |
| GSTP1 | ||||
| Ile/ Ile | 23 (53.5) | 13 (8.9) | 1 | 1 |
| Ile/ Val + Val/Val | 23 (53.5) | 41 (75.9) | 0.001* | 0.251 (0.105-0.597) |
| Post-menopause | ||||
| GSTM1 | ||||
| Null | 20 (33.0) | 71 (67.0) | 0.0001* | 0.134 (0.065-0.278) |
| Non-null | 42 (67.7) | 20 (32.3) | 1 | 1 |
| GSTT1 | ||||
| Null | 10 (16.1) | 20 (22.0) | 0.373 | 0.683 (0.295-1.580) |
| Non-null | 52 (83.9) | 71 (78.0) | 1 | 1 |
| GSTP1 | ||||
| Ile/Ile | 15 (24.2) | 60 (65.9) | 1 | 1 |
| Ile/ Val + Val/Val | 47 (75.8) | 31 (34.1) | 0.0001* | 6.065 (2.937-12.523) |
*All p-values <0.05 were considered statistically significant.
Table 7.
Analysis of Impact of GST Genotype Combination and BC Risk
| Genotype Combination | Cases | Control | p-value | OR (95% CI) | ||
|---|---|---|---|---|---|---|
| GSTM1 | GSTT1 | GSTP1 | N (%) | N (%) | ||
| Non-Null | Non-null | Ile/Ile | 18 (17.1) | 39 (26.9) | 1 | 1 |
| Null | Null | Ile/Ile | 5 (4.7) | 6 (4.1) | 0.377 | 1.808 (0.486-6.703) |
| Null | Non- null | Ile/Ile | 11 (10.5) | 16 (11) | 0.412 | 1.490 (0.576-3.849) |
| Non-null | Null | Ile/Ile | 4 (3.8) | 12 (8.3) | 0.615 | 0.722 (0.204-2.551) |
| Non-null | Non-null | Ile/Val + Val/Val | 19 (18.1) | 35 (24.1) | 0.688 | 1.176 (0.534-2.591) |
| Null | Null | Ile/Val + Val/Val | 9 (8.6) | 3 (2.1) | 0.005* | 6.500 (1.570-26.918) |
| Null | Non-null | Ile/Val + Val/Val | 32 (30.5) | 23 (15.9) | 0.005* | 3.014 (1.390-6.536) |
| Non-null | Null | Ile/Val + Val/Val | 7 (6.7) | 11 (7.6) | 0.569 | 1.379 (0.459-4.142) |
*All p-values <0.05 were considered statistically significant.
Discussion
Every year around 2.1 million fresh BC cases are reported, resulting in 600,000 deaths, which is the primary cause of mortality in females across the globe. According to reports, by the year 2050, the number of BC cases in women is expected to reach 3.2 million worldwide (Momenimovahed and Salehiniya 2019). The evaluation of different genetic variants and their relation with the development of BC has contributed in establishing the role of genomics in cancer research. Genetic polymorphism or SNPs, are such common genetic variations that are present in majority of the human genome. The study of these single nucleotide polymorphisms can help to prognosticate an individual’s reaction to certain drugs, vulnerability to environmental factors, and risk of developing diseases including cancer development (Chang-Sheng et al., 2018). Additionally, the other factors that lead to commencement of a neoplasm and metastasis include accumulation of cellular mutations, like inhibition of tumor suppressor enzymes, resistance to apoptosis and increase in angiogenesis. The current case-control study aimed to explore genetic variability in GSTM1, GSTT1 and GSTP1 genes and its susceptibility to BC in a sample of North-Indian population and to analyze the occurrence of the four subtypes of BC based on molecular classification.
We found that GSTM1 null genotype is significantly associated to BC risk in ethnic North-Indian population. However, no significant association was found between GSTT1 null genotype and susceptibility to BC. Our findings were in alignment with a similar study conducted in northeastern Mexico which showed an increased BC risk associated with the GSTM1 (null) genotype, whereas no association was found between the GSTT1 (null) genotype and overall BC risk. The GSTM1 null genotype resulted in two-fold (95%CI = 1.50-3.21) increase in the BC risk in the Mexican population (Jaramillo-Rangel et al., 2015). Conversely, there are some studies that have linked GSTT1 gene deletion with an increased risk of BC susceptibility (Fang et al., 2013). Chen et al. performed a meta-analysis which included 17,254 cases and 21,163 control subjects from 48 studies and investigated the association between the GSTT1 polymorphism and BC risk. The result associated that GSTT1 null genotype to a low-penetrant risk factor for BC risk (Chen X et al., 2011). Tagoe et al. performed a similar study in the Ghanaian population, which demonstrated a strong association between GSTT1 null genotype and BC risk. The frequency of GSTT1 (null) genotype in Ghanaian patients came out to be 42.9% and a significant association with BC was found (OR=2.84, 95% CI=1.52–5.29, p=0.001) (Tagoe et al., 2017). Khedhaier et al. reported a significant association between GSTT1 gene deletion and the risk of BC development at an early stage. On the other hand, a number of authors couldn’t find any significant association between GSTM1 and GSTT1 genes deletion and the risk of BC (Reis M, 2006, Anton et al., 2010). A study carried out by Morais et al. disclosed that about 35% of cases had GSTM1 gene deletion and around 14% of the cases had GSTT1 gene deletion, but they could not relate this deletion with the possibility of BC (Morais et al., 2008). Another study conducted in the Nigerian population indicated that the GSTM1 and GSTT1 homozygous gene deletion is a potential risk factor for the emergence of BC (Ogunlana et al., 2018).
Our data demonstrated that the GSTP1 (Val/Val) genotype might alter the risk of BC but the association was not found to be statistically significant. Similarly, Ge et al., (2013) also documented a positive association between GSTP1 (Ile105Val) polymorphism and BC risk (Ge et al., 2013). In constrast to our findings, many studies investigating the association of the GSTP1 polymorphisms with BC risk found no association between both of them. For instance, (Samson et al., 2007, Unlu et al.,2008, Millikan et al., 2000, Zhao et al., 2001) have reported a non-significant increase in the risk of BC.
Previously reviewed literatures have shown contradictory reports on GST polymorphism and menopausal status. In our study we observed that the GSTM1 gene deletion enhanced the risk of BC four times in pre-menopausal women, while in post- menopausal women it reduced the risk of BC. GSTP1 (Ile/Val+Val/Val) genotype caused a six-fold increase in the BC risk in post-menopausal women in comparison to pre-menopausal women. Helzlsouer et al. and Charrier et al. observed positive associations for the GSTM1 null genotype and post-menopausal women (Helzlsouer et al., 1998, Charrier et al. 1999). Ambrosone et al. performed a case-control study, which included 216 post-menopausal Caucasian women with incident BC and 282 community controls, results showed a positive association between GSTM1 null genotype and younger pre-menopausal women. On the other hand, Bansal et al. reported no association between GSTT1 and GSTM1 gene deletion and menopausal status in the development of BC (Bansal et al., 2015). Similar to our finding, Helzlsouer et al. reported no association between GSTT1 gene deletion and risk of BC in pre- or post-menopausal women while Garcia-Closas et al. reported no association between GSTM1 and GSTT1 gene deletion and BC risk, with null GSTT1 being protective in pre-menopausal women. (Garcia-Closas et al.,1999).
Presence of null genotype in both GSTM1 and GSTT1 together with homozygous mutant GSTP1 was termed as high risk genotype combination whereas presence of GSTM1, GSTT1 alleles alongwith homozygous genotype in GSTP1 were termed as low risk genotypes. Previously, many studies have reported that homozygous mutant individuals have a significantly higher risk of BC (Saxena et al., 2009, Zhang et al., 2011). Analysis of all the genotypes demonstrated significantly higher BC risk. We observed a six-fold increased BC risk in women who carry null genotype both in GSTM1 and GSTT1 and mutant genotype in GSTP1. Our findings were in harmony with the previously published reports (Gudmundsdottir et al. 2001; Park et al. 2004).
In our study, IDC was the most commonly observed histological type of breast carcinoma accounting 81.9% of the total cases. On the basis of a clinical database research, Wang et al demonstrated that 90.1% of breast carcinoma was of invasive ductal type which correlates with our study (Wang et al., 2014). Similarly, Kakarala et al. revealed that Asian Indian/Pakistani women had more IDC and less ILC in comparison to Caucasians (Kakarala et al., 2010).
Several studies have assessed the association of GST polymorphism with BC risk, but due to lack of conclusive evidence the association still remains ambiguous and has not been well established. There are multiple discrepancies in the association study reports which can be attributed to the different populations which may have been exposed to varied environmental risk factors. Moreover, the dissimilarities could also arise due to distinct methodology of study such as the study design, variation in sample size, genetic analysis, control selection as well as particular gene–environment interactions. Preliminary studies have already pointed that there is a undeniable association between the GST gene polymorphisms and BC. Therefore, further studies with larger sample sizes are compulsorily needed to authenticate our findings.
Author Contribution Statement
The authors confirm contributionto the paper as follows: study conception and design: Priyanka Gautam and Munish Kumar; Data collection: Priyanka Gautam, Sonia Tiwari and ZainabFeroz; Analysis and Interpretation of results: Munish Kumar, Sivakumar Vijayaraghavalu and Girish C. Shukla; Draft manuscript preparation: Priyanka Gautam, Munish Kumar and Sivakumar Vijayaraghavalu. All the authors reviewed the results and approved the final version of the manuscript.
Declarations of Conflicts of Interest
The authors declare no conflict of interest.
Acknowledgment
Priyanka acknowledges UGC New Delhi for financial assistance in the form of CRET- Research Fellowship. All the authors thankfully acknowledge UGC-SAP and DBT builder grant for providing facilities at Department of Biochemistry, University of Allahabad, Prayagraj .
References
- 1.Abdel-Rehman SZ, el-Zein RA, Anwar WA, et al. A multiplex PCR procedure for polymorphic analysis of GSTM1 and GSTT1 genes in population studies. Cancer Lett. 1996;107:229–3. doi: 10.1016/0304-3835(96)04832-x. [DOI] [PubMed] [Google Scholar]
- 2.Ambrosone CB, Freudenheim JL, Graham S, et al. Cytochrome P4501A1 and glutathione S-transferase (M1) genetic polymorphisms and postmenopausal breast cancer risk. Cancer Res. 1995;55:3483–5. [PubMed] [Google Scholar]
- 3.Anderson KN, Schwab RB, Martinez ME. Reproductive risk factors and breast cancer subtypes: a review of the literature. Breast Cancer Res Treat. 2014;144:1–10. doi: 10.1007/s10549-014-2852-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Anton EM, Renner JD, Valim AR, Dotto ML, Possuelo LG. Avaliacao epidemiologica da influencia dos genes GSTM1 e GSTT1 na susceptibilidade ao cancer de mama em mulheres atendidas em um hospital do sul do Brasil: um estudo piloto. Rev AMRIGS. 2010;54:411–5. [Google Scholar]
- 5.Bansal VK, Rajan K, Sharma A, et al. Prospective Case–Control Study to Evaluate the Role of Glutathione S Transferases (GSTT1 and GSTM1) Gene Deletion in Breast Carcinoma and Its Prognostic Significance. Indian J Surg. 2015;77:1067–2. doi: 10.1007/s12262-014-1152-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Barrios CH. Global challenges in breast cancer detection and treatment. Breast J. 2022;62:3–6. doi: 10.1016/j.breast.2022.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Boyer T. The glutathione S-transferases: an update. Hepatology. 1989;9:486–6. doi: 10.1002/hep.1840090324. [DOI] [PubMed] [Google Scholar]
- 8.Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2018;68:394–4. doi: 10.3322/caac.21492. [DOI] [PubMed] [Google Scholar]
- 9.Calaf G, Russo J. Transformation of human breast epithelial cells by chemical carcinogens. Carcinogenesis. 1993;14:483–2. doi: 10.1093/carcin/14.3.483. [DOI] [PubMed] [Google Scholar]
- 10.Chang-Sheng C, Kitamura E, Johnson J, et al. Genomics analysis of racial differences in triple negative breast cancer. Genomics. 2018;111:1529–2. doi: 10.1016/j.ygeno.2018.10.010. [DOI] [PubMed] [Google Scholar]
- 11.Charrier J, Maugard CM, Le Mevel B, Bignon YJ. Allelotype influence at glutathione S-transferase M1 locus on breast cancer susceptibility. Br J Cancer. 1999;79:346–3. doi: 10.1038/sj.bjc.6690055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Chatterjee A, Gupta S. The multifaceted role of glutathione S-transferases in cancer. Cancer Lett. 2018;433:33–2. doi: 10.1016/j.canlet.2018.06.028. [DOI] [PubMed] [Google Scholar]
- 13.Chen X, Zhao RP, Qiu LX, et al. Glutathione S-transferase T1 polymorphism is associated with breast cancer susceptibility. Cytokine. 2011;56:477–80. doi: 10.1016/j.cyto.2011.06.008. [DOI] [PubMed] [Google Scholar]
- 14.Curran JE, Weinstein SR, Griffths LR. Polymorphisms of glutathione S-transferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer susceptibility. Cancer Lett. 2000;153:113–20. doi: 10.1016/s0304-3835(00)00361-x. [DOI] [PubMed] [Google Scholar]
- 15.Datkhile KD, Patil MN, Durgawale PP, et al. Genetic polymorphisms in carcinogen detoxifying genes and risk of cervical cancer in Maharashtra: a case control study. Int J Biomed Res. 2019;10:e5105. [Google Scholar]
- 16.Dunnick JK, Elwell MR, Huff J, Barrett JC. Chemically induced mammary gland cancer in the National Toxicology Program’s carcinogenesis bioassay. Carcinogenesis. 1995;16:173–9. doi: 10.1093/carcin/16.2.173. [DOI] [PubMed] [Google Scholar]
- 17.Dunning AM, Healey CS, Pharoah PD, et al. A systematic review of genetic polymorphisms and breast cancer risk. Cancer Epidemiol Biomarkers Prev. 1999;8:843–4. [PubMed] [Google Scholar]
- 18.Fang J, Wang S, Zhang S, et al. Association of the Glutathione S-Transferase M1, T1 Polymorphisms with Cancer: Evidence from a Meta-Analysis. PLoS One. 2013;8:e78707. doi: 10.1371/journal.pone.0078707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Farmohammadi A, Arab-Yarmohammadi V, Ramzanpour R. Association analysis of rs1695 and rs1138272 variations in GSTP1 gene and breast cancer susceptibility. Asian Pac J Cancer Prev. 2020;21:1167–2. doi: 10.31557/APJCP.2020.21.4.1167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Feng Y, Spezia M, Huang S, et al. Breast cancer development and progression: Risk factors, cancer stem cells, signaling pathways, genomics, and molecular pathogenesis. Genes Dis. 2018;5:77–6. doi: 10.1016/j.gendis.2018.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Garcia-Closas M, Kelsey KT, Hankinson SE, et al. Glutathione S-transferase µ and t polymorphisms and breast cancer susceptibility. J Natl Cancer Inst. 1999;91:1960–4. doi: 10.1093/jnci/91.22.1960. [DOI] [PubMed] [Google Scholar]
- 22.Ge J, Tian AX, Wang QS, et al. The GSTP1 105Val allele increases breast cancer risk and aggressiveness but enhances response to cyclophosphamide chemotherapy in North China. PLoS One. 2013;8:e67589. doi: 10.1371/journal.pone.0067589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Goss PE, Strasser-Weippl K, Lee-Bychkovsky BL, et al. Challenges to effective cancer control in China, India, and Russia. Lancet Oncol. 2014;15:489–8. doi: 10.1016/S1470-2045(14)70029-4. [DOI] [PubMed] [Google Scholar]
- 24.Gudmundsdottir K, Tryggvadottir L, Eyfjord JE. GSTM1, GSTT1, and GSTP1 genotypes in relation to breast cancer risk and frequency of mutations in the p53 gene. Cancer Epidemiol Biomarkers Prev. 2001;10:1169–3. [PubMed] [Google Scholar]
- 25.Harries LW, Stubbins MJ, Forman D, et al. Identification of genetic polymorphism at the glutathione S-transferase Pi locus and association with susceptibility to bladder, testicular and prostate cancer. Carcinogenesis. 1997;18:641–4. doi: 10.1093/carcin/18.4.641. [DOI] [PubMed] [Google Scholar]
- 26.Helzlsouer KJ, Huang HY, Hoffman S, et al. Association between glutathione S-transferase M1, P1, and T1 genetic polymorphisms and development of breast cancer. J Natl Cancer Inst. 1998;90:512–8. doi: 10.1093/jnci/90.7.512. [DOI] [PubMed] [Google Scholar]
- 27.Henkler F, Stolpmann K, Luch A. Exposure to polycyclic aromatic hydrocarbons: bulky DNA adducts and cellular responses. Mol Clin Environ Toxicol. 2012;101:107–1. doi: 10.1007/978-3-7643-8340-4_5. [DOI] [PubMed] [Google Scholar]
- 28.Jancova P, Anzenbacher P, Anzenbacherova E. Phase II drug metabolizing enzymes. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2010;154:103–6. doi: 10.5507/bp.2010.017. [DOI] [PubMed] [Google Scholar]
- 29.Jaramillo-Rangel G, Ortega-Martinez M, Cerda-Flores RM, et al. Polymorphisms in GSTM1, GSTT1, GSTP1, and GSTM3 genes and breast cancer risk in northeastern Mexico. Genet Mol Res. 2015;14:6465–1. doi: 10.4238/2015.June.11.22. [DOI] [PubMed] [Google Scholar]
- 30.Kakarala M, Rozek L, Cote M, et al. Breast cancer histology and receptor status characterization in Asian Indian and Pakistani women in the U. S.-a SEER analysis. BMC Cancer. 2010;10:1–8. doi: 10.1186/1471-2407-10-191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Kalacas NA, Garcia JA, Ortin TS, et al. GSTM1 and GSTT1 genetic polymorphisms and breast cancer risk in selected filipino cases. Asian Pac J Cancer Prev. 2019;20:529–5. doi: 10.31557/APJCP.2019.20.2.529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Khedhaier A, Remadi S, Corbex M, et al. Glutathione S-transferases (GSTT1 and GSTM1) gene deletions in Tunisians: susceptibility and prognostic implications in breast carcinoma. Br J Cancer. 2003;89:1502–7. doi: 10.1038/sj.bjc.6601292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kiendrebeogo IT, Zoure AA, Sorgho PA, et al. Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) variants and breast cancer risk in Burkina Faso. Biomolecular Concepts. 2019;10:175–3. doi: 10.1515/bmc-2019-0020. [DOI] [PubMed] [Google Scholar]
- 34.Lee DG, Burstyn I, Lai AS, et al. Women’s occupational exposure to polycyclic aromatic hydrocarbons and risk of breast cancer. Occup Environ Med. 2019;76:22–9. doi: 10.1136/oemed-2018-105261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Lee NR, Park SM, Yee J, et al. Association between glutathione-Stransferase gene polymorphisms and responses to tyrosine kinase inhibitor treatment in patients with chronic myeloid leukemia: a meta-analysis. Target Oncol. 2020;15:47–4. doi: 10.1007/s11523-020-00696-z. [DOI] [PubMed] [Google Scholar]
- 36.Loibl S, Poortmans P, Morrow M, et al. Breast cancer. Lancet. 2021;397:1750–9. doi: 10.1016/S0140-6736(20)32381-3. [DOI] [PubMed] [Google Scholar]
- 37.Millar DS, Ow KK, Paul CL, et al. Detailed methylation analysis of the glutathione S-transferase pi (GST-PI) gene in prostate cancer. Oncogene. 1999;18:1313–4. doi: 10.1038/sj.onc.1202415. [DOI] [PubMed] [Google Scholar]
- 38.Millikan R, Pittman G, Tse CK, et al. Glutathione S-transferase M1, T1 and P1 and Breast Cancer. Cancer Epidemiol Biomarkers Prev. 2000;9:567–3. [PubMed] [Google Scholar]
- 39.Mitrunen K, Jourenkova N, Kataja V, et al. Glutathione S-transferase M1, M3, P1, and T1 genetic polymorphisms and susceptibility to breast cancer. Cancer Epidemiol Biomarkers Prev. 2001;10:229–6. [PubMed] [Google Scholar]
- 40.Momenimovahed Z, Salehiniya H. Epidemiological characteristics of and risk factors for breast cancer in the world. Breast Cancer Targets Ther. 2019;11:151–4. doi: 10.2147/BCTT.S176070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Moore MA, Manan AA, Chow KY, et al. Cancer epidemiology and control in peninsular and island South-East Asia - past, present and future. Asian Pac J Cancer Prev. 2008;11:81–8. [PubMed] [Google Scholar]
- 42.Morais LM, Cardoso Filho C, Lourenço GJ, et al. Caracteristicas mamográficas do cancer de mama associadas aos polimorfismos GSTM1 E GSTT1. Rev Assoc Med Bras. 2008;54:61–6. doi: 10.1590/s0104-42302008000100022. [DOI] [PubMed] [Google Scholar]
- 43.Naeem M, Hayat M, Qamar SA, et al. Risk factors, genetic mutations and prevention of breast cancer. Int J Biosci. 2019;14:492–6. [Google Scholar]
- 44.Naveen AT, Adithan C, Padmaja N, et al. Glutathione S Transferase M1and T1 null genotype distribution in South Indians. Eur J Clin Pharmacol. 2004;60:403–6. doi: 10.1007/s00228-004-0779-3. [DOI] [PubMed] [Google Scholar]
- 45.Ogunlana OO, Ortiseweyinmi O, Ajoke S, et al. Significance of GSTM1 and GSTT1 gene polymorphism to breast cancer susceptibility in Nigerian women. Cancer Res. 2018:78. [Google Scholar]
- 46.Oliveira AL, Rodrigues FFO, Santos RE, et al. GSTT1, GSTM1, and GSTP1 polymorphisms and chemotherapy response in locally advanced breast cancer. Genet Mol Res. 2010;9:1045–3. doi: 10.4238/vol9-2gmr726. [DOI] [PubMed] [Google Scholar]
- 47.Osei-Afriyie S, Addae AK, Oppong S, et al. Breast cancer awareness, risk factors and screening practices among future health professionals in Ghana: A cross-sectional study. PLoS One. 2021;16:e0253373. doi: 10.1371/journal.pone.0253373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Pacholak LM, Kern R, de Oliveira, et al. Effects of GSTT1 and GSTM1 polymorphisms in glutathione levels and breast cancer development in Brazilian patients. Mol Biol Rep. 2021;48:33–40. doi: 10.1007/s11033-020-06107-w. [DOI] [PubMed] [Google Scholar]
- 49.Park SK, Yim DS, Yoon KS, et al. Combined effect of GSTM1, GSTT1, and COMT genotypes in individual breast cancer risk. Breast Cancer Res Treat. 2004;88:55–2. doi: 10.1007/s10549-004-0745-x. [DOI] [PubMed] [Google Scholar]
- 50.Perera FP, Estabrook A, Hewer A, et al. Carcinogen-DNA adducts in human breast tissue. Cancer Epidemiol Biomarkers Prev. 1995;4:233–8. [PubMed] [Google Scholar]
- 51.Ranjbar PA, Rakhshan A, Mashayekhi F, et al. Evaluation of common polymorphisms (GTSM1, GSTT1 and GSTP1) in S-glutathione transferase family and susceptibility to basal cell carcinoma (BCC) in Iranian population. Health Biotechnol Biopharma. 2018;2:40–5. [Google Scholar]
- 52.Reis M. Farmacogenetica aplicada ao cancer: quimioterapia individualizada e especificidade molecular. Medicina. 2006;39:577–6. [Google Scholar]
- 53.Samson M, Swaminathan R, Rama R, et al. Role of GSTM1 (Null/Present), GSTP1 (Ile105Val) and P53 (Arg72Pro) genetic polymorphisms and the risk of breast cancer - A Case Control Study from South India. Asian Pac J Cancer Prev. 2007;8:253–7. [PubMed] [Google Scholar]
- 54.Saxena A, Dhillon VS, Raish M, et al. Detection and relevance of germline genetic polymorphisms in glutathione S-transferases (GSTs) in breast cancer patients from northern Indian population. Breast Cancer Res Treat. 2009;115:537–3. doi: 10.1007/s10549-008-0098-y. [DOI] [PubMed] [Google Scholar]
- 55.Siegel RL, Miller KD, Jamil A. Cancer statistics. CA Cancer J Clin. 2017;67:7–30. doi: 10.3322/caac.21387. [DOI] [PubMed] [Google Scholar]
- 56.Sohail A, Kanwal N, Ali M, et al. Effects of glutathione-S-transferase polymorphisms on the risk of breast cancer: a population-based case-control study in Pakistan. Environ Toxicol Pharmacol. 2013;35:143–3. doi: 10.1016/j.etap.2012.11.014. [DOI] [PubMed] [Google Scholar]
- 57.Tagoe EA, Arko-Boham B, Adjorogbe B, et al. Glutathione S-Transferase T1 and M1 gene polymorphisms among breast cancer susceptible Ghanaians. Clin Invest. 2017;7:119–5. [Google Scholar]
- 58.Tang J, Zhou Q, Zhao F, et al. Association of glutathione S-transferase T1, M1 and P1 polymorphisms in the breast cancer risk: a meta-analysis in Asian population. Int J Clin Exp Med. 2015;8:12430–7. [PMC free article] [PubMed] [Google Scholar]
- 59.Unlu A, Ates NA, Tamer L, et al. Relation of glutathione S-transferase T1, M1 and P1 genotypes and breast cancer risk. Cell Biochem Funct. 2008;26:643–7. doi: 10.1002/cbf.1490. [DOI] [PubMed] [Google Scholar]
- 60.Van Emburgh BO, Hu JJ, Levine EA, et al. Polymorphisms in CYP1B1, GSTM1, GSTT1 and GSTP1, and susceptibility to breast cancer. Oncol Rep. 2008;19:1311–1. [PMC free article] [PubMed] [Google Scholar]
- 61.Wang LW, Yang GF, Chen JM, et al. A clinical database of breast cancer patients reveals distinctive clinico-pathological characteristics: a study from central china. Asian Pac J Cancer Prev. 2014;15:1621–6. doi: 10.7314/apjcp.2014.15.4.1621. [DOI] [PubMed] [Google Scholar]
- 62.Yadav P, Banerjee A, Boruah N, et al. Glutathione S-transferasesP1 AA (105Ile) allele increases oral cancer risk, interacts strongly with c-Jun Kinase and weakly detoxifes arecanut metabolites. Sci Rep. 2020;10:6032. doi: 10.1038/s41598-020-63034-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Yang M, Du X, Zhang F, Yuan S. Association between BRCA1 polymorphisms rs799917 and rs1799966 and breast cancer risk: a meta-analysis. J Int Med Res. 2019;47:1409–6. doi: 10.1177/0300060519826819. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Zhang BL, Sun T, Zhang B, et al. Polymorphisms of GSTP1 is associated with differences of chemotherapy response and toxicity in breast cancer. Chin Med J (Engl) 2011;124:199–4. [PubMed] [Google Scholar]
- 65.Zhao M, Lewis R, Gustafson DR, et al. No apparent association of GSTP1 A (313)G polymorphism with breast cancer risk among postmenopausal Iowa women. Cancer Epidemiol Biomarkers Prev. 2001;10:1301–2. [PubMed] [Google Scholar]