Effect of electroacupuncture on inflammatory signal expression in local tissues of rats with chronic pelvic pain syndrome based on purinergic 2X7 receptor/NOD-like receptor pyrin domain-containing 3 signal pathway

Abstract

OBJECTIVES:

To study the expression of inflammatory signal in local prostate tissue of chronic pelvic pain syndrome (CPPS) rats by electroacupuncture (EA) of Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35) and Sanyinjiao (SP6), and to explore the possible mechanism of anti-inflammatory and analgesic effects of EA.

METHODS：A total of 36 Sprague-Dawley male rats were randomly divided into three groups:

control, model and EA (n=12 rats/group). The CPPS model was made by injection of CFA into ventral lobes of the prostate (0.1 mL). Electric acupuncture apparatus was applied to stimulate Guanyuan (CV4), Zhongji (CV3), bilateral Huiyang (BL35) and Sanyinjiao (SP6) acupoints in EA group. The general condition of rats was observed and the prostate index (PI) was calculated. The thermal pain threshold was collected after each therapeutic course. Histopathological changes of the prostate tissue were examined by hematoxylin-eosin staining method. The expression levels of tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β) and prostaglandin E2 (PGE2) in prostatic homogenates were measured by enzyme linked immunosorbent assay (ELISA). Moreover, the expression levels of purinergic 2X7 receptor (P2X7R), NOD-like receptor pyrin domain-containing 3 (NLRP3), caspase-1 and interleukin-18 (IL-18) mRNA were quantified by quantitative real-time polymerase chain reaction.

RESULTS:

Compared with control group, the PI of rats increased, and the thermal pain threshold decreased significantly in model group. The morphological structure of prostate tissues of rats in model group was severely damaged with a large number of inflammatory cells infiltration. Additionally, the levels of TNF-α, IL-1β and PGE2 were higher, and the expressions of P2X7R, NLRP3, caspase-1 and IL-18 mRNA were higher than those in control group. After EA treatment, the PI was significantly decreased, the thermal pain threshold was significantly increased, and the tissue damage was significantly improved. The expressions of inflammatory cytokines were lower in EA group, and expression of P2X7R/NLRP3 pathway was down-regulated.

CONCLUSION:

The effect of EA at Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35) and Sanyinjiao (SP6) can improve inflammation and pain symptoms of CPPS rats induced by Complete Freund's adjuvant (CFA). This suggests that EA at Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35) and Sanyinjiao (SP6) can produce anti-inflammatory analgesia effect by preventing the activation of P2X7R/NLRP3 signal pathway, inhibit the release of inflammatory cytokines in CPPS rats, which may provide a putative novel target for the treatment of CPPS.

1. INTRODUCTION

Chronic pelvic pain syndrome (CPPS) is a common and frequently occurring disease in the male genitourine-urinary system, accounting for more than 90% of the cases of prostatitis. It is mainly caused by inflammation of the prostate gland stimulated by some non-infectious factors.¹ The main clinical manifestations of CPPS are pain and discomfort in the perineum, external genitalia, bladder and urethra dominated by lumbar and sacral nerves, lower urinary tract symptoms such as frequent micturition, painful micturition and dysuria, sexual dysfunction and related psychological problems.^2,3 Inflammatory pain is one of the most serious health problems worldwide, and it is also the most important type of clinical pain symptoms.^4,5 Inflammation will stimulate inflammatory cells and nerve endings to release inflammatory factors, which are manifested as redness, swelling, heat, pain and dysfunction of local tissue, accompanied by spontaneous pain and hyperalgesia.^6,7 Clinically, although there is evidence to support the effectiveness of nonsteroidal anti-inflammatory drugs (NSAIDs) and opioids in mitigating the inflammatory process that leads to pain with CPPS, their side effects are also obvious.⁸ Pain and inflammatory diseases are important clinical indications of acupuncture, EA refers to the application of a pulsating electrical current to needles for acupoint stimulation, which has been involved in regulating inflammatory and its implicated chronic pain processes.⁹ It has achieved remarkable curative effect in the clinical treatment of CPPS. The aim of this study was to observe the effects of EA on the inflammatory response and pain management in CPPS rats. From the perspective of Traditional Chinese Medicine, Guanyuan (CV4) is the intersection point of the four meridians of spleen, kidney, liver and Ren meridians, which has a function of promoting flow of Qi and body fluid circulation, it’s a common point for the treatment of cold and dull pain in the essence room. Zhongji (CV3) located in “Xiajiao”, associated with essence room and bladder, as well as the intersection point of spleen, kidney, liver and Ren meridians, which can clearing meridians and collaterals. Huiyang (BL35) is an acupoint of the bladder meridian, which also has the function of promoting Qi and body fluid of essence room and bladder. Sanyinjiao (SP6) is an acupoint of the spleen meridian, which has the function of expediting channel and activating meridian, invigorating vital energy and blood and relieve pain, commonly used in the urinary system. The compatibility of these acupoints can play a therapeutic role in CPPS. Therefore, this experiment selected local acupoints Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35), combined with distal acupoints Sanyinjiao (SP6) to explore the possible mechanism of anti-inflammatory and analgesic effects of electroacupuncture (EA).

2. MATERIALS AND METHODS

2.1. Animals

Thirty-six healthy male Sprague-Dawley (SD) rats of specific pathogen free grade, three-month-old, weighing (200 ± 20) g, were supplied by the Beijing Vitong Lihua Laboratory Animal Technology Co., Ltd. (Certificate of quality No. SYXK [Beijing] 2016-0006) and fed in the Laboratory Animal Center of Beijing University of Chinese Medicine. The study was approved by the experimental animal ethics committee of Beijing University of Chinese Medicine.

2.2. Modeling and grouping

Thirty-six rats were randomly divided into 3 groups by random number table method: control, model and EA, 12 rats in each group. Then abdominal surgery was performed to establish CPPS model. All rats were anesthetized with intraperitoneal injection of 1% sodium pentobarbital (Beijing BioDee BioTech Corporation Ltd., Beijing, China) at a dose of 0.35 mL/100 g before surgery. A longitudinal incision was made in the right lower abdomen to expose the prostate. Then the rats in model and EA groups were injected with 0.05 mL of CFA solution (Beijing Benovir Biotechnology Co., Ltd., Beijing, China) into the ventral lobes of prostate on both sides, and the rats in control group were injected with the same dose of sterile saline.¹⁰ All the rats were given penicillin to avoid postoperative infection. After 14 d, the pathological changes of prostate tissue and pain sensitivity were observed to judge whether the CPPS model was successfully prepared. If there were a large number of inflammatory cells infiltrating in the prostate and the pain threshold was significantly reduced, the model was successfully obtained.

2.3. EA Therapy

Rats were loosely immobilized in a quiet and comfortable environment. After the rats settled down, “Guanyuan (CV4)” (located at points 3/5 down the ventral midline connecting the umbilicus to the pubic tubercle¹¹), “Zhongji (CV3)” (located at points 4/5 down the ventral midline connecting the umbilicus to the pubic tubercle¹¹) and bilateral “Sanyinjiao (SP6)” (located at 10 mm proximal to the highest prominence of the medial malleolus, on the posterior border of the medial crest of the tibia¹²) acupoints were selected and acupuncture needles (0.18×13 mm, Beijing Zhongyan Taihe Medical Instrument Co., Ltd.) were inserted with a depth of about 3 mm in a supine position. Then bilateral “Huiyang (BL35)” (located at anteromedial of the transverse process of the 6th lumbar spine¹³) were inserted with a depth of about 6 mm inward toward the spine in a prone position. A set of wires from the HANS-200E electrical stimulator were then connected to the two ipsilateral needles, and density waves (2/100 Hz) of electrical stimulation were set up. Meanwhile, the rats in the control and model groups were bound and fixed without acupuncture intervention. Once daily for four therapeutic courses (5 d as a course), 2 d break between the two courses for testing the thermal hyperalgesia. The whole experimental process is shown in the Figure 1.

Figure 1. Experimental design and procedure.

A: thermal stimulation pain threshold was tested prior to and after 5 d consecutive treatment of EA. a: day 1 to day 14: CPPS model establishment; b: behavioral test before EA; c: day 16 to day 20: the 1st treatment course of EA; d: behavioral test after the 1st treatment course of EA; e: repeat the 1st course of EA for a total of 4 courses. B: schematic diagram showing the location of acupoints [Guanyuan (CV4), Zhongji (CV3), Sanyinjiao (SP6), Huiyang (BL35)] of the rat. EA: electroacupuncture; CPPS: chronic pelvic pain syndrome.

2.4. Thermal stimulation pain threshold

To quantify the thermal pain threshold of the hind paws, we placed rats in individual plastic cage to adapt to the experimental device for at least 30 min. The radiant heat intensity of the instrument (PL-200, Chengdu Technology Market Co., Ltd., Chengdu, China) was set to 50% and the latency reading was set to 30 s. The radiant heat of the light source irradiated the plantar skin of the rats’ right plantar hind paws, and started the stopwatch at the same time. When the rats moved from their original position to escape from the heat stimulation, the stopwatch stopped and the time duration noted. The incubation period from the beginning of heat application to the escape of animals from heat stimulation is considered to be the escape latency. The latency in seconds from the start of heat application till the animal’s escape from the heat stimulus was taken as thermalgesia liminal. Measure 3 times in one animal and calculate the average value.¹⁴

2.5. Measurement of wet weight of prostate and prostatic index (PI)

All the rats were sacrificed under anesthesia after behavioral experiments. The prostates were immediately separated, rinsed with phosphate-buffered saline to remove adherent blood and fat tissues, and weighed to analyze the prostate index. Prostatic index was calculated as follows: PI = prostate weight (mg)/body weight (g).

2.6. Histological examination

For the histological examination, the same area of prostate tissues from each group were fixed in 4% paraformaldehyde (Beijing Coolaber Co., Ltd., Beijing, China) for 2 d, rinsed with tap water for 24 h, and gradually dehydrated with 75%-100% ethanol. Then followed by treatment with xylene transparent solution, immersed in paraffin, embedded in paraffin, serial sectioned at 4 μm, and stained with haematoxylin and eosin. The pathological change and morphology of rat prostate were observed by microscope.

2.7. Measurements of tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β) and prostaglandin E2 (PGE2) by ELISA

The levels of TNF-α, IL-1β and PGE2 were measured by using ELISA kits following the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). First, the diluted standard and diluted tissue supernatant (50 μL) were added in a 96-well micro ELISA plate. Then add biotin antigen working solution (50 μL) incubating at 37 ℃ for 30 min. After incubation, the plate was washed using the provided washing buffer. Then add Avidin-HRP Diluent (50 μL) to each well, except blank well. Chromogenic, finally add stop solution (50 μL) into each well to stop the reaction. Make zero setting by empty well, measure the optical density (OD) of each well under 450 nm wavelength, ELISACalc software was used for calculation.

2.8. qRT-PCR technique was used to observe the mRNA expression levels of P2X7R, NLRP3, caspase-1 and IL-18

Total RNA was extracted using HiPure Total RNA Mini Kit (Guangzhou Magen Biotechnology Co., Ltd., Guangzhou, China). RNA was quantified by spectrophotometry. The First-Strand Synthesis Master Mix (Beijing LABLEAD Biotech Co., Ltd., Beijing, China) were used for reverse transcription to obtain cDNA. Primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). GAPDH was used as an internal reference gene. Primer sequences are listed in Table 1. The reaction mixture (total volume 10 μL) was prepared using cDNA (1 μg/μL), forward and reverse primers (0.5 μL), PowerUp^TMSYBR^TM Green Master Mix (5 μL) (Life Technologies), and Nuclease-Free Water (3 μL). The amplification was carried out with an initial denaturation step at 95 ℃ for 3 min, followed by 44 repeated thermal cycles (95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 30 s, 95 ℃ for 2 min). The relative quantification of P2X7R, NLRP3, caspase-1 and IL-18 mRNA normalized to GAPDH and relative to a calibrator, was measured by 2^-ΔΔCt. ΔΔCt = [(Ct_{target (unknown sample)}-Ct_{end.control (unknown sample)})] – [(Ct_{target (calibrator sample)}-Ct_{end.control (calibra®or sample)})].¹⁵

Table 1.

Primer sequence of detection genes

Gene	Primer sequence(5’-3’)
P2X7R	Forward primer: AGGTGGCAGTTCAGGGAGGAATC Reverse primer: TGTATTTGGGTTGACAGCGATGGG
NLRP3	Forward primer: GAGCTGGACCTCAGTGACAATGC Reverse primer: AGAACCAATGCGAGATCCTGACAAC
caspase-1	Forward primer: AAACACCCACTCGTACACGTCTTG Reverse primer: AGGTCAACATCAGCTCCGACTCTC
IL-18	Forward primer: GGCCTCTATTTGAAGATATGACTGATT Reverse primer: CCTCTAGGCTGGCTATCTTTATACATAC
GAPDH	Forward primer: ACCACAGTCCATGCCATCAC Reverse primer: TCCACCACCCTGTTGCTGTA

Notes: P2X7R: purinergic 2X7 receptor; NLRP3: NOD-like receptor pyrin domain-containing 3; IL-18: interleukin-18.

2.9. Statistical analysis

Differences between groups were compared using IBM SPSS software Windows version 20.0 (IBM Corp, New York, Armonk, USA). One-way analysis of variance for multiple comparisons followed by Tukey’s post hoc test was performed for the data with normal distribution. The data were represented as mean ± standard deviation ($\bar{x} \pm s$). The Mann Whitney rank sum test was performed for the data with nonnormal distribution. A P-value < 0.05 was considered to indicate a statistically significant difference.

3. RESULTS

3.1. Effect of EA on general conditions of CPPS rats

There were no significant changes in control group. In model group, the activity decreased, the gloss of fur decreased and the amount of urine increased. EA treatment effectively improved the activity and decreased the urine volume compared with the model rats.

3.2. Effect of EA on prostatic index of CPPS rats

As shown in Table 2, the body weight was significantly reduced (P < 0.01), the wet weight of prostate and PI were significantly increased (P < 0.01) in model group. Whereas, the body weight was obviously increased (P < 0.01), the wet weight of prostate and PI were significantly reduced (P < 0.01) in EA group.

Table 2.

Comparisons of body weight, wet weight of prostate and PI in rats ($\bar{x} \pm s$)

Group	n	Body weight (g)	Wet weight of prostate (mg)	PI
Control	8	405.69±16.77	452.55±21.46	1.12±0.07
Model	8	361.1±13.81a	703.11±40.48a	1.95±0.17a
EA	8	399.43±17.95b	473.56±25.13b	1.19±0.09b

Notes: control group: normal rats; model group: CPPS rats without treatment; EA group: CPPS rats treated with EA, once daily for four therapeutic courses. CPPS: chronic pelvic pain syndrome; PI: prostatic index; EA: electroacupuncture. ^aP < 0.01, compared with the control group; ^bP < 0.01, compared with the model group.

3.3. Effect of EA on inflammatory pain hypersensitivity of CPPS rats

The thermal pain threshold in all experimental groups at each time point was shown in Table 3. At the same time periods, the pain threshold of model group was all reduced significantly compared with control group (P < 0.01). Similarly, before the 3rd treatment course, the pain threshold of rats in EA group was reduced significantly compared with control group (P < 0.01). After the 3rd treatment course, EA treatment effectively rescued the pain threshold as compared to that in model group (P < 0.01).

Table 3.

Thermal stimulation pain threshold of rats in each group at different time periods (s, $\bar{x} \pm s$)

Group	n	Before acupuncture	1st course	2nd course	3rd course	4th course
Control	10	11.2±0.8	11.0±0.9	10.9±0.8	10.8±1.1	10.6±0.5
Model	10	5.4±0.4a	5.5±0.7a	5.5±0.5a	5.4±0.6a	5.4±0.6a
EA	10	5.6±0.5a	6.0±0.5a	6.7±0.6a	8.0±0.7b	10.0±0.7b

Notes: control group: normal rats; model group: CPPS rats without treatment; EA group: CPPS rats treated with EA, once daily for four therapeutic courses. CPPS: chronic pelvic pain syndrome; EA: electroacupuncture. ^aP < 0.01, compared with the control group at the corresponding time point; ^bP < 0.01, compared with the model group at the corresponding time point.

3.4. Effect of EA on the expression of TNF-α, IL-1β and PGE2 in prostate homogenate

As shown in Table 4, CFA solution up-regulated the concentrations of inflammatory cytokines (TNF-α, IL-1β, PGE2) in model group (P < 0.01). Whereas, the concentrations of these cytokines were significantly decreased in the EA group as compared to model group (P < 0.01).

Table 4.

Expressions of TNF-α, IL-1β and PGE2 of rats in each group (ng/mL)

Group	n	TNF-α	IL-1β	PGE2
Control	8	114.4±6.7	42.3±9.8	144.1±25.7
Model	8	170.7±8.8a	113.0±16.3a	251.7±10.5a
EA	8	118.7±9.4b	52.6±13.3b	153.6±27.8b

Notes: control group: normal rats; model group: CPPS rats without treatment; EA group: CPPS rats treated with EA, once daily for four therapeutic courses. EA: electroacupuncture; TNF-α: tumor necrosis factor α; IL-1β: interleukin-1β; PGE2: prostaglandin E2. Data are expressed as the median with interquartile range. ^aP < 0.01, compared with the control group; ^bP < 0.01, compared with the model group.

3.5. Effect of EA on prostate damage in CPPS rats

As shown in Figure 2, the prostate histological structure was clear and the gland cavity was regular in control group. Compared with control group, pathological changes in the prostate tissues of the model group showed an irregular and disordered gland cavity, with a large number of infiltrated inflammatory cells in the stroma, and the secretions in acini reduced in varying degrees. Whereas, the prostate histological structure of the EA group was significantly alleviated.

Figure 2. Comparison of prostatic histomorphology in rats.

A-C: HE staining of rat prostate tissue. A: histomorphology of prostate in the control group (×100); B: histomorphology of prostate in the model group (×100). Box represents atrophy of glandular cavity and decrease of secretion, arrow represents inflammatory cells infiltration; C: histomorphology of prostate in the EA group (×100). HE: hematoxylin-eosin; EA: electroacupuncture.

3.6. Effect of EA on the gene expression of P2X7R, NLRP3, caspase-1 and IL-18 mRNA

As shown in Table 5, the result showed that the expression levels of P2X7R, NLRP3, caspase-1 and IL-18 mRNA all up-regulated significantly after modeling (P < 0.05, P < 0.01). And the treatment of EA caused a significant decrease in the level of P2X7R, NLRP3, caspase-1 and IL-18 mRNA (P < 0.05, P < 0.01) as compared to model group.

Table 5.

Comparison of the expression levels of P2X7R, NLRP3, Caspase-1 and IL-18 mRNA of each group ($\bar{x} \pm s$)

Group	n	P2X7R mRNA	NLRP3 mRNA	Caspase-1 mRNA	IL-18 mRNA
Control	6	1.20±0.68	1.12±0.53	1.10±0.61	1.04±0.35
Model	6	3.83±2.01a	35.65±21.16b	6.73±3.44b	1.75±0.88a
EA	6	1.73±1.02c	1.54±0.39d	2.05±1.53c	1.09±0.25c

Notes: control group: normal rats; model group: CPPS rats without treatment; EA group: CPPS rats treated with EA, once daily for four therapeutic courses. EA: electroacupuncture; P2X7R: purinergic 2X7 receptor; NLRP3: NOD-like receptor pyrin domain-containing 3; IL-18: interleukin-18. ^aP < 0.05, ^bP < 0.01, compared with the control group; ^cP < 0.05, ^dP < 0.01, compared with the model group.

4. DISCUSSION

Acupuncture, as a kind of complementary and alternative medicine, has been accepted worldwide. Acupuncture is a method of inserting needles into specific points of the body (called acupoints) to achieve therapeutic effects. Studies have shown that acupuncture can promote the effect of relieving pain, urinary tract symptoms, improving the quality of life and total NIH-CPSI score in CPPS patients.¹⁶ The acupoints can regulate the body functions from the aspects of nervous system, humoral and immune systems.^17,⇓-19 Research showed that acupuncture can produce local, segmental and central effects through the nervous system.²⁰ The nerves are distributed under Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35) and Sanyinjiao (SP6) overlap with those innervating the prostate. Guanyuan (CV4) and Zhongji (CV3) are located in the local prostate tissue and body surface projection areas, under which parasympathetic nerves are distributed. Acupuncture can regulate the activity of prostate by stimulating parasympathetic nerve and relieve local pain and muscle spasm around penis and testis.²⁰ Huiyang (BL35) is located in the projection area of the back body surface of the prostate. EA can directly stimulate the posterior branch of the sacral nerve to improve the urinary symptoms of CPPS patients by inhibiting segmental pain.²¹ Tibial nerve is distributed under Sanyinjiao (SP6). When electrically stimulated, it can reach the dorsal root of spinal cord through tibial nerve and regulate the function of organs through central feedback.²² Therefore, acupuncture at these acupoints may improve the urinary symptoms of CPPS, such as chronic pain, frequent urination and urgent urination through neural overlap projection.

With the development of immunology research, experts believe that CPPS may be the result of the body's autoimmune response to a specific urinary and reproductive system antigen, and the imbalance of inflammatory cytokines in the body can cause damage to prostate tissue, pain and other symptoms.²³ Acupuncture is widely used in the anti-inflammatory of autoimmune diseases with definite curative effect. It can reduce the pro-inflammatory factors, increase the anti-inflammatory factors and regulate the body's immunity, cytokines play an important role in its effect.²⁴ Different types of CPPS and different stages in the development process are accompanied by fine regulation of cytokine levels. The interaction between inflammasomes, inflammatory cells and cytokines promote the occurrence and development of CPPS.²⁵ Acupuncture can regulate the expression of cytokines, and achieve anti-inflammatory effect by inhibiting the expression of pro-inflammatory cytokines and promoting the expression of anti-inflammatory cytokines. IL-1β is an important member of IL-1 family, mainly produced by macrophages. It is an important mediator in promoting the occurrence of inflammation and it plays an important role in infection, injury and immune response.²⁶ IL-1β can promote the expression of adhesion factors by endothelial cells and vascular cells, make monocytes, T lymphocytes and leukocytes exude from blood vessels and invade the prostate, so as to cause tissue lesions.²⁷ IL-1β can also induce the gene expression of cyclooxygenase 2, which results in the production of a large number of PGE2 to cause numerous biological effects.²⁸ TNF- α mainly acts on endothelial cells and increases the expression of adhesion molecules to promote the adhesion, migration, infiltration and degranulation of inflammatory cells. At the same time, it also acts on macrophages by autocrine way to release inflammatory transmitters, such as prostaglandins which can promote inflammatory response.²⁵

P2X7R has attracted increasing attention for its role in various inflammatory diseases. Studies have shown that P2X7R is up-regulated in various inflammatory pathological states, and it can affect the expression of inflammatory mediators, participate in inflammatory and immune responses, and induce cell damage and even apoptosis.²⁸ P2X7R can activate NLRP3 after being activated by ligand ATP.²⁹ NLRP3 inflammasome is assembled by NLRP3, ASC and caspase-1. It also plays an important role in immunity and inflammation. When NLRP3 inflammasome is activated, ASC and caspase-1 can be recruited, and then the inactive precursor caspase-1 can be transformed into active caspase-1 by cutting its precursor, so as to activate the downstream pathways and promote the secretion and release of IL-1β, IL-18 and PGE2.^30,31 The activated P2X7R can also activate the Egr transcription factor through the ERK/P38 MAPK signaling pathway, which induces the production of TNF-α.³²

In the present study, we detected the expression of TNF-α, IL-1β, PGE2 in prostate tissue, the genes expression levels of P2X7R, NLRP3, caspase-1 and IL-18 mRNA in prostate were all up-regulated, which indicating that the activated P2X7R can activate NLRP3 inflammatory receptor. This may be an important mechanism leading to the up-regulation of the expression levels of infla-mmatory factors in CPPS. After the intervention of EA, the expression levels of these substances were down reg-ulated, which proved the anti-inflammatory effect of EA.

The core indicator of CPPS is obvious inflammation of the prostate tissue. Pathological observation can accurately confirm the severity of prostatitis, and a light microscope is used to observe whether there is infiltration of inflammatory cells, as well as whether there is tissue edema, etc.³³ In this study, through microscopic observation, we found the acinar cavity of model group was reduced and atrophied, and a large number of inflammatory cells infiltrated in the stroma. After the intervention of EA, the infiltration of inflammatory cells in the stroma subsided significantly, and the shape of acini was improved in varying degrees. It shows that EA can restore the physiological function of prostate by improving the pathological structure of prostate tissue.

Apparent indicators include the wet weight, prostate index, urine output and activities.³³ After the CPPS model was successfully prepared, the wet weight of prostate and PI increased, the amount of urine increased, the activity decreased and the gloss of fur decreased, which were consistent with our experimental results. After the intervention of EA, all the symptoms above were effectively rescued.

Pain is also the most prominent manifestation of CPPS, and its impact on the quality of life of patients is greater than any other symptoms.³⁴ Inflammatory response is an important cause of promoting CPPS pain. The inflammatory response caused by prostate tissue injury can release a series of pain related substances, such as PGE2. The expression of these substances is significantly correlated with the pain sensitivity of CPPS.³⁵ In addition, P2X7R also involved in pain transduction. In rats with inflammatory pain, visceral pain and neuropathic pain, local or intraperitoneal injection of P2X7 antagonist can inhibit mechanical hyperalgesia and hypersensitivity.³⁶ The results of this study show that the thresholds of plantar thermal pain of rats are significantly reduced after modeling, and show a rising trend after EA treatment. And after the third EA course of treatment, there is a significant difference compared with the model group rats. This indicates that EA can play an anti-inflammatory and analgesic role by inhibiting the expression of pain related factors.

In conclusion, EA at Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35) and Sanyinjiao (SP6) can significantly reduce the pain sensitivity of CPPS rats and improve the histopathological condition of prostate. Its mechanism may be active the pathway of P2X7R/NLRP3, so as to reduce the expression levels of TNF-α, IL-1β, PGE2. By regulating the complex network system composed of a variety of cytokines, restoring the balance of the unbalanced immune state of the body, so as to improve the local inflammation of the prostate, promoting the repair of prostate tissue, and relieving pain. This conclusion can provide a theoretical basis for the clinical treatment of CPPS, However, the exact mechanism of anti-inflammatory and analgesic effect of EA need to be further discussed.