Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2023 Jan 3;120(2):e2214829120. doi: 10.1073/pnas.2214829120

Circadian regulator BMAL1::CLOCK promotes cell proliferation in hepatocellular carcinoma by controlling apoptosis and cell cycle

Meng Qu a,b,1, Guoxin Zhang c,d,1, Han Qu e, Alexander Vu b, Raymond Wu f, Hidekazu Tsukamoto f, Zhenyu Jia e,g, Wendong Huang h, Heinz-Josef Lenz i, Jeremy N Rich c,d, Steve A Kay b,2
PMCID: PMC9926257  PMID: 36595671

Significance

The circadian clock modulates the expression of many protein-coding genes in most cell types, thereby playing a key role in human health. Recent discoveries have unveiled the circadian clock as a novel pathway for therapeutic intervention in cancer. Liver cancer remains a major public health concern globally and is closely associated with dysregulated circadian parameters. However, the underlying mechanism is currently unknown. Our findings establish anti-apoptotic roles of the master clock regulators BMAL1 and CLOCK in promoting proliferation of liver cancer cells and reveal an underpinning mechanism being mediated by the cancer-state essential gene Wee1.

Keywords: circadian clock, hepatocellular carcinoma, cell cycle, apoptosis

Abstract

Hepatocellular carcinoma (HCC) remains a global health challenge whose incidence is growing worldwide. Previous evidence strongly supported the notion that the circadian clock controls physiological homeostasis of the liver and plays a key role in hepatocarcinogenesis. Despite the progress, cellular and molecular mechanisms underpinning this HCC-clock crosstalk remain unknown. Addressing this knowledge gap, we show here that although the human HCC cells Hep3B, HepG2, and Huh7 displayed variations in circadian rhythm profiles, all cells relied on the master circadian clock transcription factors, BMAL1 and CLOCK, for sustained cell growth. Down-regulating Bmal1 or Clock in the HCC cells induced apoptosis and arrested cell cycle at the G2/M phase. Mechanistically, we found that inhibiting Bmal1/Clock induced dysregulation of the cell cycle regulators Wee1 and p21 which cooperatively contribute to tumor cell death. Bmal1/Clock knockdown caused downregulation of Wee1 that led to apoptosis activation and upregulation of p21 which arrested the cell cycle at the G2/M phase. Collectively, our results suggest that the circadian clock regulators BMAL1 and CLOCK promote HCC cell proliferation by controlling Wee1 and p21 levels, thereby preventing apoptosis and cell cycle arrest. Our findings shed light on cellular impact of the clock proteins for maintaining HCC oncogenesis and provide proof-of-principle for developing cancer therapy based on modulation of the circadian clock.


Hepatocellular carcinoma (HCC), the most common form of liver cancer, is the third leading cause of cancer-related deaths worldwide. As the incidence of viral hepatitis-related liver cancer has declined due to preventive interventions and treatments, other etiologies such as non-alcoholic fatty liver disease (NAFLD) and alcohol-associated liver disease (ALD) are emerging as leading risk factors associated with rising HCC cases (1). Molecularly targeted therapeutics have demonstrated efficacy for HCC treatment; the combination of atezolizumab (anti-PD-L1 antibody) and bevacizumab (anti-vascular endothelial growth factor antibody) has become the new standard first-line treatment demonstrating superior survival and response rate compared to the prior standard of sorafenib (2). While these agents have the potential to improve patient outcomes, the efficacy is far from adequate, and the objective response rates are still low (about 25%) (3). Defining the underlying molecular mechanisms driving HCC initiation and growth is urgently needed to lay the foundation for novel molecularly targeted therapeutic approaches.

The circadian clock represents an evolutionarily conserved mechanism that achieves the coordination of physiological processes and behavior with the day-night cycles. The molecular clock centered on the transcription factor BMAL1 and its partner CLOCK (BMAL1::CLOCK) establishes rhythmic expression of most protein-coding genes in mammalian genomes, thereby gating key physiological outputs, including sleep, feeding, hormone secretion, metabolism, and immune responses (4, 5). Several studies have demonstrated that core clock genes, including Bmal1 and Clock, are commonly dysregulated or mutated in cancer cells (6, 7). Epidemiological and genetic studies have uncovered reciprocal regulation of disrupted circadian homeostasis and oncogenic processes in the context of several cancer types (8–14). Importantly, modulation of the core clock by small molecules has recently emerged as a promising new approach in cancer therapy, thus providing a possible path toward experimental therapeutics (10, 14).

Due to the distinct chromatin landscape shaped by tissue-specific pioneer factors, the liver represents a physiological hub for circadian regulation (4, 15, 16). The hepatic circadian transcripts are involved in principal functions of the liver, including glucose homeostasis, lipogenesis, bile acid synthesis, mitochondrial biogenesis, oxidative metabolism, amino acid turnover, and xenobiotic detoxification (17). Chronic jet lag disturbing the circadian rhythms accelerated diethylnitrosamine (DEN)-induced liver carcinogenesis (18) and caused spontaneous HCC development following increased susceptibility to NAFLD (19). Alterations of the circadian clock genes are correlated with survival and clinical outcome of HCC patients (6). Accordingly, the circadian control of liver physiological homeostasis plays a key role in hepatocarcinogenesis. Despite the genetic correlations, the molecular functions of the clock genes implicated in HCC pathogenesis are still enigmatic, which hampers the efforts to leverage therapeutic strategies targeting clock proteins in HCC.

In the present study, we report that the core clock genes Bmal1 and Clock play a pro-proliferative role in HCC by controlling cell cycle regulators. Down-regulating Bmal1 and Clock induced HCC cytotoxicity, activated apoptosis, and altered cell cycle progression. Wee1 encoding an essential kinase in the G2/M checkpoint and p21Cdkn1a/Waf1/Cip1 (referred to as p21 hereafter) encoding a cyclin-dependent kinase inhibitor that negatively regulate cell cycle progression are transcriptional targets of the circadian clock circuit that contribute to Bmal1/Clock-promoted HCC cell proliferation. Bmal1/Clock knockdown induced downregulation of Wee1 leading to enhanced apoptosis. However, the G2/M phase arrest caused by Bmal1/Clock knockdown was independent of Wee1 but associated with altered expression of the p21 gene. Therefore, Bmal1 and Clock control HCC cell proliferation through divergent molecular mechanisms that involve the inhibition of apoptosis and cell cycle arrest.

Results

The Core Clock Genes Bmal1 and Clock Are Indispensable for HCC Cell Growth.

We first interrogated the circadian rhythms in three widely used human HCC cells, Hep3B, HepG2, and Huh7, finding each displayed a distinct pattern (Fig. 1 A–C), with the Hep3B cells oscillating most robustly and the Huh7 cells not technically cycling according to circadian parameters (SI Appendix, Fig. S1). To study the functional roles of the core circadian clock in the HCC cells, we targeted Bmal1 and Clock by introducing siRNA-mediated gene knockdown. Despite the heterogeneous intrinsic circadian oscillations, targeting either Bmal1 or Clock potently impaired the proliferation of all three HCC cell lines (Fig. 1 D–I). We validated the clock machinery dependency in vivo with Hep3B xenografts by showing that shRNA-mediated Bmal1/Clock knockdown strongly inhibited tumor growth (Fig. 1 J and K). Therefore, the master circadian clock transcription factor heterodimer BMAL1::CLOCK plays a critical role in HCC cell proliferation, irrespective of the robustness of circadian oscillations or other genetic backgrounds, and is relevant to impaired tumor growth in vivo.

Fig. 1.

Fig. 1.

The core clock genes Bmal1 and Clock are required for HCC cell growth independent of circadian oscillation. (A–C) Representative bioluminescence of Bmal1-Luc reporter in Hep3B (A), HepG2 (B), and Huh7 (C) cells synchronized by 150 nM dexamethasone (n = 3). (D–F) Relative cell numbers of Hep3B (D), HepG2 (E), and Huh7 (F) transfected with scramble, Bmal1, or Clock siRNA. Data are represented as mean ± SD (n = 4). Statistical significance was determined by two-way ANOVA with Tukey multiple comparison test (***P < 0.001). (G–I) Transcript level of genes in Hep3B (G), HepG2 (H), and Huh7 (I) transfected with scramble, Bmal1, or Clock siRNA was determined by RT-qPCR. Displayed are the means ± SD (n = 3 cell culture wells) normalized to Rplp0 expression levels. Statistical significance was determined by a two-tailed Student’s t test (***P < 0.001). (J and K) NU/J nude mice were subcutaneously injected with 3 × 106 Hep3B cells transduced with indicated shRNAs. Xenograft tumors were imaged (J) and weighed (K). Displayed are the means ± SD (n = 3). Statistical significance was determined by Student’s t test (***P < 0.001).

Targeting Bmal1 and Clock Induces Apoptosis and Cell Cycle Arrest in HCC.

To elucidate the molecular mechanisms underlying BMAL1::CLOCK-regulated HCC proliferation, we determined cellular effects of Bmal1 and Clock knockdown. Flow-cytometric measurement of Annexin V and propidium iodide (PI) staining as well as the cleavage of CASPASE 3 revealed the activation of bonafide apoptosis upon Bmal1 or Clock knockdown (Fig. 2 A and B and SI Appendix, Fig. S2). Bmal1/Clock-targeted HCC cells displayed a decreased G1 fraction and a concomitant increase in the G2/M fraction relative to cells transduced with a non-targeting control siRNA (Fig. 2 C and D), indicating inhibited cell cycle progression. To determine if similar regulation occurs in normal tissues, we performed RT-qPCR characterization of the Bmal1 knockout mouse liver, which identified extensively disrupted transcription of cell cycle genes compared to the wild-type liver; specifically, Wee1 and Ccnb1 were down-regulated and p21 and Myc were up-regulated (Fig. 2E). Therefore, BMAL1::CLOCK may control transcription of the cell cycle regulators (20).

Fig. 2.

Fig. 2.

Down-regulating Bmal1/Clock activates apoptosis and G2/M phase cell cycle arrest. (A) Representative flow cytometry analysis of FITC-Annexin V/PI staining in Hep3B cells transfected with scramble, Bmal1, or Clock siRNA. (B) Quantification of FITC-Annexin V/PI-positive cells presented in (A). Displayed are the means ± SD (n = 3). Statistical significance was determined by Student’s t test (***P < 0.001). (C) Representative cell cycle analysis of Hep3B cells following transfection with scramble, Bmal1, or Clock siRNA. (D) Quantification of cell cycle phases presented in (C). Displayed are the means ± SD (n = 3). Statistical significance was determined by Student’s t test (**P < 0.01, ***P < 0.001). (E) Control and Bmal1 knockout mouse livers were harvested at 4-h intervals throughout 24 h. Transcript level of genes was analyzed by using RT-qPCR. Displayed are the means ± SD (n = 3 or 4) normalized to non-oscillating Rplp0 expression levels. P-values determined by two-tailed Student’s t test were displayed (*P < 0.05, **P < 0.01, ***P < 0.001).

The Circadian Clock Contributes to Control of Cell Cycle Progression by Transcriptional Regulation of Ccnb1, p21, and Myc.

We were accordingly prompted to investigate whether BMAL1::CLOCK promotes the growth of HCC cells by modulating cell cycle progression and division. We first inspected the mechanism underpinning clock-regulated cell cycle progression. As cell cycle progression requires well-orchestrated transcriptional control of the cell cycle regulators (21), we characterized the impact of the altered transcription of cell cycle genes in response to Bmal1 depletion (Fig. 2E). siRNA-mediated Wee1 downregulation induced G1 phase accumulation (Fig. 3 A and B), which is compatible with its functional roles in activating the G2/M checkpoint (22). In contrast, the knockdown of Ccnb1, a G2/M-specific cyclin, reduced the fraction of cells in G1 phase and increased the proportion of cells in the G2/M phase (Fig. 3 A and B). Overexpression of p21, a cyclin-dependent kinase inhibitor that promotes cell cycle arrest (23), increased the fraction of cells arrested in G2/M phase (Fig. 3 C and D). Consistent with previous studies (24), induction of Myc expression increased cell population arrested in the G2/M phase (Fig. 3 C and D). Therefore, the G2/M phase cell cycle arrest resulting from Bmal1/Clock knockdown (Fig. 2 C and D) is likely associated with transcriptional downregulation of Ccnb1 and upregulation of p21 and Myc.

Fig. 3.

Fig. 3.

Ccnb1 knockdown and p21 or Myc overexpression cause G2/M phase arrest. (A) Representative cell cycle analysis of Hep3B cells following transfection with scramble, Wee1, or Ccnb1 siRNA. (B) Quantification of cell cycle phases presented in (A). Displayed are the means ± SD (n = 3). Statistical significance was determined by Student’s t test (***P < 0.001; ns, not significant). (C) Representative cell cycle analysis of Hep3B cells following lentiviral transduction of EGFP, p21, or Myc gene. (D) Quantification of cell cycle phases presented in (C). Displayed are the means ± SD (n = 3). Statistical significance was determined by Student’s t test (***P < 0.001).

BMAL1::CLOCK Promotes HCC Cell Proliferation by Suppressing the Cell Cycle Regulator p21.

Cell cycle checkpoints regulate the rate of cell division. Next, we assessed whether the Ccnb1, Myc, and p21-associated G2/M phase cell cycle arrest in response to Bmal1/Clock downregulation reduced cell proliferation. Knockdown of Ccnb1 alone had a minor impact on HCC cell growth (Fig. 4 A–F). Also, upregulation of the proto-oncogene Myc is unlikely to lead to HCC proliferation inhibition. Therefore, the G2/M phase arrest does not necessarily result in reduced cell proliferation per se, in concordance with previous reports that depending on molecular context, either inhibition or activation of the G2/M checkpoint can induce cell death (25).

Fig. 4.

Fig. 4.

Bmal1/Clock controls HCC cell growth by suppressing p21. (A–C) Relative cell numbers of Hep3B (A), HepG2 (B), and Huh7 (C) transfected with scramble or Ccnb1 siRNA. Data are represented as mean ± SD (n = 4). Statistical significance was determined by two-way ANOVA with Tukey multiple comparison test (ns, not significant). (D–F) Transcript level of genes in Hep3B (D), HepG2 (E), and Huh7 (F) transfected with scramble or Ccnb1 siRNA was determined by RT-qPCR. Displayed are the means ± SD (n = 3 cell culture wells) normalized to Rplp0 expression levels. Statistical significance was determined by a two-tailed Student’s t test (***P < 0.001). (G) Relative cell numbers of Hep3B transfected with scramble, Bmal1, Clock, or p21 siRNA. Data are represented as mean ± SD (n = 4). Statistical significance was determined by two-way ANOVA with Tukey multiple comparison test (***P < 0.001). (H) Transcript level of genes in Hep3B transfected with scramble, Bmal1, Clock, or p21 siRNA was determined by RT-qPCR. Displayed are the means ± SD (n = 3 cell culture wells) normalized to Rplp0 expression levels. Statistical significance was determined by a two-tailed Student’s t test (**P < 0.01, ***P < 0.001; ns, not significant).

Bmal1 knockout increased the basal level of p21 and reversed its peak expression from ZT0 to ZT12 (Fig. 2E). Gréchez-Cassiau and co-workers reported that the cyclic expression of p21 was controlled by the RORE-binding clock transcription factors REV-ERBs and RORs and up-regulated p21 was responsible for the decreased hepatocyte proliferation rate in the Bmal1 knockout mouse liver (26). We found that concurrent knockdown of p21 partially rescued HCC growth inhibition induced by Bmal1/Clock knockdown (Fig. 4 G and H). p21 overexpression did not substantially change the activity of apoptosis in Hep3B cells (SI Appendix, Fig. S3), in line with previous reports (27). Collectively, our findings indicate that BMAL1::CLOCK negatively regulates the RORE-containing cell cycle regulator p21 to maintain proliferation rate of HCC cells.

BMAL1::CLOCK Promotes HCC Cell Proliferation by Stimulating Expression of the Cancer-state Essential Gene Wee1.

Cancer cells are reliant on WEE1-activated G2/M checkpoint to cope with DNA damage and avoid apoptosis (28). Analogous to Bmal1/Clock knockdown, we found that down-regulating Wee1 attenuated proliferation and caused apoptosis in HCC cells (Fig. 5 A–H). As depleting Bmal1 significantly reduced Wee1 levels in both mouse liver and Hep3B cells (Fig. 2E and SI Appendix, Fig. S4), we asked whether Wee1 downregulation contributed to cell lethality resulting from BMAL1::CLOCK inhibition. Overexpression of Wee1 did not change the expression levels of Bmal1 and Clock (Fig. 5I) but could partially rescue cell growth inhibition caused by BMAL1::CLOCK downregulation (Fig. 5J). Wee1 transcription showed robust circadian oscillation in the mouse liver, peaking at the end of the day, in phase with the classical BMAL1::CLOCK target gene Dbp (Fig. 2E). BMAL1 chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) indicated that BMAL1::CLOCK binds Wee1 genes in both mouse liver and Hep3B cells (Fig. 5K). Therefore, Wee1 inhibits apoptosis and contributes to BMAL1::CLOCK-controlled HCC cell growth.

Fig. 5.

Fig. 5.

Bmal1/Clock controls HCC cell growth by activating Wee1. (A–C) Relative cell numbers of Hep3B (A), HepG2 (B), and Huh7 (C) transfected with scramble, Bmal1, Clock, or Wee1 siRNA. Data are represented as mean ± SD (n = 4). Statistical significance was determined by two-way ANOVA with Tukey multiple comparison test (***P < 0.001). (D–F) Transcript level of genes in Hep3B (D), HepG2 (E), and Huh7 (F) transfected with scramble or Wee1 siRNA were determined by RT-qPCR. Displayed are the means ± SD (n = 3 cell culture wells) normalized to Rplp0 expression levels. Statistical significance was determined by a two-tailed Student’s t test (***P < 0.001). (G) Representative flow cytometry analysis of FITC-Annexin V/PI staining in Hep3B cells transfected with scramble or Wee1 siRNA. (H) Quantification of FITC-Annexin V/PI-positive cells presented in (G). Displayed are the means ± SD (n = 3). Statistical significance was determined by Student’s t test (***P < 0.001). (I) Transcript level of genes in Hep3B stably overexpressing GFP or Wee1 was determined by RT-qPCR. Displayed are the means ± SD (n = 3 cell culture wells) normalized to Rplp0 expression levels. Statistical significance was determined by a two-tailed Student’s t test (***P < 0.001; ns, not significant). (J) Relative cell numbers of Hep3B stably overexpressing GFP or Wee1 followed by transfection with Bmal1 or Clock siRNA. Cell numbers were normalized to Hep3B cells transfected with scramble siRNA of the same time point. Data are represented as mean ± SD (n = 4). Statistical significance was determined by two-way ANOVA with Tukey multiple comparison tests (***P < 0.001). (K) IGV genome tracks showing BMAL1 enrichment at the Wee1 gene loci in the mouse liver and Hep3B cells, based on normalized ChIP-seq read coverage. Track heights are indicated. (L) Mechanism of BMAL1::CLOCK-regulated HCC oncogenesis. BMAL1::CLOCK binds the E-box element on chromatin and activates the transcription of Rev-erbs and Wee1. REV-ERBs suppresses the expression of p21 through binding RORE element. The inhibition of cell cycle arrest and apoptosis, which are activated by p21 downregulation and Wee1 upregulation, respectively, collaboratively contribute to pro-proliferative activity of BMAL1::CLOCK.

Discussion

Previous studies strongly support the crosstalk between HCC and the circadian clock. Modeling chronic jet lag to disrupt the circadian rhythms accelerated DEN-induced murine liver carcinogenesis (18) and even increased the incidence of spontaneous HCC associated with NAFLD (19). However, as chronic jet lag induced circadian desynchrony of most key clock genes, it is challenging to generalize from the results to the role of any single clock component in the observed HCC predisposition. Conversely, circadian transcript analysis of patient specimens revealed that a large body of genes cycling in noncancerous tissues, including specific core clock genes, lost oscillations in HCC tumors (29–34). Here, our results provide molecular insights into this HCC-clock crosstalk by unveiling that the core clock transcription factor BMAL1::CLOCK is hijacked by cancer cells to fuel rapid cell proliferation and inhibit apoptosis in HCC, independent of the genetic background or core clock oscillations.

Mechanistically, inhibiting Bmal1 or Clock triggered systemic dysregulation of the cell cycle in HCC cells featured by activation of cell cycle arrest and apoptosis. Relative to Bmal1, we found knocking down Clock induced more apoptosis and arrested cell cycle at both the S and G2/M phases. It will be of interest for future studies to investigate whether the difference is because of potentially differentiated biological functions of the Bmal1 and Clock genes or solely due to higher knockdown efficiency of the Clock siRNA (Fig. 1 G–I). Further, we provide genetic evidence supporting a scenario in which transcriptional alterations of the key cell cycle regulators Wee1 and p21 cooperatively contribute to cell growth inhibition in cells where BMAL1::CLOCK is down-regulated. BMAL1::CLOCK downregulation halted the cell cycle progression by up-regulating p21 and meanwhile activated apoptosis by down-regulating Wee1. As BMAL1 cooperates with the hepatocyte nuclear factor HNF4A in driving the liver-specific circadian regulation of tumorigenesis (15, 16, 35, 36), BMAL1::CLOCK is a versatile player in HCC oncogenesis targeting multiple pathways. This study provides proof-of-principle for future development of novel liver cancer therapies via modulation of the circadian clock. CRYs, PERs, and REV-ERBs agonists inhibit BMAL1::CLOCK through circadian clock negative feedback loops (7). Therapeutics targeting the molecular clock has strong potential to be explored either as monotherapy or in combination with other therapies, with Wee1 and p21 potentially serving as molecular markers for evaluation of anticancer efficacy.

p21, a tumor suppressor that arrests cell growth by inhibiting cell cycle progression, is expressed at lower levels in HCC tissues than that in the corresponding normal liver (37–39). p21 ablation induces continuous hepatocyte proliferation and enhances hepatocarcinogenesis in mice (40, 41). Thus, controlling compensatory proliferation by high levels of p21 is likely critical to preventing HCC development. Pharmacological approaches developed for anticancer therapy targeting histone deacetylase (HDAC), PI3K-Akt, or MDM2-p53 interaction selectively induce p21 expression, thereby leading to decreased cell viability (42). Our findings shed new light on p21 regulation, now identifying the gene as a target of the circadian clock transcriptional network underlying the oncogenic function of BMAL1::CLOCK. Therefore, targeting p21 for activation of cell cycle arrest presents an opportunity to potentiate HCC therapy using clock drugs as an adjuvant.

Normal cells repair damaged DNA during the G1/S cell cycle arrest, whereas cancer cells often have a deficient G1/S checkpoint and depend on a functional G2/M checkpoint for DNA repair and survival. The WEE1 kinase that plays a crucial role in the G2/M checkpoint arrest displays universally high expression in cancer. WEE1 inhibitors, including AZD1775 (MK1775), have been developed to compromise the G2/M checkpoint in combination with DNA damaging agents (22). In HCC tumors, WEE1 levels and kinase activity were found significantly elevated relative to surrounding cirrhotic tissues (43). Concordant with a previous study showing that BMAL1::CLOCK directly activates Wee1 transcription in an vitro system (44), we found that BMAL1 bound the Wee1 gene promoter (Fig. 5K) and Bmal1 depletion significantly reduced the Wee1 mRNA levels in liver cells (Fig. 2E and SI Appendix, Fig. S4). Down-regulating Wee1 in HCC cells substantially attenuated HCC cell viability and induced apoptosis, which played an important role in the cytotoxicity effect of Bmal1/Clock inhibition (Fig. 5 A–J). Collectively, our observations support the concept that anti-apoptosis activity of the cancer-specific WEE1 contributes to BMAL1::CLOCK stimulated HCC cell proliferation. Small molecules targeting the clock are supposed to mimic WEE1 inhibitors but may provide increased specificity over the kinase modifiers for increasing DNA damage sensitivity of HCC patients.

Materials and Methods

Animal Experiments.

All animal care and experiments were performed under the institutional protocols approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Southern California. For mouse liver RT-qPCR analysis, mice were housed in a 12-h light/12-h dark (LD) cycle with free access to food and water and age of 10 to 12 wk were used. For the xenograft transplantation model, NU/J nude mice (The Jackson Library #002019) were subcutaneously transplanted in the right flank with 3 × 106 Hep3B cells transduced with a non-targeting control shRNA or shRNA targeting either Bmal1 or Clock. Tumor growth was monitored for 4 wk by measuring tumor diameter and weight at the endpoint.

Cell Culture.

Hep3B and Huh7 cells were grown in complete DMEM (Life Technologies cat. #11995065) supplemented with 10% FBS and 1% penicillin/streptomycin. HepG2 cells were grown in Ham’s F12 (Corning Cellgro 10-080-CV) supplemented with 10% FBS and 1% penicillin and streptomycin. All cells were grown in a 37 °C incubator at 5% CO2.

Circadian Assays.

For circadian assays, human liver cancer cells were plated on 35-mm dishes and synchronized as previously described by a dexamethasone shock (10, 15, 16, 45). In brief, cell culture media was replaced with HEPES-buffered phenol-free DMEM media containing 100 nM dexamethasone and 100 μM D-luciferin. Dishes were covered with 40-mm glass coverslips (Fisher Scientific) and sealed with vacuum grease to prevent evaporation. Luminescence signals were monitored every 10 min using the LumiCycle luminometer (Actimetrics) at 37 °C without supplementary CO2. Results shown are representative of at least three independent experiments.

Cell Viability Assay.

Cells were plated in 96-well plate at a density of ~1,000 cells per well. Relative ATP level was measured following the instruction of CellTiter-Glo Luminescent Cell Viability Assay (Promega, G7570).

Cell Cycle Analysis and Apoptosis Assay.

Cells were collected and resuspended in Tris-buffered saline with 10 µg/mL DAPI and 0.1% nonidet P-40 detergent for flow cytometry. Cell cycle phases were analyzed using FlowJo software. Apoptosis was measured using FITC-Annexin V antibody and PI staining following manufacturer’s instruction (Life Technology, V13241). Cells were read using flow cytometry (BD Bioscience), and the results were analyzed via FlowJo.

Quantitative RT-PCR.

Liver tissues of 10- to 12-wk-old male mice were harvested at indicated Zeitgeber times. Total RNA was isolated using TRIzol reagent according to manufacturer’s instructions (Life Technologies cat. #15596026) and then reverse transcribed to cDNA using iScript cDNA Synthesis kit (Bio-Rad cat. #1708891). We designed real-time primers spanning the exon–intron junctions using the IDT primer-designing software PrimerQuest (https://www.idtdna.com/PrimerQuest). Primer sequences are

  • mRplp0: forward GGCCCTGCACTCTCGCTTTC,

  • reverse TGCCAGGACGCGCTTGT;

  • mBmal1: forward CCCTAGGCCTTCATTGGATTT,

  • reverse GCAAAGGGCCACTGTAGTT;

  • mDbp: forward AATGACCTTTGAACCTGATCCCGCT,

  • reverse GCTCCAGTACTTCTCATCCTTCTGT;

  • mWee1: forward CCCACGTCGTTCGCTATTT,

  • reverse TCAGCTAAACTCCCACCATTAC;

  • mCcnb1: forward GACTCCCTGCTTCCTGTTATG,

  • reverse CTTGACAGTCATGTGCTTTGTG;

  • mp21: forward CGGAGGAACAGTCCTACTGATA,

  • reverse CAGGTAAGAAGTGGCAAGGAA;

  • mMyc: forward CGACTCTGAAGAAGAGCAAGAA,

  • reverse ATGGAGATGAGCCCGACT;

  • hRplp0: forward CGTGGAAGTGACATCGTCTT,

  • reverse GGATGATCTTAAGGAAGTAGTTGGA;

  • hBmal1: forward ATCCTCAACTACAGCCAGAATG,

  • reverse AGAGCTGCTCCTTGACTTTG;

  • hClock: forward TCTCAGACCCTTCCTCAACA,

  • reverse TGACCTTCTTTGCACCATCTT;

  • hWee1: forward ATTTCTCTGCGTGGGCAGAAG,

  • reverse CAAAAGGAGATCCTTCAACTCTGC;

  • hCcnb1: forward TGTGGATGCAGAAGATGGAG,

  • reverse TGGCTCTCATGTTTCCAGTG;

  • hp21: forward GCAGACCAGCATGACAGATTT,

  • reverse GGATTAGGGCTTCCTCTTGGA;

  • hMyc: forward AAAGGCCCCCAAGGTAGTTA,

  • reverse GCACAAGAGTTCCGTAGCTG.

RT-qPCR analyses were performed as described previously (15, 16, 45) with CFX384 Real-Time PCR Detection System (Bio-Rad).

Western Blotting.

Frozen mouse liver tissue was homogenized in RIPA buffer containing 1x EDTA-free protease inhibitor cocktail (Roche) using Omni Tissue Homogenizer (Omni International). The total protein concentration was determined by Bio-Rad Protein Assay and then equalized to 15 g/L. 25 μg of total protein was used for the western blot assay, performed as previously described (15, 16, 45). Antibodies used in the western blots are anti-BMAL1 (Cell signaling, #14020), anti-Wee1 (Cell signaling, #4936), and anti-TUBULIN (Sigma-Aldrich, T0198).

Quantification and Statistical Analysis.

The significance of differences between peak distance, period length, and gene expression was evaluated by unpaired Student’s t test (two-tailed), with significant differences at P < 0.05.

Supplementary Material

Appendix 01 (PDF)

Acknowledgments

We thank Li-Lin Du (National Institute of Biological Sciences, Beijing, China) and Jia-Min Zhang (Tongji University, China) for critically reading the manuscript. This study was funded by grants from the University of Southern California Norris Comprehensive Cancer Center Translational Team Accelerator Program (S.A.K. and H.-J.L.). J.N.R. is funded by NIH (P30 CA047904, CA238662, CA197718, NS103434). W.H. is funded by NIH (CA139158, DK124627). Z.J. is funded by the United States Department of Agriculture National Institute of Food and Agriculture Grant (2019-67022-29930). H.T. is funded by NIH (P50 AA011999, U01 AA027681), Department of Veterans Affairs (5 I01BX001991), and Biomedical Laboratory Research and Development Research Career Scientist Award (5 IK6BX004205).

Author contributions

M.Q., G.Z., J.N.R., and S.A.K. designed research; M.Q., G.Z., A.V., and R.W. performed research; M.Q., G.Z., H.Q., H.T., Z.J., W.H., H.-J.L., J.N.R., and S.A.K. analyzed data; H.T., Z.J., W.H., H.-J.L., and J.N.R. provided edits of the paper; and M.Q. and S.A.K. wrote the paper.

Competing interest

S.A.K., discloses his financial interest in Synchronicity Pharma, where he serves on the Board of Directors.

Footnotes

Reviewers: C.B.G., The University of Texas Southwestern Medical Center; and K.A.L., The Scripps Research Institute

Data, Materials, and Software Availability

All study data are included in the article and/or SI Appendix.

Supporting Information

References

  • 1.Yarchoan M., et al. , Recent developments and therapeutic strategies against hepatocellular carcinoma. Cancer Res. 79, 4326–4330 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.C. for D. E. and Research, “FDA approves atezolizumab plus bevacizumab for unresectable hepatocellular carcinoma” (FDA, 2020). 9 March2021. [Google Scholar]
  • 3.Llovet J. M., Montal R., Sia D., Finn R. S., Molecular therapies and precision medicine for hepatocellular carcinoma. Nat. Rev. Clin. Oncol. 15, 599–616 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zhang R., Lahens N. F., Ballance H. I., Hughes M. E., Hogenesch J. B., A circadian gene expression atlas in mammals: Implications for biology and medicine. Proc. Natl. Acad. Sci. U.S.A. 111, 16219–16224 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Mure L. S., et al. , Diurnal transcriptome atlas of a primate across major neural and peripheral tissues. Science 359, eaao0318 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ye Y., et al. , The genomic landscape and pharmacogenomic interactions of clock genes in cancer chronotherapy. Cels 6, 314–328.e2 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Battaglin F., et al. , Clocking cancer: The circadian clock as a target in cancer therapy. Oncogene 40, 3187–3200 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ruan W., Yuan X., Eltzschig H. K., Circadian rhythm as a therapeutic target. Nat. Rev. Drug. Discov. 20, 287–307 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Sulli G., Lam M. T. Y., Panda S., Interplay between circadian clock and cancer: New frontiers for cancer treatment. Trends Cancer 5, 475–494 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dong Z., et al. , Targeting glioblastoma stem cells through disruption of the Circadian clock. Cancer Discov. 9, 1556–1573 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chen P., et al. , Circadian regulator CLOCK recruits immune suppressive microglia into the GBM tumor microenvironment. Cancer Discov. 10, 371–381 (2020), 10.1158/2159-8290.CD-19-0400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Papagiannakopoulos T., et al. , Circadian rhythm disruption promotes lung tumorigenesis. Cell Metabol. 24, 324–331 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Puram R. V., et al. , Core Circadian clock genes regulate leukemia stem cells in AML. Cell 165, 303–316 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sulli G., et al. , Pharmacological activation of REV-ERBs is lethal in cancer and oncogene-induced senescence. Nature 553, 351–355 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Qu M., Duffy T., Hirota T., Kay S. A., Nuclear receptor HNF4A transrepresses CLOCK:BMAL1 and modulates tissue-specific circadian networks. Proc. Natl. Acad. Sci. U.S.A. 115, E12305–E12312 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Qu M., Qu H., Jia Z., Kay S. A., HNF4A defines tissue-specific circadian rhythms by beaconing BMAL1::CLOCK chromatin binding and shaping the rhythmic chromatin landscape. Nat. Commun. 12, 6350 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Mukherji A., Bailey S. M., Staels B., Baumert T. F., The circadian clock and liver function in health and disease. J. Hepatol. 71, 200–211 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Filipski E., et al. , Circadian disruption accelerates liver carcinogenesis in mice. Mutat. Res. 680, 95–105 (2009). [DOI] [PubMed] [Google Scholar]
  • 19.Kettner N. M., et al. , Circadian homeostasis of liver metabolism suppresses hepatocarcinogenesis. Cancer Cell 30, 909–924 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Miller B. H., et al. , Circadian and CLOCK-controlled regulation of the mouse transcriptome and cell proliferation. Proc. Natl. Acad. Sci. U.S.A. 104, 3342–3347 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Satyanarayana A., Kaldis P., Mammalian cell-cycle regulation: Several Cdks, numerous cyclins and diverse compensatory mechanisms. Oncogene 28, 2925–2939 (2009). [DOI] [PubMed] [Google Scholar]
  • 22.Matheson C. J., Backos D. S., Reigan P., Targeting WEE1 kinase in cancer. Trends Pharmacol. Sci. 37, 872–881 (2016). [DOI] [PubMed] [Google Scholar]
  • 23.Karimian A., Ahmadi Y., Yousefi B., Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA Repair 42, 63–71 (2016). [DOI] [PubMed] [Google Scholar]
  • 24.Shostak A., et al. , MYC/MIZ1-dependent gene repression inversely coordinates the circadian clock with cell cycle and proliferation. Nat. Commun. 7, 11807 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.DiPaola R. S., To arrest or not to G2-M cell-Cycle arrest: Commentary re: A. K. Tyagi et al., Silibinin strongly synergizes human prostate carcinoma DU145 cells to doxorubicin-induced growth inhibition, G2-M arrest, and apoptosis. Clin. Cancer Res., 8: 3512–3519, 2002. Clinical Cancer Res. 8, 3311–3314 (2002). [PubMed] [Google Scholar]
  • 26.Gréchez-Cassiau A., Rayet B., Guillaumond F., Teboul M., Delaunay F., The Circadian clock component BMAL1 is a critical regulator of p21WAF1/CIP1 expression and hepatocyte proliferation. J. Biol. Chem. 283, 4535–4542 (2008). [DOI] [PubMed] [Google Scholar]
  • 27.Chen A., et al. , The role of p21 in apoptosis, proliferation, cell cycle arrest, and antioxidant activity in UVB-irradiated human HaCaT keratinocytes. Med. Sci. Monit Basic Res. 21, 86–95 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Do K., Doroshow J. H., Kummar S., Wee1 kinase as a target for cancer therapy. Cell Cycle 12, 3348–3353 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Davidson A. J., Straume M., Block G. D., Menaker M., Daily timed meals dissociate circadian rhythms in hepatoma and healthy host liver. Int. J. Cancer 118, 1623–1627 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lin Y.-M., et al. , Disturbance of circadian gene expression in hepatocellular carcinoma. Mol. Carcinogenesis 47, 925–933 (2008). [DOI] [PubMed] [Google Scholar]
  • 31.Cui M., et al. , A long noncoding RNA perturbs the Circadian rhythm of hepatoma cells to facilitate hepatocarcinogenesis. Neoplasia 17, 79–88 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Huisman S. A., et al. , Colorectal liver metastases with a disrupted circadian rhythm phase shift the peripheral clock in liver and kidney. Int. J. Cancer 136, 1024–1032 (2015). [DOI] [PubMed] [Google Scholar]
  • 33.Yu C., et al. , Hypoxia disrupts the expression levels of circadian rhythm genes in hepatocellular carcinoma. Mol. Med. Rep. 11, 4002–4008 (2015). [DOI] [PubMed] [Google Scholar]
  • 34.Anafi R. C., Francey L. J., Hogenesch J. B., Kim J., CYCLOPS reveals human transcriptional rhythms in health and disease. Proc. Natl. Acad. Sci. U.S.A. 114, 5312–5317 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fekry B., et al. , Incompatibility of the circadian protein BMAL1 and HNF4α in hepatocellular carcinoma. Nat. Commun. 9, 4349 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Fekry B., et al. , HNF4α-deficient fatty liver provides a permissive environment for sex-independent hepatocellular carcinoma. Cancer Res. 79, 5860–5873 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Furutani M., et al. , Decreased expression and rare somatic mutation of the CIP1/WAF1 gene in human hepatocellular carcinoma. Cancer Lett. 111, 191–197 (1997). [DOI] [PubMed] [Google Scholar]
  • 38.Hui A. M., Kanai Y., Sakamoto M., Tsuda H., Hirohashi S., Reduced p21WAF1/CIP1 expression and p53 mutation in hepatocellular carcinomas. Hepatology 25, 575–579 (1997). [DOI] [PubMed] [Google Scholar]
  • 39.Shi Y.-Z., et al. , Reduced p21WAF1/CIP1protein expression is predominantly related to altered p53 in hepatocellular carcinomas. Br J. Cancer 83, 50–55 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Buitrago-Molina L. E., et al. , The degree of liver injury determines the role of p21 in liver regeneration and hepatocarcinogenesis in mice. Hepatology 58, 1143–1152 (2013). [DOI] [PubMed] [Google Scholar]
  • 41.Ehedego H., et al. , p21 ablation in liver enhances DNA damage, cholestasis, and carcinogenesis. Cancer Res. 75, 1144–1155 (2015). [DOI] [PubMed] [Google Scholar]
  • 42.Shamloo B., Usluer S., p21 in cancer research. Cancers 11, 1178 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Masaki T., et al. , Cyclins and cyclin-dependent kinases: Comparative study of hepatocellular carcinoma versus cirrhosis. Hepatology 37, 534–543 (2003). [DOI] [PubMed] [Google Scholar]
  • 44.Matsuo T., et al. , Control mechanism of the Circadian clock for timing of cell division in vivo. Science 302, 255–259 (2003). [DOI] [PubMed] [Google Scholar]
  • 45.Bang Y. H., et al. , Real-world efficacy and safety of cabozantinib in Korean patients with advanced hepatocellular carcinoma: A multicenter retrospective analysis. Ther. Adv. Med. Oncol. 14, 17588359221097934 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Appendix 01 (PDF)

Data Availability Statement

All study data are included in the article and/or SI Appendix.


Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES