Skip to main content
Protein Science : A Publication of the Protein Society logoLink to Protein Science : A Publication of the Protein Society
. 2023 Feb 14;32(3):e4584. doi: 10.1002/pro.4584

Importance of aspartic acid side chain carboxylate‐arginine interaction in substrate selection of arginine 2,3‐aminomutase BlsG

Xiangkun Luo 1, Xiankun Wang 1, Lina Zhang 1, Aiqin Du 1, Zixin Deng 1,2, Ming Jiang 1,2,✉, Xinyi He 1,2,✉
PMCID: PMC9926467  PMID: 36721314

Abstract

The fungicide nucleoside blasticidin S features a β‐arginine, a moiety seldom revealed in the structure of natural products. BlsG, a radical SAM arginine‐2,3‐aminomutase from the blasticidin S biosynthetic pathway, displayed promiscuous activity to three basic amino acids. Here in this study, we demonstrated that BlsG showed high preference toward its natural substrate arginine. The combined structural modeling, steady‐state kinetics, and mutational analyses lead to the detailed understanding of the substrate recognition of BlsG. A single mutation of T340D changed the substrate preference of BlsG leading to a little more preference to lysine than arginine. On the basis of our understanding of the substrate selection of BlsG and bioinformatic analysis, we propose that the D…D motif locationally corresponding to D293 and D330 of KAM is characteristic of lysine 2,3‐aminomutase while the corresponding D…T motif is characteristic of arginine 2,3‐aminomutase. The study may provide a simple way to discern the arginine 2,3‐aminomutase and thus lead to the discovery of new natural compounds with β‐arginine moiety.

Keywords: aminomutase; arginine 2,3‐aminomutase; blasticidin S; radical SAM; β‐arginine

1. INTRODUCTION

β‐amino acids widely exist and are frequently found as components of complex natural products that are important sources of drug candidates owing to their wide‐ranging therapeutic activities (Newman & Cragg, 2012). β‐amino acids are most frequently present in cyclic non‐ribosomal peptides (NRPs) and their polyketide hybrids (Finlay et al., 1951; Funabashi et al., 1993; Fusetani et al., 1990; Igarashi et al., 1997; Kunze et al., 1995; Shiba et al., 1976; Suda et al., 1976; Zabriskie et al., 1986) and are also found in terpenoid‐β‐amino acid hybrids (Graf et al., 1982; Wani et al., 1971) as well as in sugar‐β‐amino acid hybrids (French et al., 1973; Kurath et al., 1984; Kusumoto et al., 1982; Takeuchi et al., 1958). When compared to the proteinogenic l‐α‐amino acids, β‐amino acids possess similar polarity but distinctive structures that generate structural diversity, unique biological functions and special properties in nature. For example, the β‐amino acid‐containing peptides are resistant to the usual proteinases (Kudo et al., 2014).

Biosynthesis of β‐amino acids has been extensively studied and involves versatile mechanisms (Kudo et al., 2014; Parmeggiani et al., 2018), among which aminomutase‐mediated intramolecular migration of the amino group from carbon 2 to carbon 3 is the simplest route, but that includes complex bond rearrangements (Kudo et al., 2014). 2,3‐aminomutases coordinate a co‐factor such as 4‐methylideneimidazol‐5‐one (MIO) (Heberling et al., 2013; Turner, 2011; Wu et al., 2011) or S‐adenosyl‐l‐methionine (SAM) to function. Lysine 2,3‐aminomutase (KAM) from Clostridium subterminale SB4 (Chirpich et al., 1970; Frey, 1993; Song & Frey, 1991), and glutamate 2,3‐aminomutase (EAM) (Ruzicka & Frey, 2007) associate a SAM molecule to catalyze the amino group migration. KAM from Clostridium subterminale was first characterized (Chirpich et al., 1970) and is involved in lysine catabolism in a pyridoxal phosphate (PLP)‐dependent way (Costilow et al., 1966). KAMs use SAM and a [4Fe‐4 S] cluster to generate a 5′‐deoxyadenosyl radical to initiate mutual transfer between 2‐amino group and 3‐hydrogen. It is noteworthy that KAM utilizes SAM as a catalytic cofactor in vitro as opposed to using SAM as a cosubstrate to generate 5′‐deoxyadenosine as a byproduct (Broderick et al., 2014; Frey et al., 2008). KAM is highly specific for l‐lysine and will not accept most other amino acids as substrates (Ruzicka & Frey, 2010). KAMs have been revealed in the biosynthetic pathways of diverse bioactive natural products, including antituberculosis drugs viomycin (Barkei et al., 2009), capreomycin (Shiba et al., 1976), and streptothricin (Kusumoto et al., 1982). β‐lysine could also function as an antibacterial reagent. It is well‐established that methanogens commonly synthesize acetyl‐β‐lysine as osmolytes (Sowers et al., 1990), in order to maintain osmotic balance in high salinity environments since β‐amino acids are not incorporated into proteins or other essential macromolecules and are easily synthesized from α‐amino acid precursors (Robertson et al., 1992).

Blasticidin S (BS) is a representative peptidyl nucleoside antibiotic containing a β‐arginine moiety and was first isolated from Streptomyces griseochromogenes (Takeuchi et al., 1958). BS consists of a C2′, C3′‐dehydrated pyranose ring that is connected with cytosine at C1′ and β‐arginine linker moiety at C4′. The biosynthesis of BS has been the subject of several studies (Lee et al., 2022; Li et al., 2013; Wang et al., 2021). The biosynthesis gene cluster of BS was identified and the biosynthetic pathway has been proposed by Zabriskie (Cone et al., 2003). Later its heterologous biosynthesis was successfully accomplished in an engineered Streptomyces lividans strain (Li et al., 2013). Feeding experiment showed that the β‐arginine moiety of BS is derived from l‐arginine, which undergoes C2‐C3 shift in a stereospecific way (Prabhakaran et al., 1986, 1988). BS biosynthetic gene cluster encodes a putative arginine 2,3‐aminomutase BlsG, which was recently demonstrated to catalyze in vitro amino group C2‐C3 shift of l‐arginine through a radical‐mediated reaction (Zhao et al., 2020). Interestingly, BlsG showed similar activities to both l‐arginine and l‐lysine (Zhao et al., 2020). The biosynthetic role of BlsG in BS is generation of β‐arginine. Thus, the equal ability of generation of β‐lysine is seemingly meaningless in the BS biosynthesis. Otherwise, there may exist an unknown mechanism used by BlsG for the substrate selection. The catalytic mechanism of BlsG is similar with the reported lysine 2,3‐aminomutase (KAM) that contains an iron–sulfur cluster and a PLP (pyridoxal‐5′‐phosphate) binding motif. In contrast with the reported substrate's promiscuity, KAM can only act on l‐lysine (Ruzicka & Frey, 2010). In the complex structure of KAM, two aspartic residues, D293 and D330, interact with the ε‐amino group of l‐lysine (Lepore et al., 2005).

In this study, BlsG was kinetically characterized and its substrate specificity was determined. It shows strong substrate preference toward its natural substrate arginine. By combining protein modeling, docking analysis, and in vitro biochemical analysis, we disclosure the mechanism behind the arginine preference of BlsG. Interestingly, a single residue replacement changes the substrate specificity of BlsG dramatically. Our data provide a thorough understanding of the molecular basis for the amino acid preference of BlsG. Knowledge of mechanism involved in arginine recognition would significantly aid the identification of β‐arginine moiety containing natural products.

2. MATERIALS AND METHODS

2.1. Materials

Commercial reagents were used as received: Na2S, Fe(NH4)2(SO4)2, l‐lysine, l‐arginine, l‐homoarginine, l‐ornithine, and 18 other proteinogenic amino acids from Shanghai Macklin Biochemical Co., Ltd. S‐adenosyl‐l‐methionine (SAM), dithiothreitol (DTT) and kanamycin from Sangon Biotech Co., Ltd. (Shanghai, China), pyridoxal 5′‐phosphate (PLP) from Ark Pharm, sodium dithionite (DTH) from Amethyst, 2,4‐dinitrofluorobenzene (DNFB) and 5′‐deoxyadenosine (5′‐dAdoH) from Sigma, isopropyl‐β‐d(−)‐thiogalactopyranoside (IPTG) from Shanghai Yeason Bio Technologies co., Ltd. ClonExpress MultiS One Step Cloning Kit (C113‐01) from Vazyme Biotech. Escherichia coli strain DH10B was used for construction of cloning vectors. E. coli BL21(DE3) (Novagen) was used as a host for protein expression. E. coli strains were cultivated at 37°C in LB/LA medium supplied with corresponding antibiotics. pET28a vector (Novagen) containing the lac operator downstream from the T7 promoter is for protein expression.

2.2. General molecular biology methods

Plasmid DNA was purified by plasmid mini kit (Vazyme Biotech Co., Ltd.). Restrictions enzymes NdeI, EcoRI, XbaI and DNA polymerase were purchased from New England Biolabs (Beijing) Ltd. Primers were synthesized by GENEWIZ (Suzhou, China), PCR products were purified from agarose gels (0.8%) using DNA Gel Extraction Kit (Omega). T4 ligase kit for construction of recombinant plasmid was purchased from TaKaRa (China).

2.3. Cloning of plasmids

All PCR reactions were performed using PrimeSTAR Max Premix (2x) from TaKaRa and ClonExpress MultiS One Step Cloning Kit (C113‐01) according to manufacturer's instructions. The blsG gene was PCR amplified from Streptomyces lividans WJ2 (Li et al., 2013) genomic DNA using primer 5′‐GTGCCGCGCGGCAGCCATATGATGAGTACGGAATCCGACGGGATCA‐3′ and 5′‐TTGTCGACGGAGCTCGAATTCTCATCGTGCACCCTCCCCGGTGGCC‐3′. PCR product was gel purified and cloned into corresponding restriction sites of pET28a using One Step Cloning Kit. Four genes encoding putative 2,3‐aminomutases, including OQA19969.1, KAB8320089.1, NLY56110.1, and HHV80508.1 (Gen Bank accession number) were synthesized after codon optimization for overexpression in E. coli by GENEWIZ (Suzhou, China). All these synthesized genes were cloned in the restriction sites of pET28a.

2.4. Construction of BlsG variants

blsG expression plasmid DNA that is isolated from Dam methylation proficient host DH10B was used as a template for site mutagenesis by PCR strategy. PCR was performed in 0.5 mL microcentrifuge tube and the DpnI‐treated PCR products were transformed into chemically competent E. coli DH10B. Incorporation of the mutations was confirmed by DNA sequencing. Primers used for site mutagenesis are as follow:

BlsGT340A 5′‐TCCTCGCAACCCGGCTGGGGAA ‐3′ and 5′‐ CCGGTGACGTTTGCGCAGTGGT ‐3′, BlsGT341A 5′‐GTCCTCACCGCACGGCTGGGGAAGATCCC ‐3′ and 5′‐CCCCAGCCGTGCGGTGAGGACGTACTGGG‐3′, BlsGH301A 5′‐ TACCTCTACGCATGCGACAACGTCACCGG ‐3′ and 5′‐ GTTGTCGCATGCGTAGAGGTAGTAGGGGC ‐3′, BlsGH301Q 5′‐ TACCTCTACCAGTGCGACAACGTCACCGG ‐3′ and 5′‐ GTTGTCGCACTGGTAGAGGTAGTAGGGGC ‐3′,

BlsGT340D 5′‐ CCTCGACACCCGGCTGGGGAAG ‐3′ and 5′‐CCAGCCGGGTGTCGAGGACGTAC ‐3′.

2.5. Overexpression of BlsG: Its variants and homologous enzymes

E. coli BL21 (DE3) harboring the protein expression plasmids were grown overnight in 10 mL LB medium supplied with kanamycin of a final concentration 50 μg/mL at 37°C overnight. Seed solution (10%/vol:vol) of cell culture was inoculated in 1 L LB medium in a 3 L flask and cultured at 37°C until OD600 reached 0.6–0.8. After cooling the culture medium to room temperature, the IPTG (final concentration 0.2 mM) was added and then grown for 18 h at 16°C. Cells were harvested by centrifugation at 5000 r/min for 10 min.

2.6. Purification and reconstitution of BlsG and its homologous enzymes

Protein purification was performed in the Coy‐Chamber glove box (Product, Inc., USA) with less than 5 ppm of O2. The cell pellet was resuspended in 40 mL of lysis buffer (50 mM Tris–HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0) and was lysed by sonication on ice. Cell debris was removed via centrifugation at 15000g for 1 h at 4°C. The supernatant was passed through a column containing 2 mL of high‐affinity Ni‐NTA resin (GE Co., Ltd.) pre‐equilibrated with lysis buffer, and the column was then washed with 50 mL buffer A (50 mM Tris–HCl, 150 mM NaCl, 50 mM imidazole, pH 8.0), and the column was then washed with 5 mL buffer B (50 mM Tris–HCl, 150 mM NaCl, 100 mM imidazole, pH 8.0). Finally, the protein fractions were collected using 3 mL of elution buffer (50 mM Tris–HCl, 150 mM NaCl, 300 mM imidazole, pH 8.0). The purity of protein was analyzed by SDS‐PAGE (15% Tris‐glycine gel) and its concentration was determined using a Bradford Assay Kit (Shanghai Houkai Biotchnology Co., Ltd.) using bovine serum albumin (BSA) as a standard. The protein reconstitution was performed by incubation of as‐isolated BlsG with 6 equal excess mole amount of Na2S, Fe(NH4)2(SO4)2 in presence of 5.0 mM DTT for 3 h at 4°C anaerobically. The resulting dark brown solution was desalted on a PD‐10 (GE) column pre‐equilibrated with the elution buffer (50 mM Tris–HCl, 150 mM NaCl, pH 8.0, 10%/vol:vol glycerin). The eluted protein fraction was collected and used directly for in vitro assay or stored at −80°C for further use.

2.7. In vitro assay of BlsG and its mutants

The reaction volume was 200 μL with 2 mM amino acids, 1 mM SAM, 4 mM DTH, 0.5 mM PLP, 20 μM enzyme, reaction buffer 50 mM Tris–HCl, pH 8.0 and 150 mM NaCl, at 30°C for respective time.

2.8. Derivatization of amino acids by DNFB

The amino group of amino acids can react with 2,4‐dinitrofluorobenzene (DNFB), and the resultant substance has UV absorbance at 360 nm. A mixture of 100 μL amino acid standard solutions (in dd‐H2O) or reaction solutions were mixed with 20 μL 1 M NaHCO3, two times substrate equivalent DNFB (in acetone) and incubated at 60°C for 30 min. The reaction was stopped by adding 20 μL of 1 M HCl and the precipitates were subsequently removed by centrifugation.

2.9. HPLC and LC–MS analysis

High performance liquid chromatography (HPLC) analysis was performed on an Agilent series 1260 using the Agilent C18 column (5 μm, 4.6 mm × 250 mm). Two buffers were used, buffer A: 0.05% (vol/vol) formic acid in water was aqueous phase, buffer B was organic phase (acetonitrile). The samples were eluted at a flow rate of 1.0 mL/min and the concentration of buffer B rose from 20% to 60% in 15 min, then rose from 60% to 90% in 11 min and finally kept at 90% for 10 min with detection at 275 or 360 nm. The column used for HR‐LC‐Q‐TOF detection was a YMC‐Pack ODS‐AQ C18 column (5 μm, 4.6 mm × 250 mm). The flow rate was 0.3 mL/min for HPLC. The mobile phase comprised of water and acetonitrile 0.1% (vol/vol) formic acid with detection at 360 nm.

2.10. Kinetic analysis

The relative areas of peaks corresponding to the DNFB‐derivatized products observed at 360 nm were calculated to determine the concentration of each amino acid. Assays with arginine (from 0.1 to 2 mM) were performed with 20 μM enzyme (BlsG and mutants), 4.0 mM DTH, 1 mM SAM, and 0.5 mM PLP in 50 mM Tris–HCl, pH 8.0. Reaction was performed in the presence of 20 μM enzyme (BlsG and T340D) with lysine (1, 2, 4, 6, 8, and 10 mM), 4 mM DTH, 1 mM SAM, and 0.5 mM PLP in 50 mM Tris–HCl, pH 8.0. The initial velocities of β‐arginine formation were calculation at 2 min, and N 2, N 6‐bis(2,4‐dinitrophenyl)‐l‐Lysine was used as an internal standard. All the assays were performed in triplicate. The resulting initial velocities were fitted to the Michaelis–Menten equation by nonlinear regression analysis using GraphPad Prism 8.0.2 to extract the K m and k cat parameters.

2.11. Preparative scale in vitro reaction for structure elucidation by NMR

In general, 20 tubes of 200 μL solution composed of 10 mM amino acids, 1 mM SAM, 4 mM DTH, 20 μM enzyme, 0.5 mM PLP and reaction buffer (50 mM Tris–HCl, pH 8.0 and 150 mM NaCl) were incubated at 30°C for 6 h. The reaction solutions were directly for DNFB derivatization. After centrifugation and concentrated by rotatory evaporator, reaction mixture was monitored and purified by HPLC with reverse phase silica gel (Agilent ZORBAX SB‐C18, 9.6 × 250 mm). For structural elucidation, 1H, 13C, 1H‐1H COSY, HSQC, and HMBC spectra were recorded on Bruker AV instruments.

3. RESULTS

3.1. BlsG is a radical SAM protein with relaxed specificity to alkaline amino acids

Bioinformatic study showed that BS biosynthesis gene cluster encodes a sole aminomutase BlsG (Cone et al., 2003), which has a high similarity to KAM (Ruzicka et al., 2000, 49% identity, 66% similarity), YodO (Chen et al., 2000, 45% identity, 64% similarity) and EAM (Ruzicka & Frey, 2007, 42% identity, 60% similarity). The proposed function of BlsG is catalyzing the formation of β‐arginine. In the beginning of this study, there was no biochemical characterization of BlsG. In order to investigate its potential activity, BlsG was heterologously expressed and purified anaerobically. The purified BlsG shows brown color, and has a 420‐nm band with a long‐wavelength tail extending to 700‐nm in the UV–visible absorption spectrum (Figure 1a). The front band in absorption is attributed mainly to the iron–sulfur center (Chen et al., 2000). To check the in vitro activity, purified BlsG was first reconstituted with excess of iron and sulfide. The enzyme was then incubated with dithionite, SAM, PLP and its physiological substrate, l‐arginine, for enzymatic characterization. In the end of the reaction, the amino acids from the reaction were derivatized with DNFB followed by HPLC analysis. Compared with the control using denatured BlsG, there is a new product 1′ in the BlsG catalyzed reaction (Figure 1b). The structure of DNFB‐derivatized product (1′) was determined as N3‐(2,4‐dinitrophenyl)‐l‐arginine (Figure 1b, Figures S1–S4 and Tables S1 and S2) indicating generation of β‐arginine in BlsG catalyzed reaction with l‐arginine as substrate. We then tested other three basic amino acids, l‐lysine, l‐homoarginine, and l‐ornithine, as substrates for the activity assay of BlsG. BlsG showed activity to l‐lysine and l‐homoarginine, but not l‐ornithine. The product of 2′ and 3′ (Figure 1b and Figure S1) were confirmed to be DNFB derivatives of β‐lysine and β‐homoarginine by HRMS (Table S2 and Figures S5 and S6) and NMR (Tables S3 and S4 and Figures S7–S10). Moreover, 18 other proteinogenic amino acids cannot be catalyzed by BlsG, indicating its preference for the basic amino acids.

FIGURE 1.

FIGURE 1

In vitro characterization of BlsG. (a) UV–visible absorption spectra and SDS‐PAGE analysis of purified BlsG. Lane 1, BlsG eluted with buffer containing 100 mM imidazole, Lane 2, BlsG eluted with buffer containing 300 mM imidazole, Lane 3, protein marker. (b) High performance liquid chromatography (HPLC) analysis of the products for the BlsG catalyzed reactions with basic amino acids: (i) l‐arginine with BlsG (upper) and denatured BlsG (down), respectively. (ii) l‐lysine with BlsG (upper) and denatured BlsG (down), respectively. (iii) l‐homoarginine with BlsG (upper) and denatured BlsG (down), respectively. (iv) l‐ornithine with BlsG (upper) and denatured BlsG (down), respectively. 1′ is DNFB‐β‐arginine and 1 is DNFB‐l‐arginine, 2′ is DNFB‐β‐lysine and 2 is DNFB‐l‐lysine, 3′ is DNFB‐β‐homoarginine and 3 is DNFB‐l‐homoarginine, 4 is DNFB‐l‐ornithine. The reaction products were derivatized by 2,4‐dinitrofluorobenzene (DNFB) prior to HPLC analysis. All products were detected via UV absorbance at 360 nm wavelength.

3.2. BlsG prefers arginine to lysine

Lysine and arginine are positively charged basic amino acids and structurally similar. Thus, it is not surprising that BlsG has 2,3‐aminomutase activity for both lysine and arginine. However, β‐lysine containing BS analog has never been isolated in the fermentation culture of two BS producing strains, Streptomyces griseochromogenes (Seto et al., 1976) and Streptomyces lividans WJ2 (Li et al., 2013). The similar k cat and K m values of BlsG for arginine and lysine measured in previous research is confusing. In order to investigate whether BlsG has similar substrate specificity for these two basic amino acids and makes similar amount of β‐lysine and β‐arginine in vivo, we set up a one‐pot competition experiment. BlsG was incubated with 2 mM arginine and lysine in the presence of dithionite, PLP and SAM (Figure 2). After 1 h, about half of the arginine was converted to β‐arginine, similar to the reaction without lysine. In contrast, the production of β‐lysine was significantly decreased from around 20% conversion with lysine to only barely detected with both arginine and lysine. Thus, above result unambiguously suggested that BlsG strongly prefers arginine over lysine as substrate, which is consistent with the biological function of BlsG. To explain the substrate preference of BlsG for arginine over lysine, its steady‐state kinetic parameters for these two substrates were re‐examined. BlsG has a k cat of 19.0 min−1 and a K m of 7.04 mM for l‐lysine (Table 1 and Figure 3). By comparison, the k cat is 12.9 min−1 and the K m is 0.76 mM for arginine. The much higher k cat/K m value for l‐arginine than for l‐lysine is in good agreement with the one‐pot competition assay result and BlsG's function as an arginine 2,3‐aminomutase in blasticidin S biosynthesis.

FIGURE 2.

FIGURE 2

A one‐pot competition experiment of BlsG with Arg and Lys: assay with (i) l‐arginine, (ii) l‐lysine, (iii) l‐arginine and l‐lysine. 1′ is DNFB‐β‐arginine and 1 is DNFB‐l‐arginine, 2′ is DNFB‐β‐lysine and 2 is DNFB‐l‐lysine. The reaction mixtures contained 2 mM of each or both substrates and were incubated for 1 h

TABLE 1.

Kinetic parameters for BlsG with l‐arginine and l‐lysine

Substrate k cat (min−1) K m (mM) k cat/K m (mM−1 min−1)
l‐α‐arginine 12.9 ± 0.42 0.76 ± 0.04 17.0
l‐α‐lysine 19.0 ± 1.78 7.04 ± 0.91 2.7

FIGURE 3.

FIGURE 3

Determination of kinetic constants of BlsG toward l‐arginine (left) and l‐lysine (right). The enzyme concentration is 20 μM. Assays were performed in triplicates and the standard deviations are shown by the error bars

3.3. Structure modeling and substrate docking for BlsG

As BlsG strongly prefers arginine over lysine, we are wondering whether it has an additional binding site for arginine than for lysine. To dissect the arginine binding‐mode and look for the reason for the substrate preference, we first modeled the structure for BlsG. BlsG and KAM show high sequence similarity (49% identity, 66% similarity, Figure S11). As the crystal structure of BlsG is unavailable, we built a homology model using the X‐ray structure of KAM (lysine‐2,3‐aminomutase from Clostridium subterminale, PDB ID code 2A5H, Lepore et al., 2005).

With the BlsG model structure, we then tried to address substrate recognition using docking calculations. The reaction intermediate, α‐arginine–PLP aldimine complex, was selected for the docking experiments and accommodates the active site of BlsG well, forming reasonable interactions with the surrounding residues (Figure 4). The general arginine‐binding mode at the BlsG active site is analogous with lysine in KAM active site. The most important interactions between lysine with the KAM active site residues could be identified in the docked structure of PLP‐arginine and BlsG. Within the binding pocket, the residues Thr340 in BlsG form one hydrogen bond with Arg in Arg‐PLP. Additionally, the residues Asp303 and Arg140 in BlsG form salt bridges with Arg in Arg‐PLP, respectively (Figure 4). The residues Tyr298 in BlsG form one hydrogen bond with PLP in Arg‐PLP, and the residues Arg122, Arg208, and Lys345 in BlsG form hydrogen bonds and salt bridges with PLP in Arg‐PLP.

FIGURE 4.

FIGURE 4

The optimal binding mode of Arg‐PLP with BlsG. The Arg is colored in magenta, and the PLP and SAM‐Fe are in green. The surrounding residues in the binding pocket are in blue. The backbone of the receptor is depicted as slate cartoon with transparency. The hydrogen bonds are depicted as red dashed lines, and the salt bridges are depicted as blue dashed lines

A significant difference in the active site architectures is T340 and T341. In KAM crystal structure, these two corresponding residues are D330 and A331, in which D330 forms salt bridge with the ε‐amine group of lysine and is critical for lysine binding (Lepore et al., 2005). Thus, for BlsG, these two relatively conservative T340 and T341 might form hydrogen bond with the guanidino group of arginine. Another difference and potential guanidino group binding site is H301.

3.4. Mutations identified the key factors for substrate preference

In order to confirm the contribution of the key residues identified in the docking experiment to the arginine recognition of BlsG, T340, and T341 were mutated to alanine, respectively. The resultant mutant proteins were purified and then incubated with 2 mM l‐arginine and l‐lysine. Both BlsG T340A and T341A mutants demonstrated l‐arginine preference over l‐lysine, similar to wild‐type BlsG (Figures S12 and S13, respectively). Then, H301 was replaced by Q and A, respectively. Purified BlsG H301A and H301Q mutants were assayed in the presence of l‐arginine and l‐lysine and the substrate preference did not change (Figures S14 and S15, respectively). The steady‐state kinetic parameters for these mutants were then determined (Table S5 and detailed see Figures S16 and S17). k cat and K m of BlsG T340A, T341A, H301A, and H301Q mutants for arginine do not significantly change in contrast to the wild‐type BlsG, indicating these three residues do not play important roles in recognition of arginine.

Given the above results and that there is no other obvious extra binding site for arginine, we are wondering whether there exists a specific binding site for arginine than lysine. At the position of T340 of BlsG, KAM has an aspartic acid residue, which is important for its interaction with ε‐amino group of lysine. T340 of BlsG was then replaced by aspartic acid and purified. Interestingly, BlsG T340D mutant demonstrated lysine preference in the competition assay with more β‐lysine produced than β‐arginine (Figure 5). The steady‐state kinetic parameters of BlsG T340D mutant for l‐arginine and l‐lysine were then determined (Table S6 and Figure S18). In comparison with wild‐type BlsG, k cat and K m for l‐arginine of T340D mutant were not significantly different. In contrast, K m of T340D mutant for lysine was dramatically decreased by nearly 93% indicating drastically increased interaction and K cat decreased by about 50% for lysine. Thus, the k cat/K m value of T340D mutant for lysine increased by around sevenfold and becomes even a little higher than that for arginine. The two aspartic acid residues (Asp293 and Asp330, D…D binding motif) of KAM form two hydrogen bonds with ε‐amino group of lysine (Lepore et al., 2005). Compare to the D…D binding motif of KAM, the corresponding D…T motif of BlsG significantly decreased its interaction with lysine, while the binding with arginine is not significantly affected. Taken together, we concluded that the substrate preference of BlsG for arginine over lysine might arise from the “decrease” of the interaction with lysine but not due to the originally proposed increased binding with arginine.

FIGURE 5.

FIGURE 5

A one‐pot competition experiment of T340D with Arg and Lys: assay with (i) l‐arginine, (ii) l‐lysine, (iii) l‐arginine and l‐lysine. 1′ is DNFB‐β‐arginine and 1 is DNFB‐l‐arginine, 2′ is DNFB‐β‐lysine and 2 is DNFB‐l‐lysine. The reaction mixtures contained 2 mM of each or both substrates and were incubated for 1 h

3.5. Identification of arginine 2,3‐aminomutases by genome mining

To investigate whether arginine 2,3‐aminomutase with the same sequence feature of BlsG widely exist, we initiated a conscientious survey of the public databases to identify related proteins. This search revealed that l‐arginine and l‐lysine 2,3‐aminomutases are widespread in various species. Among them, more than 100 sequences were found to possess the BlsG‐like D…T motif, indicating they might catalyze β‐arginine formation from l‐arginine (Table S7). Most of the left 2,3‐aminomutases possess the KAM‐like D…D motif, indicating they are l‐lysine 2,3‐aminomutases. To confirm our hypothesis and further investigate whether the proteins possessing the D…T motif indeed have l‐arginine preference as BlsG, we randomly selected OQA19969.1 (from Chloroflexi bacterium ADurb.Bin360) and KAB8320089.1 (from Tolypothrix campylonemoides), which contain D…T motif. Their encoding genes were chemically synthesized and used to the protein overexpression. Two proteins show activities toward both l‐arginine and l‐lysine and have similar competition results (Figures 6 and 7) as BlsG, further confirming the importance of D…T motif for the substrate specificity. Similarly, the encoding genes of two proteins, HHV80508.1 (from bacterium) and NLY56110.1 (from Firmicutes bacterium), possessing the D…D motif were synthesized. Purified HHV80508.1 and NLY56110.1 only showed activity toward l‐lysine, but not l‐arginine (Figures S19 and S20). Taken together, the D…T motif could be used to discriminate l‐arginine 2,3‐aminomutase and l‐lysine 2,3‐aminomutase. In addition, more than 100 l‐arginine 2,3‐aminomutase were distributed in different species and can be used for the β‐arginine moiety containing natural product discovery.

FIGURE 6.

FIGURE 6

A one‐pot competition experiment of OQA (OQA19969.1) with Arg and Lys: assay with (i) l‐arginine, (ii) l‐lysine, (iii) l‐arginine, and l‐lysine. 1′ is DNFB‐β‐arginine and 1 is DNFB‐l‐arginine, 2′ is DNFB‐β‐lysine and 2 is DNFB‐l‐lysine. The reaction mixtures contained 2 mM of each or both substrates and were incubated for 1 h

FIGURE 7.

FIGURE 7

A one‐pot competition experiment of KAB (KAB8320089.1) with Arg and Lys: assay with (i) l‐arginine, (ii) l‐lysine, (iii) l‐arginine, and l‐lysine. 1′ is DNFB‐β‐arginine and 1 is DNFB‐l‐arginine, 2′ is DNFB‐β‐lysine and 2 is DNFB‐l‐lysine. The reaction mixtures contained 2 mM of each or both substrates and were incubated for 1 h

4. DISCUSSION

BS is a peptidyl nucleoside antibiotic containing a β‐arginine moiety. Natural products featuring β‐arginine moiety are rare. To date, less than 10 natural products have been found to contain β‐arginine moiety. And there are few studies about the enzyme catalyzing the β‐arginine formation. In comparison, lysine 2,3‐aminomutase (KAM) (Chirpich et al., 1970) and glutamate 2,3‐aminomutase (EAM) (Ruzicka & Frey, 2007) have been characterized in vitro. Recently, Zhao et al. reported the biochemical characterization of a arginine 2,3‐aminomutase, BlsG (Zhao et al., 2020). Interestingly, they found that BlsG has dual substrate specificity and has similar catalytic efficiency toward arginine and lysine. As no BS analogue containing β‐lysine moiety has been discovered, the comparable catalytic efficiency toward l‐arginine and l‐lysine is curious. Generation of β‐lysine, if not used by the downstream proteins, will be meaningless to BS biosynthesis. Alternatively, there exists an unknown mechanism to increase the substrate specificity of BlsG in vivo. In this study, we further characterized the substrate specificity of BlsG.

To investigate whether BlsG has similar activity toward lysine and arginine in vivo, one‐pot competition assay was used. Equal concentration of lysine and arginine were incubated with BlsG together to mimic the in vivo condition. Much more β‐arginine was produced compared with β‐lysine indicating strong arginine preference (Figure 2). This substrate preference of BlsG is reasonable because arginine is its natural substrate. However, this competition result seems contradictory to the previous study. It is generally accepted that k cat/K m determines substrate specificity of an enzyme. Recently, Su et al reported an interesting phenomenon that N‐myristoyltransferases prefers myristoyl‐CoA over acetyl‐CoA despite their similar k cat/K m values because they proposed that K d should be more emphasized for determining the substrate specificity of enzymes in the complicated physiological conditions where multiple substrates with similar properties are present and compete for the same enzyme active site (Su et al., 2021). The steady‐state kinetic constants of BlsG were further determined before we tried to investigate whether BlsG prefers arginine for the same reason. BlsG has similar k cat values for both arginine and lysine, while the K m value for lysine is about nine times as much as that for arginine. Thus, the k cat/K m values for arginine and lysine can perfectly explain the substrate preference of BlsG. Although BlsG still follows the traditional thought in enzymology that the substrate specificity is determined by k cat/K m values, our study indicated that substrate competition experiment is an easy and direct complement to determine the substrate specificity. On the other hand, the determination of the k cat/K m values could be affected by varying conditions that could influence the judgment.

BlsG has a high sequence similarity with lysine 2,3‐aminomutase, KAM and it is interesting that they have very different substrate specificity. The complex structure of KAM and lysine has been determined, providing a lot of details of their interactions. Arginine and lysine are basic amino acid and similar in structure. Lysine has a ε‐amino group while the side chain of arginine ends with a guanidino group. Firstly, we hypothesized that BlsG could specifically use arginine when both arginine and lysine are present because of a specific/extra guanidino binding motif. By sequence analysis, structure comparison, and docking analysis, two potential specific binding sites for the guanidino group were found. The first is the T340T341 of BlsG, which is close to the guanidino group. T340 could form hydrogen bond with the guanidino group in the docking calculation. However, when these two threonine residues are replaced by alanine respectively, mutants do not change the substrate preference and the K m and k cat values for arginine are very similar to that of the wild‐type BlsG. Thus, T340 and T341 do not contribute to the substrate recognition of BlsG significantly. Another potential residue that could be used to bind the guanidino group is H301. Although H301 is not close enough to form hydrogen bond with the guanidino group in our docking structure, it is still possible that in the real BlsG and arginine complex the active site could be rearranged and H301 becomes close to the guanidino group. Unfortunately, competition experiment (Figure S14) and steady‐state kinetics (Table S5) of H301A mutant enzyme indicated H301 does not affect arginine recognition of BlsG dramatically. Thus, the attempt of searching for extra arginine binding site was unsuccessful.

In the complex structure of KAM and its substrate, the ε‐amino group of l‐lysine interacts with the side‐chain carboxyl groups of two aspartic acid residues of KAM, D293 and D330. In comparison, the guanidino group of arginine interact with both D303 and T340 within the binding pocket of modeling BlsG (Figure 4). Interestingly, the replacement of T340 of BlsG by alanine does not affect activity for arginine, while the same residue mutation, T340D, dramatically increases the catalytic efficiency for lysine (Figure 5). The increase of the catalytic efficiency of BlsG T340D for lysine is mainly due to the decrease of K m value (Table S6 and Figure S18), indicating increase of the binding affinity. Actually, BlsG T340D demonstrates a little lysine preference (Figure 5, iii). According to previous study, the binding of carboxylate‐guanidino group of arginine is much stronger than carboxylate‐amino group of lysine side chain (Hart et al., 1987). The interaction of only one carboxylate and guanidino group could be comparable with two carboxylates and lysine side‐chain amino group. Thus, the binding affinity of arginine with wild‐type BlsG is much stronger than lysine. In BlsG T340D mutant, when lysine is used as substrate, two aspartic acid residues interact with lysine side chain amino group similar to the situation in KAM active site. Thus, we conclude that the structure of the substrate‐binding site of BlsG is optimized for l‐arginine binding and BlsG has a strong arginine preference not because of additional binding site for arginine, but due to the decrease of the interaction with lysine (compared with KAM).

Our studies provided an explanation for the substrate specificity of BlsG and revealed a sequence feature for arginine selection. We synthesized several genes encoding BlsG‐like proteins and KAM‐like proteins. The in vitro activity assays indicated that the 2,3‐aminomutases with D…T motif have arginine preference as BlsG and those with D…D motif prefer lysine as substrate further confirming the accuracy of our study. As β‐amino acid‐containing natural products have significant and unique biological functions, discovery of new β‐amino acid‐containing natural products is a promising way for the drug development. Till now, very few β‐arginine‐containing natural products have been found. Further investigation using the knowledge in this study will greatly help to identify biosynthetic machinery for new β‐arginine‐containing natural products through genome mining approach. Given our findings, it is likely that the discovery of natural product with beta‐arginine as building block will expand to existing and emerging genomes.

AUTHOR CONTRIBUTIONS

Xiangkun Luo: Investigation (lead); writing – original draft (equal). Xiankun Wang: Methodology (supporting); resources (supporting). Lina Zhang: Investigation (supporting). Aiqin Du: Resources (supporting). Zixin Deng: Funding acquisition (supporting). Xinyi He: Funding acquisition (lead); supervision (equal); writing – original draft (equal); writing – review and editing (equal). Ming Jiang: Experiment design; manuscript drafting.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

Supporting information

Data S1: Supporting Information

ACKNOWLEDGMENTS

This work was supported by grant from the National Key Research and Development Program of China (grant number 2018YFA0901900); the National Natural Science Foundation of China (grant numbers 31871250, 31870026, 31670034, 32170076).

Luo X, Wang X, Zhang L, Du A, Deng Z, Jiang M, et al. Importance of aspartic acid side chain carboxylate‐arginine interaction in substrate selection of arginine 2,3‐aminomutase BlsG . Protein Science. 2023;32(3):e4584. 10.1002/pro.4584

Review Editor: Aitziber L. Cortajarena

Funding information National Natural Science Foundation of China, Grant/Award Numbers: 31670034, 31870026, 31871250, 32170076; The National Key Research and Development Program of China, Grant/Award Number: 2018YFA0901900

Contributor Information

Ming Jiang, Email: jiangming9722@sjtu.edu.cn.

Xinyi He, Email: xyhe@sjtu.edu.cn.

REFERENCES

  1. Barkei JJ, Kevany BM, Felnagle EA, Thomas MG. Investigations into viomycin biosynthesis by using heterologous production in Streptomyces lividans. Chembiochem. 2009;10:366–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Broderick JB, Duffus BR, Duschene KS, Shepard EM. Radical S‐adenosylmethionine enzymes. Chem Rev. 2014;114:4229–317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen D, Ruzicka FJ, Frey PA. A novel lysine 2;3‐aminomutase encoded by the yodO gene of bacillus subtilis: characterization and the observation of organic radical intermediates. Biochem J. 2000;348:539–49. [PMC free article] [PubMed] [Google Scholar]
  4. Chirpich TP, Zappia V, Costilow RN, Barker HA. Lysine 2;3‐aminomutase. Purification and properties of a pyridoxal phosphate and S‐adenosylmethionine‐activated enzyme. J Biol Chem. 1970;245:1778–89. [PubMed] [Google Scholar]
  5. Cone MC, Yin X, Grochowski LL, Parker MR, Zabriskie TM. The blasticidin S biosynthesis gene cluster from Streptomyces griseochromogenes: sequence analysis; organization; and initial characterization. Chembiochem. 2003;4:821–8. [DOI] [PubMed] [Google Scholar]
  6. Costilow RN, Rochovansky OM, Barker HA. Isolation and identification of beta‐lysine as an intermediate in lysine fermentation. J Biol Chem. 1966;241:1573–80. [PubMed] [Google Scholar]
  7. Finlay AC, Hobby GL, Hoschstein F, Lees TM, Lenert TF, Means JA, et al. Viomycin a new antibiotic active against mycobacteria. Am Rev Tuberc. 1951;63:1–3. [DOI] [PubMed] [Google Scholar]
  8. French JC, Bartz QR, Dion HW. Myomycin; a new antibiotic. J Antibiot (Tokyo). 1973;26:272–83. [DOI] [PubMed] [Google Scholar]
  9. Frey PA. Lysine 2;3‐aminomutase: is adenosylmethionine a poor man's adenosylcobalamin? FASEB J. 1993;7:662–70. [DOI] [PubMed] [Google Scholar]
  10. Frey PA, Hegeman AD, Ruzicka FJ. The radical SAM superfamily. Crit Rev Biochem Mol Biol. 2008;43:63–88. [DOI] [PubMed] [Google Scholar]
  11. Funabashi Y, Tsubotani S, Koyama K, Katayama N, Harada S. A new anti‐Mrsa dipeptide; Tan‐1057‐a. Tetrahedron. 1993;49:13–28. [Google Scholar]
  12. Fusetani N, Matsunaga S, Matsumoto H, Takebayashi Y. Bioactive marine metabolites. 33. Cyclotheonamides; potent thrombin inhibitors; from a marine sponge Theonella sp. J Am Chem Soc. 1990;112:7053–4. [Google Scholar]
  13. Graf E, Kirfel A, Wolff G, Breitmaier E. Die Aufklarung von Taxin A Aus Taxus Baccata L. Chem Europe. 1982;1982:376–81. [Google Scholar]
  14. Hart KW, Clarke AR, Wigley DB, Chia WN, Barstow DA, Atkinson T, et al. The importance of arginine 171 in substrate binding by Bacillus stearothermophilus lactate dehydrogenase. Biochem Biophys Res Commun. 1987;146:346–53. [DOI] [PubMed] [Google Scholar]
  15. Heberling MM, Wu B, Bartsch S, Janssen DB. Priming ammonia lyases and aminomutases for industrial and therapeutic applications. Curr Opin Chem Biol. 2013;17:250–60. [DOI] [PubMed] [Google Scholar]
  16. Igarashi M, Nakamura H, Naganawa H, Takeuchi T. Resormycin; a novel herbicidal and antifungal antibiotic produced by a strain of Streptomyces platensis. II. Structure elucidation of resormycin. J Antibiot (Tokyo). 1997;50:1026–31. [DOI] [PubMed] [Google Scholar]
  17. Kudo F, Miyanagaa A, Eguchi T. Biosynthesis of natural products containing beta‐amino acids. Nat Prod Rep. 2014;31:1056–73. [DOI] [PubMed] [Google Scholar]
  18. Kunze B, Jansen R, Sasse F, Hofle G, Reichenbach H. Chondramides a approximately D; new antifungal and cytostatic depsipeptides from Chondromyces crocatus (myxobacteria). Production; physico‐chemical and biological properties. J Antibiot (Tokyo). 1995;48:1262–6. [DOI] [PubMed] [Google Scholar]
  19. Kurath P, Rosenbrook W Jr, Dunnigan DA, McAlpine JB, Egan RS, Stanaszek RS, et al. Lysinomicin; a new aminoglycoside antibiotic. II structure and stereochemistry. J Antibiot (Tokyo). 1984;37:1130–43. [DOI] [PubMed] [Google Scholar]
  20. Kusumoto S, Kambayashi Y, Imaoka S, Shima K, Shiba T. Total chemical structure of streptothricin. J Antibiot (Tokyo). 1982;35:925–7. [DOI] [PubMed] [Google Scholar]
  21. Lee YH, Hou X, Chen R, Feng J, Liu X, Ruszczycky MW, et al. Radical S‐adenosyl methionine enzyme BlsE catalyzes a radical‐mediated 1;2‐diol dehydration during the biosynthesis of Blasticidin S. J Am Chem Soc. 2022;144:4478–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lepore BW, Ruzicka FJ, Frey PA, Ringe D. The x‐ray crystal structure of lysine‐2;3‐aminomutase from Clostridium subterminale. Proc Natl Acad Sci U S A. 2005;102:13819–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li L, Wu J, Deng Z, Zabriskie TM, He X. Streptomyces lividans blasticidin S deaminase and its application in engineering a blasticidin S‐producing strain for ease of genetic manipulation. Appl Environ Microbiol. 2013;79:2349–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Newman DJ, Cragg GM. Natural products As sources of new drugs over the 30 years from 1981 to 2010. J Nat Prod. 2012;75:311–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Parmeggiani F, Weise NJ, Ahmed ST, Turner NJ. Synthetic and therapeutic applications of ammonia‐lyases and aminomutases. Chem Rev. 2018;118:73–118. [DOI] [PubMed] [Google Scholar]
  26. Prabhakaran PC, Nam T, Woo P, Yorgey S, Society SJJotAC . Biosynthesis of blasticidin S from L‐.alpha.‐arginine. Stereochemistry in the arginine‐2;3‐aminomutase reaction. J Am Chem Soc. 1988;110:5785–91. [Google Scholar]
  27. Prabhakaran PC, Nam‐Tae W, Peter Y, Steven JG. Studies on nitrogen metabolism using 13C NMR spectroscopy. 5. Metabolism of L‐α‐arginine in the biosynthesis of blasticidin S. Tetrahedron Lett. 1986;27:3815–8. [Google Scholar]
  28. Robertson DE, Noll D, Roberts MF. Free amino acid dynamics in marine methanogens. Beta‐amino acids as compatible solutes. J Biol Chem. 1992;267:14893–901. [PubMed] [Google Scholar]
  29. Ruzicka FJ, Frey PA. Glutamate 2;3‐aminomutase: a new member of the radical SAM superfamily of enzymes. Biochim Biophys Acta. 2007;1774:286–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ruzicka FJ, Frey PA. Kinetic and spectroscopic evidence of negative cooperativity in the action of lysine 2;3‐aminomutase. J Phys Chem B. 2010;114:16118–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ruzicka FJ, Lieder KW, Frey PA. Lysine 2;3‐aminomutase from Clostridium subterminale SB4: mass spectral characterization of cyanogen bromide‐treated peptides and cloning; sequencing; and expression of the gene kamA in Escherichia coli. J Bacteriol. 2000;182:469–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Seto H, Furihata K, Yonehara H. Studies on the biosynthesis of blasticidin S. V. Isolation and structure of pentopyranic acid. J Antibiot (Tokyo). 1976;29:595–6. [DOI] [PubMed] [Google Scholar]
  33. Shiba T, Nomoto S, Wakamiya T. The chemical structure of capreomycin. Experientia. 1976;32:1109–11. [DOI] [PubMed] [Google Scholar]
  34. Song KB, Frey PA. Molecular properties of lysine‐2;3‐aminomutase. J Biol Chem. 1991;266:7651–5. [PubMed] [Google Scholar]
  35. Sowers KR, Robertson DE, Noll D, Gunsalus RP, Roberts MF. N epsilon‐acetyl‐beta‐lysine: an osmolyte synthesized by methanogenic archaebacteria. Proc Natl Acad Sci U S A. 1990;87:9083–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Su D, Kosciuk T, Yang M, Price IR, Lin H. Binding affinity determines substrate specificity and enables discovery of substrates for N‐Myristoyltransferases. ACS Catal. 2021;11:14877–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Suda H, Takita T, Aoyagi T, Umezawa H. The structure of bestatin. J Antibiot (Tokyo). 1976;29:100–1. [DOI] [PubMed] [Google Scholar]
  38. Takeuchi S, Hirayama K, Ueda K, Sakai H, Yonehara H. Blasticidin S; a new antibiotic. J Antibiot (Tokyo). 1958;11:1–5. [PubMed] [Google Scholar]
  39. Turner NJ. Ammonia lyases and aminomutases as biocatalysts for the synthesis of alpha‐amino and beta‐amino acids. Curr Opin Chem Biol. 2011;15:234–40. [DOI] [PubMed] [Google Scholar]
  40. Wang X, Zhao Y, Gao Y, Luo X, Du A, Deng Z, et al. A [3Fe‐4 S] cluster and tRNA‐dependent aminoacyltransferase BlsK in the biosynthesis of Blasticidin S. Proc Natl Acad Sci U S A. 2021;118:1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Wani MC, Taylor HL, Wall ME, Coggon P, McPhail AT. Plant antitumor agents. VI. The isolation and structure of taxol; a novel antileukemic and antitumor agent from Taxus brevifolia. J Am Chem Soc. 1971;93:2325–7. [DOI] [PubMed] [Google Scholar]
  42. Wu B, Szymanski W, Heberling MM, Feringa BL, Janssen DB. Aminomutases: mechanistic diversity; biotechnological applications and future perspectives. Trends Biotechnol. 2011;29:352–62. [DOI] [PubMed] [Google Scholar]
  43. Zabriskie TM, Klocke JA, Ireland CM, Marcus AH, Molinski TF, Faulkner DJ, et al. Jaspamide; a modified peptide from a Jaspis sponge; with insecticidal and antifungal activity. J Am Chem Soc. 1986;108:3123–4. [Google Scholar]
  44. Zhao JF, Ji WJ, Ji XJ, Zhang Q. Biochemical characterization of an arginine 2;3‐aminomutase with dual substrate specificity. Chinese J Chem. 2020;38:959–62. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1: Supporting Information


Articles from Protein Science : A Publication of the Protein Society are provided here courtesy of The Protein Society

RESOURCES