Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Feb 14.
Published in final edited form as: Cell Calcium. 2022 Jun 25;105:102619. doi: 10.1016/j.ceca.2022.102619

1Toll-like receptor 4 activation enhances Orai1-mediated calcium signal promoting cytokine production in spinal astrocytes

Hareram Birla 1, Jingsheng Xia 1, Xinghua Gao 1, Hui Zhao 1, Fengying Wang 1, Shivam Patel 1, Akwasi Amponsah 1, Alex Bekker 1, Yuan-Xiang Tao 1,2, Huijuan Hu 1,2
PMCID: PMC9928533  NIHMSID: NIHMS1872607  PMID: 35780680

Abstract

Toll-like receptor 4 (TLR4) has been implicated in pathological conditions including chronic pain. Activation of astrocytic TLRs leads to the synthesis of pro-inflammatory cytokines like interleukin 6 (IL-6) and tumor necrosis factor-ɑ (TNF-α), which can cause pathological inflammation and tissue damage in the central nervous system. However, the mechanisms of TLR4-mediated cytokine releases from astrocytes are incomplete understood. Our previous study has shown that Orai1, a key component of calcium release activated calcium channels (CRACs), mediates Ca2+ entry in astrocytes. How Orai1 contributes to TLR4 signaling remains unclear. Here we show that Orai1 deficiency drastically attenuated lipopolysaccharides (LPS)-induced TNF-α and IL-6 production in astrocytes. Acute LPS treatment did not induce Ca2+ response and had no effect on thapsigargin (Ca2+-ATPase inhibitor)-induced store-dependent Ca2+ entry. Inhibition or knockdown of Orai1 showed no reduction in LPS-induced p-ERK1/2, p-c-Jun N-terminal kinase, or p-p38 MAPK activation. Interestingly, Orai1 protein level was significantly increased after LPS exposure, which was blocked by inhibition of NF-κB activity. LPS significantly increased basal Ca2+ level and SOCE after exposure to astrocytes. Moreover, elevating extracellular Ca2+ concentration increased cytosolic Ca2+ level, which was almost eliminated in Orai1 KO astrocytes. Our study reports novel findings that Orai1 acts as a Ca2+ leak channel regulating the basal Ca2+ level and enhancing cytokine production in astrocytes under the inflammatory condition. These findings highlight an important role of Orai1 in astrocytic TRL4 function and may suggest that Orai1 could be a potential therapeutic target for neuroinflammatory disorders including chronic pain.

Keywords: TLR4, store-operated calcium channels, Orai1, astrocytes, cytokine, spinal cord

1. Introduction

Astrocytes play a key role in maintaining ion and pH homeostasis, promoting gliotransmitter synthesis/release, removal of neurotransmitters within the central nervous system (CNS) [1–4]. Astrocytes possess numerous fine processes surrounding neurons and blood vessels providing brain glucose supply and antioxidant defense [5, 6]. However, during injury or disease, astrocytes become reactive, producing proinflammatory mediators and releasing reactive oxygen species [7, 8]. Reactive astrocytes have been implicated in many central nervous system (CNS) disorders, such as epilepsy, Alzheimer’s Disease, Parkinson’s disease, and multiple sclerosis [9–12]. Spinal astrocytes have been recognized as an important player in chronic pain and itch [13–15]. Peripheral inflammation or injury can trigger astrocyte activation (reactive astrogliosis), which is thought to be involved in central mechanisms underlying the maintenance and exaggeration of chronic pain [16, 17].

Toll-like receptor 4 (TLR4) is a member of the TLR family proteins that play a crucial role in the initiation of innate immune response. TLR4 is one of the most studied among the family members and widely expressed on many different cell types in the human body. TLR4 is expressed on astrocytes and is involved in a variety of inflammatory conditions associated with excessive cytokine production [18–20]. TLR4 signaling is involved in several CNS diseases, such as AD progression and Parkinson’s disease [18, 21, 22]. Accumulating evidence indicates that TLR4 contributes to the development of pain hypersensitivity in several animal models of pain [20, 23–25]. TLR4 signaling also enhances histamine-mediated itch sensation and is essential for the development of chronic itch [15, 26]. It is well established that activation of astrocytic TLR4 leads to the downstream stimulation of the MAPK and NF-κB signaling pathways that trigger the production of inflammatory mediators and cytokines, however, the molecular entities in these pathways remain poorly defined.

Intracellular Ca2+ is vital for a wide range of cellular processes in astrocytes and mediates remarkable cellular functions, such as gliotransmission and cytokine production [27, 28], which are involved in the process of pathological CNS diseases [29–31]. Astrocytic Ca2+ signals can be derived from intracellular Ca2+ release by intracellular organelles and extracellular Ca2+ influx through various Ca2+ permeable channels on the plasma membrane. Astrocytes express numerous Ca2+ permeable channels such as L-type voltage-gated Ca2+ channels and transient receptor potential (TRP) channels, regulating Ca2+ homeostasis [28, 32]. Ca2+ also acts as a critical molecular coordinator of neuron-glia communication [33, 34]. Given the important role of Ca2+ in physiological and pathological functions of astrocytes, the precise profile of Ca2+ signaling in astrocytes remains to be defined.

Store-operated Ca2+ channels (SOCs) are the major Ca2+ entry pathway in non-excitatory cells. Calcium release activated calcium channels (CRACs, known as Orai1/2/3) have emerged as important Ca2+ signals in many cell types. CRACs can be activated by Ca2+ release from the endoplasmic reticulum (ER) [35, 36]. It is well known that SOC entry is required for immune cell activation and that loss of SOC entry leads to various diseases including severe combined immunodeficiency, thrombocytopenia, tubular aggregate myopathy [37, 38]. SOCs have emerged as the leading Ca2+ pathway in non-excitatory and excitatory cells [39, 40]. Orai1 is a primary component of CRACs and its role in immune responses and autoimmunity is well-documented. Orai1-mediated Ca2+ entry plays a key role in regulating NF-κB activation and nuclear localization [41, 42]. Previous studies have shown that SOCs are expressed in hippocampal astrocytes and contribute to spontaneous astrocytic Ca2+ transients and play a major role in gliotransmission [1, 43]. We have reported that Orai1 is a key player in astrocytic SOC entry [44]. Activation of SOCs by thapsigargin (a Ca2+-ATPase inhibitor) triggers cytokine production, and inhibition CRACs or knockdown of Orai1 markedly attenuates lipopolysaccharides (LPS)-induced cytokine production in spinal astrocytes [44]. However, how Orai1 is involved in this process is unknown.

In this study, we show that Orai1 deficiency drastically decreased LPS-induced cytokine production. Acute activation of TLR4 by LPS neither induced calcium release nor calcium entry. LPS application did not modulate Orai1 function directly. Inhibition or knockdown of Orai1 did not alter in LPS-induced MAPK activation. Interestingly, we found that Orai1 protein level was significantly increased after LPS exposure for a few hours, which was blocked by inhibition of NF-κB activity. LPS significantly increased basal Ca2+ level and SOCE after 3–4 hours of exposure. Moreover, elevating extracellular Ca2+ concentration increased cytosolic Ca2+ level, which was almost eliminated in Orai1 KO astrocytes. Taken together, these findings identify Orai1 as a Ca2+ leak channel, contributing astrocytic Ca2+ homeostasis and TLR4-mediated cytokine production.

2. Results

2.1. Orai1 deficiency impairs thapsigargin (TG)- and LPS-induced cytokine production in spinal astrocytes

Ca2+ is an important regulator of many cellular functions in a variety of cell types. Non-selective Ca2+ permeable channels-mediated Ca2+ entry is crucial for TLR4-mediated NFκB activation and cytokine production in macrophages and epithelial cells [32, 45–47]. However, the role of store-dependent Ca2+ entry in TLR4-mediated functions has not been established. It has been reported that SOC entry is dispensable for LPS-induced cytokine production in microphages [48]. We have shown that inhibition or knockdown of Orai1 drastically reduces SOCE and cytokine production [44]. Since pharmacological approaches may not specifically inhibit Orai1, here we used an Orai1 mutant mouse line, which had been previously characterized and backcrossed to CD-1 for at least 8 generations [49–51], to confirm these observations. Spinal astrocytes were cultured from Orai1 deficient (KO) and its littermate wild type (WT) mice. Western blotting results revealed that Orai1 protein was absent, while other CRAC family members were intact in Orai1 KO astrocytes compared to WT astrocytes (Fig. 1A). We performed live cell Ca2+ imaging in spinal cord astrocytes. Astrocytes were pretreated with the Ca2+-free Tyrode’s solution. Consistent with our previous study [44], 1μM TG (Ca2+-ATPase inhibitor), transiently induced Ca2+ release from the ER, which was followed by a sustained increase when 2 mM Ca2+ was added. TG-induced Ca2+ entry was drastically reduced, while Ca2+ release was not affected in Orai1 KO astrocytes (Fig. 1B, C). To determine whether reduction of SOCE observed in Orai1−/− astrocytes is due to loss of Orai1 expression, we transfected Orai1−/− astrocytes with wild type Orai1-CFP. Astrocytes transfected with Orai1-CFP showed increased basal Ca2+ level and SOCE compared to astrocytes transfected with GFP plasmid (Supplementary Figure 1), suggesting that Orai1 is responsible for astrocytic SOCE. As expected, TG-induced production of TNF-α and IL-6 was eliminated in Orai1 KO group (Fig. 1D, E). These findings demonstrate that Orai1 is necessary for TG-induced SOCE and cytokine secretion.

Figure 1. Deficiency of Orai1 abolishes thapsigargin (TG)-induced cytokine production in spinal astrocytes.

Figure 1.

(A) Representative images of western blots probed with antibodies against Orai1, Orai2, Orai3 and actin, respectively. Spinal cord samples were collected from adult wild type (WT) and Orai1 knockout (KO) mice. (B) Representative Ca2+ imaging recordings of TG-induced Ca2+ release and SOCE in WT and Orai1 KO astrocytes. (C) Summary of the result of TG-induced SOCE in WT and Orai1 KO astrocytes, n=13–18. (D, E) TG-induced IL-6 (D) and TNF-ɑ (E) production in WT and Orai1 KO astrocytes, n=9. (F-I) LPS-induced cytokine production in Orai1 KO and WT astrocytes: IL-6 (F) and TNF-ɑ (G) production after 24 h treatment; IL-6 (H) and TNF-ɑ (I) production after 6 h treatment, n = 5–8 in each group. Values represent mean ± SEM; *** P < 0.001 compared with WT by Student’s t test (C) or compared with control by one-way ANOVA followed by the Tukey’s multiple comparison test (D-I). ### P < 0.001 compared with WT by one-way ANOVA followed by the Tukey’s multiple comparison test F-I).

To determine whether Orai1 deficiency affects TLR4-mediated cytokine production, we used Lipopolysaccharide (LPS), a potent TLR4 agonist. LPS dose-dependently increased production of IL-6 and TNF-α after 24 hours of treatment (Supplementary Figure 2A, B), which was completely blocked by a specific TLR4 antagonist TAK-242 [52] (Supplementary Figure 2C, D). To confirm LPS-induced cytokine production is mediated by TLR4, astrocytes were transfected with control siRNA or TLR4 siRNA. Similarly, TLR4 siRNA significantly reduced IL-6 and TNF-α production (Supplementary Figure 2E, F). The TLR4 reduction was evaluated by RT-PCR (Supplementary Figure 2G). Importantly, LPS-induced production of IL-6 and TNF-α was markedly attenuated in Orai1 KO astrocytes (Fig. 1F, G). To determine whether Orai1 is involved in early cytokine production, we examined LPS-induced cytokine production after 6 hours of treatment and the similar result was observed (Fig. 1H, I). These results indicate that Orai1 plays a key role in TLR4-mediated cytokine production.

2.2. Acute activation of TLR4 does not modulate Orai1 functions

It has been shown that LPS-induced activation of TLR4 causes Ca2+ release from ER in endothelial cells and Ca2+ flux in murine macrophages [53, 54]. We wondered whether astrocytic Orai1 is involved in the LPS-induced Ca2+ response. Ca2+ imaging was performed in astrocytes. Interestingly, bath application of LPS neither elicited Ca2+ release in the absence of Ca2+, nor changed basal Ca2+ level in the presence of 2 mM Ca2+ (Fig. 2A, B), while 2-Methylthioadenosine (purinoceptor P2Y agonist) application caused Ca2+ release from intracellular organelles (Fig. 2A), and ATP 100 μM induced robust Ca2+ response in these cells (Fig. 2B, C). We then tested if LPS enhances Orai1 function. Astrocytes were pretreated with vehicle (PBS) or 10 ng/mL LPS for 10 min. TG-induced Ca2+ release and entry in LPS-treated cells were comparable to those in PBS-treated cells (Fig. 2D–F). These results suggest that acute activation of TLR4 is not able to directly trigger Ca2+ response or modulate Orai1 function.

Figure 2. Acute LPS treatment neither induce Ca2+ response nor increase SOCE.

Figure 2.

(A) Effect of LPS 10 ng/ml and 1 μM 2-Methylthioadenosine (P2 purinoceptor agonist) on cytosolic Ca2+ level under the 0 Ca2+ condition. (B) Effect of LPS and ATP on cytosolic Ca2+ level under the 2 mM Ca2+ condition. (C) Summary of the effect of 10 ng/ml LPS on basal Ca2+ level. (D) Representative Ca2+ imaging recordings of TG-induced Ca2+ responses. (E, F) Summary of the effect of LPS on TG-induced Ca2+ release (E) and Ca2+ influx (F). Values represent mean ± SEM; n = 13–22.

2.3. Inhibition or deficiency of Orai1 does not affect LPS-induced initial mitogen-activated protein kinase (MAPK) activation.

It is well known that MAPK activation is required for the production of proinflammatory cytokines in TLR signaling [55, 56]. To determine whether Orai1 regulates cytokines production via the MAPK pathway, we examined LPS-induced MAPK activation in astrocytes. The activation of ERK, p38, and JNK were assessed by measuring the relative expression of p-ERK, p-p38, and p-JNK. Astrocytes were treated with LPS from 5 minutes to 1 hour. ERK and p38 activation occurred within 5 min and maintained for at least 1 hour, but JNK activation started at later time points (Supplementary Figure 3). Inhibition of MEK (upstream of ERK) by PD58059, p38 by SB203580, or JNK by SP600125 reduced LPS-induced cytokine production in a concentration-dependent manner (Supplementary Figure 4A–F), respectively. These effects were not due to changes of cell viability (Supplementary Figure 4G). To determine whether store-operated Ca2+ entry contributes to TLR4-mediated MAPK activation, we pretreated astrocytes with vehicle (0.1% DMSO) or a CRAC channel blocker YM-58483 (10 μM) for 30 min. Surprisingly, ERK, p38 and JNK activation was not affected by YM-58483 (Fig. 3A–C). To further determine whether Orai1 contributes to TLR4-mediated MAPK activation, astrocytes were exposed to 10 ng/mL LPS for 20 min. Consistently, LPS-induced ERK and p38 activation in Orai1 KO cells were similar to those in WT astrocytes (Fig. 3D–F). These data suggest that Orai1 is downstream of TLR4-MAPK signaling.

Figure 3. Inhibition or deficiency of Orai1 does not affect LPS-induced mitogen-activated protein kinase (MAPK) activation in astrocytes.

Figure 3.

(A-C) Effect of YM-58483 on LPS-induced ERK activation (A), p38 activation (B) and JNK activation (C). The p-ERK, p-p38 and p-JNK levels were quantified as a ratio to total ERK, p38 and JNK, and were normalized to levels of their PBS control. (D) Representative images of western blots probed with antibodies against p-ERK, ERK, p-p38 and p38, respectively. Samples were collected from cultured WT or Orai1 KO astrocytes treated with PBS or LPS. (E, F) LPS-induced ERK (E) and p38 (F) activation in astrocytes cultured from Orai1 KO and WT littermates, n = 3–4 samples (each group). Values represent mean ± SEM; *P < 0.05 compared with PBS control by one-way ANOVA followed by the Tukey’s multiple comparison test.

2.4. Activation of TLR4 increases Orai1 expression via NF-κB signaling

We then asked whether LPS treatment alters Orai1 expression. Western blotting was performed in cultured astrocytes treated with PBS or 10 ng/mL LPS for 6 hours (the time point for measuring cytokine production). LPS treatment significantly increased Orai1 and STIM1 expression after 6 hours (Fig. 4A). To determine the time course of LPS-induced Orai1 upregulation, astrocytes were treated with LPS 10 ng/mL at different time points from 30 min to 6 hours. Orai1 upregulation occurred one hour after LPS treatment with the peak Orai1 level at 4-hour time point. (Fig. 4B). To determine whether Orai1 upregulation increases Ca2+ signal, we performed calcium imaging recordings in astrocytes treated with PBS or 10 ng/mL LPS for 3–4 hours. Basal Ca2+ level was significantly higher in LPS-treated cells compared to PBS-treated cells (Fig. 4C, D). Moreover, in LPS-treated astrocytes, TG-induced SOCE was also significantly increased (Fig. 4C, E), but TG-induced Ca2+ release was not altered (Fig. 4C). These results suggest that upregulation of Orai1 protein contributes to Orai1-mediated Ca2+ signal.

Figure 4. Activation of TLR4 increases expression and function of Orai1 and STIM1 in astrocytes.

Figure 4.

(A) Effect of LPS treatment for 6 h on Orai1 and STIM1 protein expression, n = 3. (B) Time course of LPS-induced Orai1 upregulation, n = 2. (C) Representative recordings of TG-induced Ca2+ release and Ca2+ entry after PBS or LPS treatment (3–4 hours). (D) Effect of LPS treatment on basal Ca2+ level, n = 72–201. (E) Effect of LPS treatment on TG-induced SOCE, n = 72–102. (F) Effect of inhibition of IK/NF-κB with 10 μM IKK-16 (IKK) on LPS-induced NF-κB activation, n = 2. (G) Effect of IKK-16 on LPS-induced Orai1 upregulation, n = 5. Values represent mean ± SEM; ** P < 0.05, ** P < 0.01, *** P < 0.01 compared with PBS by Student’s t test.

NF-κB is one of the key transcription factors in the inflammatory response. It is well known that LPS stimulation triggers post-translational modifications in the p65 subunit of NF-κB (NF-κB p65) prior to nuclear translocation [57, 58]. To determine whether Orai1 upregulation is mediated by NF-κB activity, we used IKK-16 (a selective IκB kinase (IKK) inhibitor), which inhibits NF-κB activation [59, 60]. Astrocytes were pretreated with IKK-16 at 5 or 10 μM for 30 min. IKK-16 at a higher concentration (10 μM) abolished LPS-induced phosphorylation of NF-κB (p-NF-κB) (Fig. 4F). Using this concentration, we found that Orai1 upregulation was eliminated by IKK-16 (Fig. 4G). This result indicates that Orai1 upregulation was mediated by NF-κB signaling.

2.5. Orai1 contributes to basal Ca2+ homeostasis

To determine whether Orai1 plays a role in Ca2+ homeostasis in astrocytes, we measured resting Ca2+ levels in cultured astrocytes using live-cell Ca2+ imaging. Under 2 mM Ca2+ condition, YM-58483 and 2-APB (another CRAC channel blocker) dose-dependently decreased basal Ca2+ level in astrocytes (Fig. 5A, B). To confirm that these effects are mediated by the CRAC channel family, we used control siRNA or targeting siRNAs against Orai1, Orai2, and Orai3, respectively. Only Orai1 siRNA reduced basal Ca2+ level (Fig. 5C). Their knockdown efficiency was evaluated in our previous study [44], and confirmed in the present study by Western blot analysis (Supplementary Figure 5A). To further confirm the Orai1 siRNA result, we cultured astrocytes from Orai1 KO and WT neonatal mice. Consistently, astrocytes from Orai1 deficiency mice showed significant reduction of basal Ca2+ level (Fig. 5D). To determine whether Orai1’s modulation is store (STIM)-dependent, we examined the effect of the STIM inhibitor ML-9 on basal Ca2+ level. Twenty-five μM ML-9 (an effective concentration for SOCE) treatment did not reduce basal Ca2+ level (Fig. 5E), while increasing ML-9 concentration to 50 μM resulted in slight Ca2+ response. To further rule out the possibility of STIM protein’s involvement, we also used the knockdown approach and found that transfection of STIM1 siRNA or STIM2 siRNA into astrocytes did not alter basal Ca2+ level (Fig. 5F). The reduction of STIM1 and STIM2 protein expression was confirmed in STIM1 siRNA- or STIM2 siRNA-treated astrocytes (Supplementary Figure 5B). These results indicate that Orai1 mediates a store-independent Ca2+ signal regulating basal Ca2+ homeostasis.

Figure 5. Orai1 contributes to basal Ca2+ homeostasis.

Figure 5.

(A) Effect of YM-58483 on basal Ca2+ level, n = 14–22. (B) Effect of 2-APB on basal Ca2+ level, n = 14–22. (C) Effects of specific siRNAs against Orai members on the basal Ca2+ concentration measured in astrocytes transfected with control siRNA, Orai1 siRNA, Orai2 siRNA or Orai3 siRNA, n = 15–28. (D) The basal Ca2+ concentrations measured in astrocytes cultured from WT and Orai1 KO mice, n = 21–25. (E) Effect of ML-9 on basal Ca2+ level, n = 13. (F) Effect of STIM1 siRNA and STIM2 siRNA on basal Ca2+ concentration measured in astrocytes transfected with control siRNA, STIM1 siRNA or STIM2 siRNA, n = 34–45. Values represent mean ± SEM, ***P < 0.001 compared with control by one-way ANOVA followed by the Tukey’s multiple comparison test or compared with WT by Student’s t test.

2.6. Orai1 functions as a leak Ca2+ channel

We then asked whether Orai1 functions as a leak Ca2+ channel in astrocytes. To answer this question, we applied modified Tyrode’s solutions that contained different Ca2+ concentrations to astrocytes. Astrocytes were perfused with 0.2 mM Ca2+ solution for 2 minutes. Changing the extracellular Ca2+ concentration to 2 mM immediately elevated intracellular Ca2+ level. Subsequently increasing Ca2+ concentration to 10 mM resulted in further Ca2+ entry in astrocytes (Fig. 6A). 2-APB (30 μM) or YM-58483 (10 μM) reduced Ca2+ level under 0.2 mM Ca2+ condition, almost abolished 2 mM- or 10 mM-Ca2+-induced Ca2+ influx (Fig. 6A, B). We also observed that Ca2+ level under the 0.2 mM Ca2+ condition was significantly lower in Orai1 siRNA-transfected astrocytes compared to control siRNA-transfected astrocytes (Fig. 6C). Raising Ca2+ concentration-induced Ca2+ influx was almost eliminated in Orai1 siRNA-transfected astrocytes (Fig. 6C). This knockdown effect was further confirmed in Orai1 KO astrocytes (Fig. 6D). To determine whether STIM proteins are involved in Orai1-mediated Ca2+ entry, we knocked down STIM1 or STIM2 respectively. Elevating extracellular Ca2+ concentration-induced Ca2+ influx was intact in STIM1 or STIM2 knocked down astrocytes (Supplementary Figure 6A, B). These findings suggest that Orai1 acts as the leak Ca2+ channel and plays a crucial role in maintaining astrocytic Ca2+ homeostasis.

Figure 6. Orai1 functions as a leak Ca2+ channel.

Figure 6.

(A) Effect of 2-APB on elevation of extracellular Ca2+-induced Ca2+ entry, n = 18. (B) Effect of YM-58483 on elevation of extracellular Ca2+-induced Ca2+ entry, n = 20. (C) Effect of Orai1 siRNAs on elevation of extracellular Ca2+-induced Ca2+ entry in astrocytes transfected with control siRNA or Orai1 siRNA, n = 13–25. (D) Effect of Orai1 deficiency on elevation of extracellular Ca2+-induced Ca2+ entry in astrocytes cultured from WT and Orai1 KO mice, n = 19–20. Values represent mean ± SEM, ***P < 0.001, compared with vehicle, control siRNA or WT by one-way ANOVA.

3. Discussion

TLR4 signaling plays a crucial role in neuroinflammation and has been linked to the pathogenesis of several CNS diseases. Activation of TLR4 leading to an increase in the production of inflammatory cytokines was well characterized, however, our understanding of the underlying mechanisms remains incomplete. It is known that cytosolic Ca2+ is essential for TLR4-mediated downstream events in macrophages and epithelial cells [32, 45–47]. Whether and how Orai1-mediated Ca2+ entry in astrocytic TLR4 signaling has not been documented. In the present study, we identified Orai1 as a Ca2+ leak channel regulating the basal Ca2+ level and a downstream effector of TLR4 signaling in astrocytes. Our data reveal a functional link between TLR4 and the CRAC channel Orai1. LPS stimulates TLR4 to induce orai1 upregulation, consequently, increases cytosolic Ca2+ level, enhancing Ca2+-mediated cellular processes.

It has been shown that LPS exposure induces Ca2+ release from ER stores and Ca2+ influx in endothelial cells and macrophages [53, 54]. We tested if LPS has a similar effect in astrocytes. Our data showed that acute treatment of LPS neither triggered Ca2+ release nor induced Ca2+ influx in astrocytes, while positive controls 2-Methylthioadenosine and ATP had effects in the same cells. These results suggest that acute treatment of LPS does not activate Ca2+ permeable channels and regulate basal Ca2+ homeostasis in spinal astrocytes. CRAC channels are primarily activated by the ER Ca2+ sensor STIM proteins when ER Ca2+ level is decreased by Gq protein-coupled receptor (GPCR) activation under physiological and pathological conditions. TLR4 does not belongs to the GPCR family. Therefore, acute LPS treatment did not trigger IP3-mediated Ca2+ release. The inconsistency may be attributed to the different cell types and the magnitude of stimulation used. We applied a relative low concentration of LPS. At this concentration, TLR4 antagonist completely block LPS-induced cytokine production. Our Ca2+ imaging recordings also revealed that acute LPS treatment had no effect on TG-induced Ca2+ release and Ca2+ influx. Clearly, acute treatment of LPS did not modulate SOCE.

It is well documented that LPS exposure induces robust MAPK activation in many cell types including astrocytes [55]. We also observed activation of ERK, p38 and JNK after LPS exposure. Our ELISA data showed that inhibition of MEK/ERK significantly attenuated LPS-induced cytokine production, which is consistent with previous studies [61–63]. We have shown that activation of Orai1 by TG increased ERK activation in dorsal horn neurons [64]. We expect that Orai1 is an upstream of ERK signaling. Surprisingly, inhibition or deficiency of Orai1 did not change ERK activation. Similarly, Inhibition of p38 or JNK drastically decreased cytokine production, while inhibition of Orai1 did not affect LPS-induced p38 and JNK activation. These results suggest that Orai1 is downstream of TLR4-MAPK.

Our results showed that Orai1 was upregulated in astrocytes after LPS exposure for a few hours, which is consistent with a previous study in mast cells [65]. The time course study revealed that Orai1 upregulation started at the 1-hour time point and lasted at least 6 hours. We tested if the upregulation of Orai1 enhances Orai1-mediated Ca2+ signal. The Ca2+ imaging data demonstrated that basal Ca2+ level and TG-induced SOCE were significantly increased after LPS 4-hour exposure. It is well known that NF-κB signaling is required for induction of a large number of inflammatory genes. Previous reports have shown that NF-κB activation occurred at 30 min after LPS exposure [66, 67], which is earlier than the time we observed for Orai1 upregulation. We thereby examined the effect of a specific IKK/NF-κB inhibitor (IKK-16) on LPS-induced Orai1 upregulation. Pretreated astrocytes with 10 μM IKK-16 for 30 min, completely inhibited NF-κB activation and Orai1 upregulation, suggesting that Orai1 is a downstream effector of TLR4-NF-κB signaling.

We and others have demonstrated that Orai1 is an important Ca2+ entry pathway in astrocytes [1, 44]. Indeed, Orai1 KO astrocytes showed a marked reduction (60%) of LPS-induced cytokine production. However, this cytokine secretion was not eliminated in Orai1 KO astrocytes. Definitely, other signaling pathways may also play roles in the cytokine production. It is known that astrocytes express numerous calcium-permeable ion channels and Na+/Ca2+ exchanger that mediated Ca2+ entry pathways [28, 68–73]. A previous report has demonstrated that TRPM2, a Ca2+-permeable nonselective cation channel, is involved in LPS-induced cytokine production [74]. A recent study also shows that Pannexin 1 (Panx 1), functions as a Ca2+-permeable channel[75], plays a role in LPS-induced cytokine production [76]. Some Ca2+-independent pathways may also contribute to LPS-induced cytokine production in astrocytes.

Previous reports have demonstrated that deletion of Orai2 increases Orai1-mediated SOCE in astrocytes and T cells [77–79]. However, our data from previous and present studies showed that knockdown of Orai2 did not significantly change SOCE or basal Ca2+ level in spinal cord neurons and astrocytes, which are consistent with a previous study that loss of Orai2 diminishes SOCE in neurons [80]. The possible reason for the different findings might be attributed to differences between the knockout and knockdown approaches. Knockdown of Orai2 protein may have been insufficient to determine the clear role of Orai2 in astrocytes. This has been observed in the recent study that knockdown of Orai2 does not increase SOCE while deletion of Orai2 increases SOCE [77].

Our Ca2+ imaging data showed that inhibition of Orai1 drastically decreased basal Ca2+ level. This effect was confirmed by Orai1 deficiency. Orai1 is generally believed to be activated in a store-dependent manner. Interestingly, Inhibition of STIM proteins by ML-9 had no effect on basal Ca2+ level. Consistently, knockdown of STIM1 or STIM2 did not change cytosolic Ca2+ concentration. These findings suggest that Orai1 is constituently activated and independent of STIM proteins under the resting state. We further refined our understanding of the functional role of Orai1 in astrocytic Ca2+ signal by determining whether Orai1 is a leak channel in astrocytes. Increasing extracellular Ca2+ concentrations from 0.2 mM to 2 mM then 10 mM, we observed a large Ca2+ influx, which was almost eliminated by inhibition of Orai1 with 2-APB or YM-58483. The similar results were seen in Orai1 knockdown or Orai1 deficient astrocytes, but not in STIM1 siRNA- or STIM2 siRNA-transfected astrocytes. These findings provide strong evidence that Orai1 functions as the leak Ca2+ channel contributing to basal Ca2+ homeostasis.

Taken together, we demonstrated that Orai1 plays a key role in TLR4-mediated cytokine production and is a downstream effector of TLR4-NF-κB signaling. We also identified Orai1 as a leak Ca2+ channel maintaining astrocytic Ca2+ homeostasis. Our findings revealed a novel link between TLR4 and Orai1. Collectively, the present data indicated that Orai1 is a crucial Ca2+ signal in spinal astrocytes, and may be implicated in Ca2+-dependent pathological events including neuroinflammation.

4. Methods

4.1. Ethics

Pregnant wild type CD-1 or Orai1 mutant mice were produced in our animal facility and housed in standard cages in 12-h light/dark cycle. Both male and female neonatal (post neonatal 2–4 days) mice were used. All experiments were conducted in accordance with the guidelines of the National Institutes of Health and the Committee for Research and Ethical Issues of IASP and were approved by the Rutgers New Jersey Medical School Animal Care and Use Committee.

4.2. Spinal astrocyte culture

Primary cultures of spinal cord astrocytes were prepared from CD-1 and Orai1 mutant (CD-1 background) neonatal mice as we described previously [44]. Briefly, following the induction of hypothermia on ice, neonatal mice were decapitated. The spinal cord was carefully removed after a laminectomy. After removing meninges, the spinal cord strips were incubated for 30 min at 37 °C in Hank’s balanced salt solution (HBSS, Invitrogen, Carlsbad, CA) (in mM: 137 NaCl, 5.4 KCl, 0.4 KH2PO4, 1 CaCl2, 0.5 MgCl2, 0.4 MgSO4, 4.2 NaHCO3, 0.3 Na2HPO4, and 5.6 glucose) containing papain (15 U/ml; Worthington Biochemical, Lakewood, NJ). The strips were mechanically dissociated by gently triturating using a pipette. The cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) in a 75 cm2 flask containing 10% fetal bovine serum with 5% CO2 at 37°C. When the cells reached about 70–80% confluence (usually 7–8 days), the flask was placed on an orbital shaker at 320 rpm for 2–3 hours to detach cells mainly microglia and precursor cells sitting on top of the astrocyte monolayer. The attached cells were trypsinized and re-plated to six-well plates for Western blotting analysis, 96-well plates for ELISA, and 12-mm coverslips for Ca2+ imaging in MEM culture media. The purity of astrocytes was determined by immunostaining GFAP (the percentage of positive cells was 92%).

4.3. Transfection

Astrocytes were collected from T75 flasks after 7–8 days in culture. Transfection was performed as described in our previous study [44]. Briefly, astrocytes were electroporated using a mouse Nucleofector kit according to the manufacturer’s instructions (Lonza Group Ltd, Basel, Switzerland). For siRNA transfection, astrocytes were transfected with 10 μg of TLR4 siRNA, STIM1 siRNA, STIM2 siRNA, Orai1 siRNA (Life Technologies, Grand Island, NY), Orai2 siRNA (Dharmacon), Orai3 siRNA (Dharmacon), or Scramble siRNA (Life Technologies for STIM1, STIM2 and Orai1; Dharmacon for Orai2 and Orai3) per 1 × 106 cells. For transfection of Orai1-CFP (inserted in the pIRESneo plasmid, a generous gift from Dr. Gill, Penn State College of Medicine, PA), astrocytes were transfected with Orai1-CFP (2 μg) per 1 × 106 cells. Transfected cells were seeded on 12-mm glass coverslips or 6-well plates. After 16 h, transfection medium was removed and astrocytes were fed with fresh culture medium. Calcium imaging and Western blot analysis were performed 48–72 h post transfection.

4.4. Western blot analysis

Astrocytes in six-well plates were quickly rinsed with phosphate buffer saline (PBS) before being lysed in an ice-cold radio-immunoprecipitation assay (RIPA) buffer containing 150 mM NaCl, 50 mM Tris-HCl, 0.2 mM ethylenediaminetetraacetic acid (EDTA), 2% sodium dodecyl sulphate (SDS), 1% Triton X-100, 1 % deoxycholate, 0.1 mM phenylmethanesulfonyl fluoride (PMSF), and protease cocktails inhibitor (Thermo Fisher Scientific). The supernatants were collected and utilized to determine total protein concentration. Proteins were resolved using SDS-PAGE, and then transferred to polyvinylidene difluoride membrane (PVDF; GE Healthcare, Piscataway, NY). The membrane was probed with primary antibodies, including rabbit anti-Orai1 (1:500, ProSci), rabbit anti-STIM1 (1:8000, Cell Signaling Technology), rabbit anti-STIM2 (1:8000, ProSci), anti-ERK (1: 10,000; Cell Signaling Technology), anti-p-ERK (1:1000; Cell Signaling Technology), anti-p-p38 (1:1000, Cell Signal), anti-p38 (1:5000, Cell Signal), anti-JNK (1:5000, Cell Signal) anti-p-JNK (1:1000, Cell Signal), or mouse anti-Actin (1:20,000; Sigma-Aldrich), for overnight at 4°C. The blots were rinsed and incubated with either HRP-conjugated secondary antibody (1:10 000, Cell Signal) followed by reaction with enhanced chemiluminescence (ECL) reagents, or IR Dye goat anti-rabbit/mouse secondary antibodies (1:10,000; LI-COR). Image J (NIH) or Odyssey Image Studio Software (LI-COR) were used to quantify the bands.

4.5. ELISA

Astrocytes were plated in 96-well plates (2×104 cells per well) overnight. For testing the effect of drugs on LPS-induced cytokine production, astrocytes were pretreated with different concentrations of drugs for 30 min before application of LPS. After 6 or 24 hours of LPS treatments, astrocytes were centrifuged at 1000 rpm for 5 min, and IL-6 and TNF-α in the supernatants were measured by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN, USA).

4.6. MTT cell viability assay

The cell viability was determined by an assay measuring dehydrogenase activity (Trevigen, Gaithersburg, MD) according to the manufacturer’s instructions as we described previously [44]. After collecting supernatants for ELISA, 100 μL of MEM was immediately added to each well that contained astrocytes. Ten microliters of MTT reagent were added to each well and incubated for 2 h at 37 °C. Once the purple precipitate was formed and clearly visible intracellularly under the microscope, MTT detergent was applied to dissolve the formazan crystals. The absorbance was measured directly from 96-well plates at 570 nm using a microplate reader (Spectramax Plus, Molecular Devices, CA).

4.7. Ca2+ imaging

The intracellular Ca2+ level was measured using fura-2-based microfluorimetry and imaging analysis (Nicolai et al. 2010). Astrocytes were loaded with 4 μM fura-2AM (Life Technologies) in HBSS for 30 min at RT, and then washed for another 20 min in normal bath solution (containing 5.6 mM glucose, 5 mM KCl, 140 mM NaCl, 1 mM MgCl2, 2 mM CaCl2, and 10 mM Hepes). Then cells on the coverslip were mounted in a small laminar-flow perfusion chamber (Model RC-25, Warner Instruments, Hamden, CT, USA) and continuously perfused with Tyrode’s solution (5–7 ml/min). Images were acquired using an Olympus inverted microscope equipped with a CCD camera (Hamamatsu ORCA-03G, Tokyo, Japan) at 3 s intervals (20–22 °C). The fluorescence ratio was calculated using the excitation and emission intensities at 340 and 380 nm with background subtraction. Data were analyzed using the software MetaFluor 7.7.9 (Molecular Devices, Sunnyvale, CA, USA). Free intracellular Ca2+ concentration was calculated by the formula [Ca2+]I = Kd*β*(R–Rmin)/ (Rmax–R), where β=(I380 max)/(I380 min). Rmin, Rmax, and β were calculated using in situ calibration [81]. From each coverslip, only one recording was made.

4.8. Real-Time (RT) PCR

Real-Time PCR was performed as described in our previous study [44]. Total RNA was extracted from cultured astrocytes using TRIzol Reagent (Ambion life technologies). The RNA content was analyzed by nan drop UV-Vis Spectrophotometer at 260 nm (Thermo Scientific) for cDNA preparation. Total RNA was reverse transcribed into cDNA for each sample using the superscript first strand cDNA synthesis kit (Invitrogen) according to the manufacturer’s protocol. Specific primers for mouse TLR4 (Forward:5′-CACTGTTCTTCTCCTGCCTGAC-3′, Reverse:5′TGGTTGAAGA AGGAATGTCATC-3’) and Tublin (Forwad: 5’GTGCATCTCCATCCATTGTTG3’, Reverse: 5’GTGGGTTCCAGGTCTACGAA3’) were purchased from IDT (North Carolina, USA). The CFX Touch real time PCR System (Bio-Red) was used to amplify genes with the following amplification conditions: 5 min of initial denaturation at 95 °C, then 40 cycles of 95 °C for 30 s, 57 °C for 30 s, and 72 °C for 1.5 min. The relative gene expression was determined by the 2(−Delta Delta CT, 2−ΔΔCT) method. The expression of TLR4 was normalized with Tublin (housekeeping gene).

4.9. Drugs

PD98059 (2-(2-Amino-3-methoxyphenyl)-4H-1-benzopyran-4-one), YM98483 (N-[4-[3,5-Bis (trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-4-methyl-1,2,3-thiadiazole-5-carboxamide), SB203580 (4-[5-(4- Fluorophenyl)-2-[4-(methylsulfonyl)phenyl]-1H-imidazol-4-yl]pyridine), ML-9 (1-(5-Chloronaphthalene- 1-sulfonyl)-1H-hexahydro-1,4-diazepine), SP600125 (Anthra[1-9-cd]pyrazol-6(2H)-one), IKK 16 (N-(4-Pyrrolidin-1-yl-piperidin-1-yl)-[4-(4-benzo[b]thiophen-2-yl-pyrimidin-2-ylamino)phenyl]carboxamide dihydrochloride) and TAK-242 ((R)-Ethyl 6-(N-(2-chloro-4-fluorophenyl)sulfamoyl)cyclohex-1- enecarboxylate) were purchased from Tocris (Minneapolis, MN). Thapsigargin ((3S,3aR,4S,6S,6AR, 7S,8S,9bS)-6-(Acetyloxy)-2,3,3a,4,5,6,6a,7,8,9b-decahydro-3,3a-dihydroxy-3,6,9-trimethyl-8-[[(2Z)-2-methyl-1-oxo-2-butenyl]oxy]-2-oxo-4-(1-oxobutoxy)azuleno[4,5-b]furan-7-yloctanoate), lipopolysaccharide (LPS), lipopolysaccharide (LPS) and 2-APB (2-Aminoethoxydiphenyl borane) were purchased from Sigma (St Louis, MO, USA). They were dissolved in Milli-Q water or dimethyl sulfoxide (DMSO) as stock solutions and further diluted to working concentrations.

4.10. Data analysis

Data are expressed as original traces or as mean ± SEM. All statistical analyses were carried out using the statistical software Origin 8.1. Treatment effects were statistically assessed using one-way ANOVA followed by the Tukey’s multiple comparison test. When the comparisons were limited to two means, paired or two-sample Student’s t-tests were performed. Error probabilities of P < 0.05 were considered statistical significant.

Supplementary Material

Supplementary Material

Acknowledgements

The authors thank Jie Jiang for her assistance for some ELISA and Western blotting experimentsand Dr. Donald Gill (Penn State College of Medicine) for providing Orai1-CFP.

Funding

The study is supported by NINDS R01NS117484, R01NS087033.

Abbreviations

TLR4

Toll-like receptor

SOCs

store-operated calcium channels

STIM1

stromal interaction molecule 1

STIM2

stromal interaction molecule 2

ER

endoplasmic reticulum

TG

thapsigargin

LPS

lipopolysaccharide

ER

endoplasmic reticulum

FCS

fetal calf serum

GFAP

glial fibrillary acidic protein

NF-κb

Nuclear factor kappa B

T NFα

Tumor necrosis factor alpha

IL6

Interleukin-6

DMEM

Dulbecco’s modified Eagle medium

CNS

central nervous system

PBS

Phosphate buffered saline

ELISA

enzymelinked immunosorbent assay

YM

YM-58483

PD

PD98059

SB

SB203580

SP

SP600125

HBSS

Hanks’ balanced salt solution

FBS

Fetal bovine serum

ANOVA

Analysis of variance

Footnotes

Declaration of Competing Interests

The authors declare that they have no competing financial interests.

Availability of data and materials

All material and datasets used in this manuscript will be made available to researchers on request.

References

  • [1].Toth AB, Hori K, Novakovic MM, Bernstein NG, Lambot L, Prakriya M, CRAC channels regulate astrocyte Ca(2+) signaling and gliotransmitter release to modulate hippocampal GABAergic transmission, Sci Signal, 12 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Zeng XN, Sun XL, Gao L, Fan Y, Ding JH, Hu G, Aquaporin-4 deficiency down-regulates glutamate uptake and GLT-1 expression in astrocytes, Mol Cell Neurosci, 34 (2007) 34–39. [DOI] [PubMed] [Google Scholar]
  • [3].van Putten M, Fahlke C, Kafitz KW, Hofmeijer J, Rose CR, Dysregulation of Astrocyte Ion Homeostasis and Its Relevance for Stroke-Induced Brain Damage, Int J Mol Sci, 22 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Theparambil SM, Hosford PS, Ruminot I, Kopach O, Reynolds JR, Sandoval PY, Rusakov DA, Barros LF, Gourine AV, Astrocytes regulate brain extracellular pH via a neuronal activity-dependent bicarbonate shuttle, Nat Commun, 11 (2020) 5073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Nortley R, Attwell D, Control of brain energy supply by astrocytes, Curr Opin Neurobiol, 47 (2017) 80–85. [DOI] [PubMed] [Google Scholar]
  • [6].Ghouili I, Bahdoudi S, Morin F, Amri F, Hamdi Y, Coly PM, Walet-Balieu ML, Leprince J, Zekri S, Vaudry H, Vaudry D, Castel H, Amri M, Tonon MC, Masmoudi-Kouki O, Endogenous Expression of ODN-Related Peptides in Astrocytes Contributes to Cell Protection Against Oxidative Stress: Astrocyte-Neuron Crosstalk Relevance for Neuronal Survival, Mol Neurobiol, 55 (2018) 4596–4611. [DOI] [PubMed] [Google Scholar]
  • [7].Dong Y, Benveniste EN, Immune function of astrocytes, Glia, 36 (2001) 180–190. [DOI] [PubMed] [Google Scholar]
  • [8].Hamby ME, Sofroniew MV, Reactive astrocytes as therapeutic targets for CNS disorders, Neurotherapeutics, 7 (2010) 494–506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Devinsky O, Vezzani A, Najjar S, De Lanerolle NC, Rogawski MA, Glia and epilepsy: excitability and inflammation, Trends Neurosci, 36 (2013) 174–184. [DOI] [PubMed] [Google Scholar]
  • [10].Brambilla L, Martorana F, Rossi D, Astrocyte signaling and neurodegeneration: new insights into CNS disorders, Prion, 7 (2013) 28–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Glass CK, Saijo K, Winner B, Marchetto MC, Gage FH, Mechanisms underlying inflammation in neurodegeneration, Cell, 140 (2010) 918–934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Giovannoni F, Quintana FJ, The Role of Astrocytes in CNS Inflammation, Trends Immunol, 41 (2020) 805–819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].McMahon SB, Malcangio M, Current challenges in glia-pain biology, Neuron, 64 (2009) 46–54. [DOI] [PubMed] [Google Scholar]
  • [14].Ji RR, Kawasaki Y, Zhuang ZY, Wen YR, Decosterd I, Possible role of spinal astrocytes in maintaining chronic pain sensitization: review of current evidence with focus on bFGF/JNK pathway, Neuron Glia Biol, 2 (2006) 259–269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Liu T, Han Q, Chen G, Huang Y, Zhao LX, Berta T, Gao YJ, Ji RR, Toll-like receptor 4 contributes to chronic itch, alloknesis, and spinal astrocyte activation in male mice, Pain, 157 (2016) 806–817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Watkins LR, Maier SF, Glia: a novel drug discovery target for clinical pain, Nat Rev Drug Discov, 2 (2003) 973–985. [DOI] [PubMed] [Google Scholar]
  • [17].Gao YJ, Xu ZZ, Liu YC, Wen YR, Decosterd I, Ji RR, The c-Jun N-terminal kinase 1 (JNK1) in spinal astrocytes is required for the maintenance of bilateral mechanical allodynia under a persistent inflammatory pain condition, Pain, 148 (2010) 309–319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Campolo M, Paterniti I, Siracusa R, Filippone A, Esposito E, Cuzzocrea S, TLR4 absence reduces neuroinflammation and inflammasome activation in Parkinson’s diseases in vivo model, Brain Behav Immun, 76 (2019) 236–247. [DOI] [PubMed] [Google Scholar]
  • [19].Crowley T, Fitzpatrick JM, Kuijper T, Cryan JF, O’Toole O, O’Leary OF, Downer EJ, Modulation of TLR3/TLR4 inflammatory signaling by the GABAB receptor agonist baclofen in glia and immune cells: relevance to therapeutic effects in multiple sclerosis, Front Cell Neurosci, 9 (2015) 284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Bruno K, Woller SA, Miller YI, Yaksh TL, Wallace M, Beaton G, Chakravarthy K, Targeting toll-like receptor-4 (TLR4)-an emerging therapeutic target for persistent pain states, Pain, 159 (2018) 1908–1915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Jin JJ, Kim HD, Maxwell JA, Li L, Fukuchi K, Toll-like receptor 4-dependent upregulation of cytokines in a transgenic mouse model of Alzheimer’s disease, J Neuroinflammation, 5 (2008) 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Calvo-Rodriguez M, Garcia-Rodriguez C, Villalobos C, Nunez L, Role of Toll Like Receptor 4 in Alzheimer’s Disease, Front Immunol, 11 (2020) 1588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Huck NA, Siliezar-Doyle J, Haight ES, Ishida R, Forman TE, Wu S, Shen H, Takemura Y, Clark JD, Tawfik VL, Temporal Contribution of Myeloid-Lineage TLR4 to the Transition to Chronic Pain: A Focus on Sex Differences, J Neurosci, 41 (2021) 4349–4365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Illias AM, Yu KJ, Hwang SH, Solis J, Zhang H, Velasquez JF, Cata JP, Dougherty PM, Dorsal root ganglion toll-like receptor 4 signaling contributes to oxaliplatin-induced peripheral neuropathy, Pain, (2021). [DOI] [PubMed] [Google Scholar]
  • [25].Sorge RE, LaCroix-Fralish ML, Tuttle AH, Sotocinal SG, Austin JS, Ritchie J, Chanda ML, Graham AC, Topham L, Beggs S, Salter MW, Mogil JS, Spinal cord Toll-like receptor 4 mediates inflammatory and neuropathic hypersensitivity in male but not female mice, J Neurosci, 31 (2011) 15450–15454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Min H, Lee H, Lim H, Jang YH, Chung SJ, Lee CJ, Lee SJ, TLR4 enhances histamine-mediated pruritus by potentiating TRPV1 activity, Mol Brain, 7 (2014) 59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Parnis J, Montana V, Delgado-Martinez I, Matyash V, Parpura V, Kettenmann H, Sekler I, Nolte C, Mitochondrial exchanger NCLX plays a major role in the intracellular Ca2+ signaling, gliotransmission, and proliferation of astrocytes, J Neurosci, 33 (2013) 7206–7219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Cheli VT, Santiago Gonzalez DA, Smith J, Spreuer V, Murphy GG, Paez PM, L-type voltage-operated calcium channels contribute to astrocyte activation In vitro, Glia, 64 (2016) 1396–1415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Gomez-Gonzalo M, Martin-Fernandez M, Martinez-Murillo R, Mederos S, Hernandez-Vivanco A, Jamison S, Fernandez AP, Serrano J, Calero P, Futch HS, Corpas R, Sanfeliu C, Perea G, Araque A, Neuron-astrocyte signaling is preserved in the aging brain, Glia, 65 (2017) 569–580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Zorec R, Araque A, Carmignoto G, Haydon PG, Verkhratsky A, Parpura V, Astroglial excitability and gliotransmission: an appraisal of Ca2+ as a signalling route, ASN Neuro, 4 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Gao YJ, Zhang L, Ji RR, Spinal injection of TNF-alpha-activated astrocytes produces persistent pain symptom mechanical allodynia by releasing monocyte chemoattractant protein-1, Glia, 58 (2010) 1871–1880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Schappe MS, Szteyn K, Stremska ME, Mendu SK, Downs TK, Seegren PV, Mahoney MA, Dixit S, Krupa JK, Stipes EJ, Rogers JS, Adamson SE, Leitinger N, Desai BN, Chanzyme TRPM7 Mediates the Ca(2+) Influx Essential for Lipopolysaccharide-Induced Toll-Like Receptor 4 Endocytosis and Macrophage Activation, Immunity, 48 (2018) 59–74 e55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Lian H, Zheng H, Signaling pathways regulating neuron-glia interaction and their implications in Alzheimer’s disease, J Neurochem, 136 (2016) 475–491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Carmignoto G, Haydon PG, Astrocyte calcium signaling and epilepsy, Glia, 60 (2012) 1227–1233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Parekh AB, Putney JW Jr, Store-operated calcium channels, Physiological reviews, 85 (2005) 757–810. [DOI] [PubMed] [Google Scholar]
  • [36].Tojyo Y, Morita T, Nezu A, Tanimura A, Key components of store-operated Ca2+ entry in non-excitable cells, J Pharmacol Sci, 125 (2014) 340–346. [DOI] [PubMed] [Google Scholar]
  • [37].Shaw PJ, Feske S, Regulation of lymphocyte function by ORAI and STIM proteins in infection and autoimmunity, The Journal of physiology, 590 (2012) 4157–4167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Vaeth M, Eckstein M, Shaw PJ, Kozhaya L, Yang J, Berberich-Siebelt F, Clancy R, Unutmaz D, Feske S, Store-Operated Ca(2+) Entry in Follicular T Cells Controls Humoral Immune Responses and Autoimmunity, Immunity, 44 (2016) 1350–1364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Zhang I, Hu H, Store-Operated Calcium Channels in Physiological and Pathological States of the Nervous System, Front Cell Neurosci, 14 (2020) 600758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [40].Lunz V, Romanin C, Frischauf I, STIM1 activation of Orai1, Cell Calcium, 77 (2019) 29–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Berry CT, May MJ, Freedman BD, STIM- and Orai-mediated calcium entry controls NF-kappaB activity and function in lymphocytes, Cell Calcium, 74 (2018) 131–143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Liu X, Berry CT, Ruthel G, Madara JJ, MacGillivray K, Gray CM, Madge LA, McCorkell KA, Beiting DP, Hershberg U, May MJ, Freedman BD, T Cell Receptor-induced Nuclear Factor kappaB (NF-kappaB) Signaling and Transcriptional Activation Are Regulated by STIM1- and Orai1-mediated Calcium Entry, J Biol Chem, 291 (2016) 8440–8452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Sakuragi S, Niwa F, Oda Y, Mikoshiba K, Bannai H, Astroglial Ca(2+) signaling is generated by the coordination of IP3R and store-operated Ca(2+) channels, Biochem Biophys Res Commun, 486 (2017) 879–885. [DOI] [PubMed] [Google Scholar]
  • [44].Gao X, Xia J, Munoz FM, Manners MT, Pan R, Meucci O, Dai Y, Hu H, STIMs and Orai1 regulate cytokine production in spinal astrocytes, J Neuroinflammation, 13 (2016) 126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Zhou X, Ye Y, Sun Y, Li X, Wang W, Privratsky B, Tan S, Zhou Z, Huang C, Wei YQ, Birnbaumer L, Singh BB, Wu M, Transient Receptor Potential Channel 1 Deficiency Impairs Host Defense and Proinflammatory Responses to Bacterial Infection by Regulating Protein Kinase Calpha Signaling, Mol Cell Biol, 35 (2015) 2729–2739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [46].Yamashiro K, Sasano T, Tojo K, Namekata I, Kurokawa J, Sawada N, Suganami T, Kamei Y, Tanaka H, Tajima N, Utsunomiya K, Ogawa Y, Furukawa T, Role of transient receptor potential vanilloid 2 in LPS-induced cytokine production in macrophages, Biochem Biophys Res Commun, 398 (2010) 284–289. [DOI] [PubMed] [Google Scholar]
  • [47].Geng J, Shi Y, Zhang J, Yang B, Wang P, Yuan W, Zhao H, Li J, Qin F, Hong L, Xie C, Deng X, Sun Y, Wu C, Chen L, Zhou D, TLR4 signalling via Piezo1 engages and enhances the macrophage mediated host response during bacterial infection, Nat Commun, 12 (2021) 3519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [48].Vaeth M, Zee I, Concepcion AR, Maus M, Shaw P, Portal-Celhay C, Zahra A, Kozhaya L, Weidinger C, Philips J, Unutmaz D, Feske S, Ca2+ Signaling but Not Store-Operated Ca2+ Entry Is Required for the Function of Macrophages and Dendritic Cells, J Immunol, 195 (2015) 1202–1217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [49].Vig M, DeHaven WI, Bird GS, Billingsley JM, Wang H, Rao PE, Hutchings AB, Jouvin M-H, Putney JW, Kinet J-P, Defective mast cell effector functions in mice lacking the CRACM1 pore subunit of store-operated calcium release–activated calcium channels, Nature immunology, 9 (2008) 89–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [50].Davis FM, Janoshazi A, Janardhan KS, Steinckwich N, D’Agostin DM, Petranka JG, Desai PN, Roberts-Thomson SJ, Bird GS, Tucker DK, Essential role of Orai1 store-operated calcium channels in lactation, Proceedings of the National Academy of Sciences, 112 (2015) 5827–5832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [51].Dou Y, Xia J, Gao R, Gao X, Munoz FM, Wei D, Tian Y, Barrett JE, Ajit S, Meucci O, Orai1 plays a crucial role in central sensitization by modulating neuronal excitability, Journal of Neuroscience, 38 (2018) 887–900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [52].Matsunaga N, Tsuchimori N, Matsumoto T, Ii M, TAK-242 (resatorvid), a small-molecule inhibitor of Toll-like receptor (TLR) 4 signaling, binds selectively to TLR4 and interferes with interactions between TLR4 and its adaptor molecules, Mol Pharmacol, 79 (2011) 34–41. [DOI] [PubMed] [Google Scholar]
  • [53].Liu X, Yao M, Li N, Wang C, Zheng Y, Cao X, CaMKII promotes TLR-triggered proinflammatory cytokine and type I interferon production by directly binding and activating TAK1 and IRF3 in macrophages, Blood, 112 (2008) 4961–4970. [DOI] [PubMed] [Google Scholar]
  • [54].Kandasamy K, Bezavada L, Escue RB, Parthasarathi K, Lipopolysaccharide induces endoplasmic store Ca2+-dependent inflammatory responses in lung microvessels, PLoS One, 8 (2013) e63465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [55].Gorina R, Font-Nieves M, Marquez-Kisinousky L, Santalucia T, Planas AM, Astrocyte TLR4 activation induces a proinflammatory environment through the interplay between MyD88-dependent NFkappaB signaling, MAPK, and Jak1/Stat1 pathways, Glia, 59 (2011) 242–255. [DOI] [PubMed] [Google Scholar]
  • [56].Zhou CH, Zhu YZ, Zhao PP, Xu CM, Zhang MX, Huang H, Li J, Liu L, Wu YQ, Propofol Inhibits Lipopolysaccharide-Induced Inflammatory Responses in Spinal Astrocytes via the Toll-Like Receptor 4/MyD88-Dependent Nuclear Factor-kappaB, Extracellular Signal-Regulated Protein Kinases1/2, and p38 Mitogen-Activated Protein Kinase Pathways, Anesth Analg, 120 (2015) 1361–1368. [DOI] [PubMed] [Google Scholar]
  • [57].Sakai J, Cammarota E, Wright JA, Cicuta P, Gottschalk RA, Li N, Fraser IDC, Bryant CE, Lipopolysaccharide-induced NF-kappaB nuclear translocation is primarily dependent on MyD88, but TNFalpha expression requires TRIF and MyD88, Sci Rep, 7 (2017) 1428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [58].Vallabhapurapu S, Karin M, Regulation and function of NF-kappaB transcription factors in the immune system, Annu Rev Immunol, 27 (2009) 693–733. [DOI] [PubMed] [Google Scholar]
  • [59].Haydar D, Cory TJ, Birket SE, Murphy BS, Pennypacker KR, Sinai AP, Feola DJ, Azithromycin Polarizes Macrophages to an M2 Phenotype via Inhibition of the STAT1 and NF-kappaB Signaling Pathways, J Immunol, 203 (2019) 1021–1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [60].Lanfranco MF, Sepulveda J, Kopetsky G, Rebeck GW, Expression and secretion of apoE isoforms in astrocytes and microglia during inflammation, Glia, 69 (2021) 1478–1493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [61].Morimoto K, Kitano T, Eguchi R, Otsuguro K, Bidirectional modulation of TNF-alpha transcription via alpha- and beta-adrenoceptors in cultured astrocytes from rat spinal cord, Biochem Biophys Res Commun, 528 (2020) 78–84. [DOI] [PubMed] [Google Scholar]
  • [62].Shi-Lin D, Yuan X, Zhan S, Luo-Jia T, Chao-Yang T, Trametinib, a novel MEK kinase inhibitor, suppresses lipopolysaccharide-induced tumor necrosis factor (TNF)-alpha production and endotoxin shock, Biochem Biophys Res Commun, 458 (2015) 667–673. [DOI] [PubMed] [Google Scholar]
  • [63].Huang YN, Ho YJ, Lai CC, Chiu CT, Wang JY, 1,25-Dihydroxyvitamin D3 attenuates endotoxin-induced production of inflammatory mediators by inhibiting MAPK activation in primary cortical neuron-glia cultures, J Neuroinflammation, 12 (2015) 147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [64].Dou Y, Xia J, Gao R, Gao X, Munoz FM, Wei D, Tian Y, Barrett JE, Ajit S, Meucci O, Putney JW Jr., Dai Y, Hu H, Orai1 Plays a Crucial Role in Central Sensitization by Modulating Neuronal Excitability, J Neurosci, 38 (2018) 887–900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [65].Yang C, Mo X, Lv J, Liu X, Yuan M, Dong M, Li L, Luo X, Fan X, Jin Z, Liu Z, Liu J, Lipopolysaccharide enhances FcepsilonRI-mediated mast cell degranulation by increasing Ca2+ entry through store-operated Ca2+ channels: implications for lipopolysaccharide exacerbating allergic asthma, Exp Physiol, 97 (2012) 1315–1327. [DOI] [PubMed] [Google Scholar]
  • [66].Hobbs S, Reynoso M, Geddis AV, Mitrophanov AY, Matheny RW Jr., LPS-stimulated NF-kappaB p65 dynamic response marks the initiation of TNF expression and transition to IL-10 expression in RAW 264.7 macrophages, Physiol Rep, 6 (2018) e13914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [67].Xu F, Chen L, Zhao X, Zhong H, Cui L, Jiang L, Huang H, Li L, Zeng S, Li M, Interaction of Wip1 and NF-kappaB regulates neuroinflammatory response in astrocytes, Inflamm Res, 66 (2017) 1011–1019. [DOI] [PubMed] [Google Scholar]
  • [68].Munoz FM, Patel PA, Gao X, Mei Y, Xia J, Gilels S, Hu H, Reactive oxygen species play a role in P2X7 receptor-mediated IL-6 production in spinal astrocytes, Purinergic Signal, 16 (2020) 97–107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [69].Benfenati V, Caprini M, Dovizio M, Mylonakou MN, Ferroni S, Ottersen OP, Amiry-Moghaddam M, An aquaporin-4/transient receptor potential vanilloid 4 (AQP4/TRPV4) complex is essential for cell-volume control in astrocytes, Proc Natl Acad Sci U S A, 108 (2011) 2563–2568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [70].Reyes RC, Verkhratsky A, Parpura V, TRPC1-mediated Ca2+ and Na+ signalling in astroglia: differential filtering of extracellular cations, Cell Calcium, 54 (2013) 120–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [71].Turovsky E, Theparambil SM, Kasymov V, Deitmer JW, Del Arroyo AG, Ackland GL, Corneveaux JJ, Allen AN, Huentelman MJ, Kasparov S, Marina N, Gourine AV, Mechanisms of CO2/H+ Sensitivity of Astrocytes, J Neurosci, 36 (2016) 10750–10758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [72].Ibanez I, Bartolome-Martin D, Piniella D, Gimenez C, Zafra F, Activity dependent internalization of the glutamate transporter GLT-1 requires calcium entry through the NCX sodium/calcium exchanger, Neurochem Int, 123 (2019) 125–132. [DOI] [PubMed] [Google Scholar]
  • [73].Shirakawa H, Katsumoto R, Iida S, Miyake T, Higuchi T, Nagashima T, Nagayasu K, Nakagawa T, Kaneko S, Sphingosine-1-phosphate induces Ca(2+) signaling and CXCL1 release via TRPC6 channel in astrocytes, Glia, 65 (2017) 1005–1016. [DOI] [PubMed] [Google Scholar]
  • [74].Zhu T, Zhao Y, Hu H, Zheng Q, Luo X, Ling Y, Ying Y, Shen Z, Jiang P, Shu Q, TRPM2 channel regulates cytokines production in astrocytes and aggravates brain disorder during lipopolysaccharide-induced endotoxin sepsis, Int Immunopharmacol, 75 (2019) 105836. [DOI] [PubMed] [Google Scholar]
  • [75].Vanden Abeele F, Bidaux G, Gordienko D, Beck B, Panchin YV, Baranova AV, Ivanov DV, Skryma R, Prevarskaya N, Functional implications of calcium permeability of the channel formed by pannexin 1, J Cell Biol, 174 (2006) 535–546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [76].Ling ZM, Wang Q, Ma Y, Xue P, Gu Y, Cao MH, Wei ZY, Astrocyte Pannexin 1 Suppresses LPS-Induced Inflammatory Responses to Protect Neuronal SH-SY5Y Cells, Front Cell Neurosci, 15 (2021) 710820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [77].Nakajima H, Fujita S, Kakae M, Nagayasu K, Oh-Hora M, Shirakawa H, Kaneko S, Orai2 channel regulates prostaglandin E2 production in TNFalpha/IL1alpha-stimulated astrocytes, Glia, (2022). [DOI] [PubMed] [Google Scholar]
  • [78].Vaeth M, Yang J, Yamashita M, Zee I, Eckstein M, Knosp C, Kaufmann U, Karoly Jani P, Lacruz RS, Flockerzi V, Kacskovics I, Prakriya M, Feske S, ORAI2 modulates store-operated calcium entry and T cell-mediated immunity, Nat Commun, 8 (2017) 14714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [79].Tsvilovskyy V, Solis-Lopez A, Schumacher D, Medert R, Roers A, Kriebs U, Freichel M, Deletion of Orai2 augments endogenous CRAC currents and degranulation in mast cells leading to enhanced anaphylaxis, Cell Calcium, 71 (2018) 24–33. [DOI] [PubMed] [Google Scholar]
  • [80].Stegner D, Hofmann S, Schuhmann MK, Kraft P, Herrmann AM, Popp S, Hohn M, Popp M, Klaus V, Post A, Kleinschnitz C, Braun A, Meuth SG, Lesch KP, Stoll G, Kraft R, Nieswandt B, Loss of Orai2-Mediated Capacitative Ca(2+) Entry Is Neuroprotective in Acute Ischemic Stroke, Stroke, 50 (2019) 3238–3245. [DOI] [PubMed] [Google Scholar]
  • [81].Wei D, Mei Y, Xia J, Hu H, Orai1 and Orai3 Mediate Store-Operated Calcium Entry Contributing to Neuronal Excitability in Dorsal Root Ganglion Neurons, Front Cell Neurosci, 11 (2017) 400. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material

Data Availability Statement

All material and datasets used in this manuscript will be made available to researchers on request.

RESOURCES