Abstract
The objective of the current experiment was to investigate the effect of dietary concentrations of ME and neutral detergent fiber (NDF) on productive performance, egg quality, fatty liver incidence, and hepatic fatty acid metabolism in aged laying hens. A total of three hundred twenty 75-wk-old Hy-Line Brown laying hens were allotted to 1 of 4 dietary treatments with 8 replicates. Each replicate consisted of 10 consecutive cages with 1 hen per cage. The experiment was conducted using a completely randomized design with 2 × 2 factorial arrangement consisting of 2 levels of ME (normal [commercially recommended AMEn levels; 2,730 kcal/kg] and low [50 kcal/kg reduction in AMEn; 2,680 kcal/kg]) and 2 levels of NDF (low [9.01 and 9.61%; normal-ME and low-ME diets, respectively] and high [12.57 and 13.42%; normal-ME and low-ME diets, respectively]) in the diet. The diets and water were provided to hens on an ad libitum basis for 12 wk. Results indicated that no interactions between dietary concentrations of ME and NDF were observed for all measurements except for egg yolk color, eggshell thickness, and 2 hepatic gene expressions (i.e., carnitine palmitoyl transferase 1A and malic enzyme). For the main effects, increasing NDF concentrations in diets increased (P < 0.05) feed intake without affecting other productive performance. Hens fed normal-ME and high-NDF diets showed the darkest (P < 0.05) egg yolk color among those fed treatment diets, showing an interaction (P < 0.05). Increasing NDF concentrations in low-ME diets did not influence eggshell thickness, but those in normal-ME diets increased eggshell thickness in laying hens, showing an interaction (P < 0.05). For the main effects, increasing concentrations of dietary NDF or ME reduced (P < 0.05) hepatic fat concentrations with decreasing expressions in several genes related to fatty acid synthesis. In conclusion, increasing NDF concentrations in commercially-recommended ME diets decrease hepatic fat concentrations in aged laying hens, and therefore, may have a preventative effect on the fatty liver development in aged laying hens.
Key words: aged laying hen, egg quality, fatty liver incidence, metabolizable energy, neutral detergent fiber
INTRODUCTION
Laying hens are typically raised until 70 to 80 wk of age in the commercial situation (Bain et al., 2016). The reduction in egg production and egg quality as hens become aged is one of the major reasons for depopulation and introduction of new flocks (England and Ruhnke, 2020). Therefore, extending the production period by improving egg production and quality in aged laying hens is necessary to increase economic benefits and sustainability in the layer industry (England and Ruhnke, 2020).
Fatty liver hemorrhagic syndrome (FLHS) is known to deteriorate the productive performance and egg quality in laying hens (Galea, 2011). Excessive fat accumulation structurally weakens the liver and causes massive hepatic hemorrhage, which leads to various health problems and even death (Shini et al., 2019). The FLHS is the most significant reason of fatalities in caged laying hens (Shini et al., 2019). In particular, FLHS occurs more frequently in aged laying hens than in younger hens (Dong and Tong, 2019). Therefore, the prevention of hepatic fat accumulation is essential to improve egg production and health in aged laying hens, which would subsequently enhance economic outcomes in egg production.
The lipid metabolism, especially for fat synthesis, in poultry occurs in the liver. Therefore, impaired fat utilization and increased fat synthesis in the liver can facilitate excessive fat accumulation, leading to the FLHS development (Zaefarian et al., 2019). It is appreciated that FLHS is caused by various factors, including internal and external conditions, and in particular, nutritional factor such as high energy and nutrients in diets significantly contributes to FLHS development (Gao et al., 2019; Zhu et al., 2021). Increasing concentrations of dietary fiber in layer diets may be a potential means to decrease the incidence of FLHS because of its low energy value and possible antinutritional effects (Desbruslais et al., 2021). It is reported that increasing concentrations of dietary fiber decreased the liver weight and fat concentrations in growing chickens (Akiba and Matsumoto, 1978). Moreover, dietary fiber is known to have a positive effect on digestive system development, immune function, and microbial balance in poultry (Jha et al., 2019; Okrathok et al., 2022). However, information regarding the interactive effect of different concentrations of energy and fiber in diets on hepatic fat metabolism is lacking in laying hens, especially for aged laying hens.
The objective of the current experiment was to investigate the effect of different concentrations of ME and neutral detergent fiber (NDF) in diets on productive performance, egg quality, fatty liver incidence, and hepatic fat metabolism in aged laying hens.
MATERIALS AND METHODS
Birds, Diets, and Experimental Design
All experimental procedures were reviewed and approved by the Animal Care and the Use Committee at Chung-Ang University.
A total of three hundred twenty 75-wk-old Hy-Line Brown laying hens (initial BW = 1.98 ± 0.02 kg) with similar productive performance were allotted to 1 of 4 dietary treatments with 8 replicates. Each replicate comprised 10 consecutive cages with 1 hen per cage (24 × 36 × 39 cm), such that the density was guaranteed to be approximately 0.09 m2/hen. The experiment was conducted using a completely randomized design with 2 × 2 factorial arrangement consisting of 2 concentrations of ME (normal and low) and 2 concentrations of NDF in diets. A normal-ME diet (2,730 kcal/kg AMEn) was formulated according to the recommendations of the Hy-Line Brown Management Guide (2016; Table 1). The low-ME diet was developed by reducing the AMEn of the normal-ME diet by 50 kcal/kg (2,680 kcal/kg AMEn). Within each ME level, the high-NDF diet (12.57 and 13.42% NDF for normal-ME and low-ME diets, respectively) was produced to contain 40% higher NDF concentrations than the low-NDF diet (9.01 and 9.61% NDF for normal-ME and low-ME diets, respectively). Different concentrations of NDF were achieved by modifying inclusion levels of wheat bran, distillers dried grains with solubles (DDGS), rice bran, sesame oil meal, and corn germ meal. The NDF and acid detergent fiber (ADF) concentrations in the feed were analyzed using an ANKOM 200 Fiber Analyzer (ANKOM Technology, Macedon, NY) based on the modified method described by Van Soest et al. (1991).
Table 1.
Composition and nutrient concentrations of experimental diets.
| 2,680 kcal ME/kg (Low-ME) |
2,730 kcal ME/kg (Normal-ME) |
|||
|---|---|---|---|---|
| Items | Low NDF | High NDF | Low NDF | High NDF |
| Ingredients (%) | ||||
| Corn | 62.43 | 52.44 | 63.30 | 53.29 |
| Soybean meal, 46% CP | 18.50 | 10.65 | 18.94 | 10.90 |
| Corn gluten meal | 2.43 | 2.84 | 2.50 | 3.96 |
| Wheat | 0.70 | 0.53 | 0.50 | - |
| Tallow | - | 1.03 | 0.70 | 1.40 |
| Wheat bran | 1.80 | 6.50 | - | 5.51 |
| DDGS | - | 5.00 | - | 4.02 |
| Rice bran | - | - | - | 1.94 |
| Seasame oil meal | - | 2.20 | - | 1.16 |
| Corn germ meal | - | 5.00 | - | 4.00 |
| Monodicalcium phosphate | 1.21 | 1.01 | 1.21 | 1.03 |
| Limestone | 11.10 | 11.21 | 11.10 | 11.21 |
| 54% L-Lysine H2SO4 | 0.15 | 0.36 | 0.14 | 0.36 |
| 98.5% L-Threonine | 0.02 | 0.06 | 0.02 | 0.06 |
| Liquid DL-Methionine | 0.17 | 0.17 | 0.18 | 0.17 |
| L-tryptophan | 0.04 | 0.08 | 0.01 | 0.09 |
| Celite | 0.55 | 0.02 | 0.50 | - |
| NaCl | 0.30 | 0.30 | 0.30 | 0.30 |
| 50% Choline | 0.10 | 0.10 | 0.10 | 0.10 |
| Antioxidant | 0.05 | 0.05 | 0.05 | 0.05 |
| NaHCO3 | 0.15 | 0.15 | 0.15 | 0.15 |
| Vitamin premix1 | 0.15 | 0.15 | 0.15 | 0.15 |
| Mineral premix2 | 0.15 | 0.15 | 0.15 | 0.15 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 |
| Calculated energy and nutrient concentration | ||||
| AMEn, kcal/kg | 2,680 | 2,680 | 2,730 | 2,730 |
| CP, % | 15.00 | 15.00 | 15.00 | 15.00 |
| Lysine, % | 0.78 | 0.78 | 0.78 | 0.78 |
| Methionine + Cysteine, % | 0.65 | 0.65 | 0.65 | 0.65 |
| Methionine, % | 0.39 | 0.39 | 0.39 | 0.39 |
| Threonine, % | 0.57 | 0.57 | 0.57 | 0.57 |
| Tryptophan, % | 0.17 | 0.17 | 0.17 | 0.17 |
| Total Calcium, % | 4.40 | 4.40 | 4.40 | 4.40 |
| Available phosphorus, % | 0.33 | 0.33 | 0.33 | 0.33 |
| Crude fat, % | 2.91 | 4.34 | 3.57 | 4.81 |
| NDF, % | 9.61 | 13.42 | 9.01 | 12.57 |
| ADF, % | 3.23 | 4.22 | 3.06 | 3.97 |
| Analyzed nutrient concentration | ||||
| NDF, % | 9.35 | 12.94 | 8.78 | 12.10 |
| ADF, % | 3.05 | 4.11 | 2.85 | 3.73 |
Abbreviations: DDGS, distillers dried grains with solubles; NDF, neutral detergent fiber; ADF, acid detergent fiber.
Provided per kg of the complete diet: vitamin A, 10,000 IU (retinyl acetate); vitamin D3, 4,500 IU (cholecalciferol); vitamin K3, 3.0 mg (menadione dimethylpyrimidine); vitamin B1, 2.50 mg; vitamin B2, 6.50 mg; vitamin B6, 3.20 mg; vitamin B12, 18.0 µg; biotin, 180 µg; folic acid, 1.9 mg; niacin, 60 mg.
Provided per kg of the complete diet: cobalt, 1,200 µg (CoSO4); copper, 19.0 mg (CuSO4); iron, 72 mg (FeSO4); iodine, 1.5 mg (Ca[IO3]2); manganese, 144.0 mg (MnO); selenium, 360 µg (Na2SeO3); zinc, 120 mg (ZnSO4).
However, other nutrient concentrations in all treatment diets were equalized and met the requirement estimates for Hy-Line Brown laying hens (Hy-Line, 2016). All hens were raised according to the recommendation of environmental management in Hy-Line Brown laying hens (Hy-line, 2016). The experimental diets and water were provided to hens on an ad libitum basis for 12 wk. The average room temperature and relative humidity were maintained at approximately 21.6 ± 2.3°Cand 55.5 ± 10.4%, respectively. The lighting was provided for 16 h per d throughout the experiment.
Productive Performance and Egg Quality
Productive performance including hen-day egg production, egg weight, egg mass, and broken and shell-less egg production rate was recorded daily. The mortality was recorded daily throughout the experiment. Feed intake (FI) and feed conversion ratio (FCR) were calculated every 4 wk. The FCR was calculated by dividing FI with egg mass. The egg mass was calculated by multiplying the egg production rate (%) by the average weight of eggs (g) and divided by 100. The data for productive performance were then summarized for 12 wk from 75 to 86 wk of age.
Egg quality was assessed using randomly collected samples of 10 eggs per replicate with 5 eggs per day for 2 consecutive day at 4 wk intervals during the 12-wk feeding trial. Eggshell color was evaluated by using an eggshell color fan (Samyangsa, Kangwon-do, Republic of Korea; where on a scale of 1 to 15, with 1 being a very light and pale and 15 being a very dark brown). Eggshell strength, eggshell thickness (without shell membrane), egg yolk color, and Haugh unit were determined using a digital egg tester (DET-6000, Nabel Co., Ltd., Kyoto, Japan), based on the detailed procedure reported previously (Kim et al., 2022).
Sample Collection
At the end of the experiment (i.e., 86 wk of age), 1 hen per replicate with a BW close to the average of each replicate (i.e., 8 birds per treatment) was euthanized by CO2 asphyxiation, and then promptly dissected.
The liver tissue was used for the analysis of fatty liver incidence and expression of genes related to fatty acid synthesis and oxidation. Regarding the fatty liver color score, the liver attached on the body was pictured to measure the subjective fatty liver color score using a scale from 1 to 5 (1 = dark red; 5 = light yellowish red). The liver hemorrhagic score was also analyzed using a scale from 0 to 5 (0 = normal liver; 5 = large and massive hemorrhages; Diaz et al., 1999; Choi et al., 2012). These subjective measurements were taken by 3 investigators using a blind test. The standards for fatty liver color and liver hemorrhagic scores were established based on pictures of the liver of laying hen (Choi et al., 2012). In addition, the Commission Internationale de l'Eclairage (CIE) color scale for the lightness (L*), redness (a*), and yellowness (b*) were also measured using a colorimeter (model CR-10, Konica Minolta, Tokyo, Japan). After the liver was pictured and dissected, then its weight was measured for the relative liver weight to total BW. The small pieces of the liver were then taken from the middle portion of the liver to the 1.7-mL microtube and immediately transferred to a liquid nitrogen, and stored at –80°C for the analyses of total fat concentrations and expression levels of genes related to fatty acid synthesis and oxidation. Total fat concentrations in the liver were analyzed using the acid-hydrolyzed ether extraction (method 996.01; AOAC, 2007).
The spleen, crop, proventriculus, gizzard, small intestine, and large intestine were also collected, and the content of each organ was washed with distilled water and then weighed to measure the relative organ weight as a percentage of total BW (Pitargue et al., 2019).
Analyses of Gene Expression Related to Fatty Acid Synthesis and Oxidation Metabolism
The expression levels of genes related to fatty acid synthesis and oxidation in the liver were analyzed using the modified method of Pitargue et al. (2019). In short, RNA from the liver tissue samples was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). Following extraction, 2 μg of diluted RNA was reverse-transcribed to cDNA by using the RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA), according to manufacturer's instructions, and the cDNA was stored at −20°C until further analysis.
Quantitative real-time PCR (qRT-PCR) was performed using CFX Connect Real-time PCR Detection System (Bio Rad Laboratories, Hercules, CA). The primers of the selected genes (i.e., carnitine palmitoyltransferase 1A, CPT1A; peroxisome proliferator-activated receptor-α, PPAR-α; fatty acid synthase, FASN; sterol response element-binding protein 1, SREBP-1; acetyl-CoA carboxylase, ACC; stearoyl-CoA desaturase, SCD; peroxisome proliferator-activated receptor-γ, PPAR-γ; malic enzyme) for fatty acid oxidation and synthesis were produced. The primer sequences are listed in Table 2. Thermal conditions for performing qRT-PCR are as follows: initial incubation at 95°C (2 min); 40 cycles of denaturation at 95°C (30 s), annealing at the annealing temperature for each primer (30 s), and extension at 72°C (30 s); and termination by final incubation at dissociation temperatures of 95°C (10 s), 65°C (60 s), 97°C (1 s), and 37°C (30 s). The relative quantification of gene-specific expression was calculated using the 2−ΔΔCt method after normalization to the gene expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The gene expression analysis was conducted at the BT research faility center, Chung-Ang University.
Table 2.
Primers used for quantitative RT-PCR.
| Primer name1 | Primer sequence2 (5′-3′) | Product size (bp) | GenBank accession number |
|---|---|---|---|
| GAPDH | F: tgctgcccagaacatcatcc | 142 | NM_204305 |
| R: acggcaggtcaggtcaacaa | |||
| CPT1A | F: tctcatgctttggaaagaa | 147 | NM_001012898 |
| R: attcgctgttcagaagagtt | |||
| PPAR-α | F: gtaagctctcagaaactttgtt | 145 | NM_001001464 |
| R: ccgctttccataatctgttc | |||
| FASN | F:ttcccaaaaagggatcaaca | 132 | NM_205155.3 |
| R: agttcttcagagcatcgttt | |||
| SREBP-1 | F: gccctctgtgcctttgtcttc | 130 | AY_029224 |
| R: actcagccatgatgcttcttcc | |||
| ACC | F: aatggcagctttggaggtgt | 117 | NM_205505 |
| R: tctgtttgggtgggaggtg | |||
| SCD | F: gatactacaagccctcagtg | 132 | NM_204890 |
| R: cattgagccctaaggtgtag | |||
| PPAR-γ | F: ccagcgacatcgaccagtt | 145 | AF_163811 |
| R: ggtgatttgtctgtcgtctttcc | |||
| Malic enzyme | F: tgccagcattacggtttagc | 175 | NM_204303 |
| R: ccattccataacagccaaggtc |
GAPDH, glyceraldehyde-3-phosphate; CPT1A, carnitine palmitoyl transferase 1A; PPAR-α, peroxisome proliferator-activated receptor-α; FASN, fatty acid synthase; SPEBP-1, sterol response element-binding protein 1; ACC, acetyl-CoA carboxylase; SCD, stearoyl-CoA desaturase; PPAR-γ, peroxisome proliferator-activated receptor-γ.
F, forward; R, reverse.
Statistical Analysis
All data were analyzed by ANOVA as a completely randomized design using the PROC MIXED procedure (SAS Institute Inc., Cary, NC). Each replicate was considered an experimental unit. The model included the effects of dietary levels of ME, NDF, and their interaction. All data were checked for normal distribution and outliers using the UNIVARIATE procedure of SAS (Steel et al., 1997). The LSMEANS procedure was used to calculate the treatment means and the PDIFF option was used to separate the means if the difference was significant. In order to adjust individual variations in productive performance and egg quality among aged hens at the start of the experiment, pre-trial productive performance and egg quality values were determined and used as the covariance in the statistical model. The statistical significance was set at P < 0.05.
RESULTS
Productive Performance and Egg Quality
No interactions between dietary levels of ME and NDF were observed for all productive performance including hen-day egg production, egg weight, broken and shell-less egg production, egg mass, FI, and FCR in aged laying hens (Table 3). For the main effects, dietary concentrations of ME did not affect all productive performance. However, feeding high-NDF diets to aged hens increased (P < 0.05) FI than feeding low-NDF diets, regardless of dietary concentrations of ME.
Table 3.
Effect of dietary concentrations of ME and neutral detergent fiber (NDF) on productive performance of aged laying hens.1
| Productive performance |
|||||||
|---|---|---|---|---|---|---|---|
| Item | Hen-day egg production (%) | EW (g) | Broken and shell-less egg (%) | EM (g/hen/d)2 | FI (g/hen/d) | FCR (g/g) | |
| ME3 | NDF4 | ||||||
| Low | Low | 88.5 | 65.8 | 0.25 | 58.2 | 131 | 2.25 |
| High | 88.1 | 65.6 | 0.25 | 58.1 | 133 | 2.29 | |
| Normal | Low | 88.5 | 66.0 | 0.18 | 58.5 | 130 | 2.23 |
| High | 88.4 | 66.0 | 0.19 | 58.4 | 132 | 2.26 | |
| SEM (n = 8) | 1.37 | 0.52 | 0.098 | 0.85 | 0.8 | 0.030 | |
| Main effect | |||||||
| ME | |||||||
| Low | 88.3 | 65.9 | 0.25 | 58.2 | 132 | 2.27 | |
| Normal | 88.5 | 66.0 | 0.18 | 58.5 | 131 | 2.25 | |
| SEM (n = 16) | 1.04 | 0.37 | 0.091 | 0.62 | 0.6 | 0.020 | |
| NDF | |||||||
| Low | 88.5 | 65.9 | 0.21 | 58.4 | 131 | 2.24 | |
| High | 88.3 | 66.0 | 0.22 | 58.3 | 133 | 2.28 | |
| SEM (n = 16) | 1.01 | 0.38 | 0.085 | 0.62 | 0.6 | 0.020 | |
| Effect (P-value) | |||||||
| ME | 0.914 | 0.815 | 0.154 | 0.724 | 0.389 | 0.418 | |
| NDF | 0.871 | 0.967 | 0.921 | 0.923 | 0.023 | 0.225 | |
| ME × NDF | 0.889 | 0.909 | 0.913 | 0.994 | 0.716 | 0.864 | |
Abbreviations: EW, egg weight; EM, egg mass; FI, feed intake; FCR, feed conversion ratio.
Data are least squares means of 8 observations per treatment. The data for productive performance were then summarized for 12 wk from 75 to 86 wk of age.
EM = egg production (%) × EW (g) / 100.
Normal-ME diets contained commercially recommended levels of ME (2,730 kcal AMEn/kg); low-ME diets contained less ME by 50 kcal ME/kg (2,680 kcal AMEn/kg).
High-NDF diets contained 40% higher NDF concentrations than low-NDF diets.
In egg quality, no interactions between dietary levels of ME and NDF were observed for eggshell color, eggshell strength, and Haugh unit (Table 4). However, significant interactions (P < 0.05) were identified for egg yolk color and eggshell thickness. High-NDF diets increased (P < 0.05) egg yolk color to a darker extent in normal-ME diets than in low-ME diets. In addition, increasing NDF concentrations in low-ME diets had no effects on eggshell thickness, whereas increasing NDF concentrations in normal-ME diets increased (P < 0.05) eggshell thickness. For the main effects, feeding low-ME diets to hens decreased (P < 0.05) egg yolk color and eggshell thickness, regardless of dietary concentrations of NDF. High-NDF diets increased (P < 0.01) egg yolk color as compared to low-NDF diets.
Table 4.
Effect of dietary concentrations of ME and neutral detergent fiber (NDF) on egg quality of aged laying hens.1
| Egg quality |
||||||
|---|---|---|---|---|---|---|
| Item | Eggshell color2 | Egg yolk color | Haugh unit | Eggshell strength (kg/cm2) | Eggshell thickness (μm) | |
| ME3 | NDF4 | |||||
| Low | Low | 11.7 | 7.6a | 83.1 | 3.34 | 393b |
| High | 11.3 | 8.3c | 84.0 | 3.45 | 390b | |
| Normal | Low | 11.8 | 7.9b | 82.0 | 3.44 | 393b |
| High | 11.6 | 8.8d | 83.1 | 3.53 | 401a | |
| SEM (n = 8) | 0.11 | 0.08 | 0.79 | 0.051 | 2.3 | |
| Main effect | ||||||
| ME | ||||||
| Low | 11.5 | 8.0 | 83.5 | 3.39 | 391 | |
| Normal | 11.7 | 8.3 | 82.6 | 3.48 | 397 | |
| SEM (n = 16) | 0.08 | 0.06 | 0.50 | 0.036 | 1.6 | |
| NDF | ||||||
| Low | 11.8 | 7.8 | 82.5 | 3.39 | 393 | |
| High | 11.5 | 8.5 | 83.5 | 3.49 | 396 | |
| SEM (n = 16) | 0.08 | 0.05 | 0.60 | 0.036 | 1.6 | |
| Effect (P-value) | ||||||
| ME | 0.125 | <0.001 | 0.112 | 0.075 | 0.018 | |
| NDF | 0.334 | <0.001 | 0.247 | 0.063 | 0.209 | |
| ME × NDF | 0.513 | 0.045 | 0.898 | 0.804 | 0.021 | |
Means in the same column with different superscripts are different (P < 0.05).
Data are least squares means of 8 observations per treatment.
Eggshell color was measured by the eggshell color fan scale.
Normal-ME diets contained commercially recommended levels of ME (2,730 kcal AMEn/kg); low-ME diets contained less ME by 50 kcal ME/kg (2,680 kcal AMEn/kg).
High-NDF diets contained 40% higher NDF concentrations than low-NDF diets.
Relative Organ Weight
No interactions between dietary levels of ME and NDF for all relative organ weights were observed (Table 5). For the main effects, high-NDF diets decreased (P < 0.05) the relative weights of the liver, but increased (P < 0.05) the relative weights of the gizzard as compared to low-NDF diets. However, dietary concentrations of NDF did not affect the relative weights of other organs. Similarly, dietary concentrations of ME had no effects on the relative weights of any of the organs.
Table 5.
Effect of dietary concentrations of ME and neutral detergent fiber (NDF) on relative organ weight of aged laying hens.1
| Relative organ weight (%) |
||||||||
|---|---|---|---|---|---|---|---|---|
| Item | Liver | Spleen | Crop | Proventriculus | Gizzard | Small intestine | Large intestine | |
| ME2 | NDF3 | |||||||
| Low | Low | 2.49 | 0.11 | 0.33 | 0.30 | 1.20 | 2.70 | 0.59 |
| High | 2.27 | 0.10 | 0.32 | 0.31 | 1.31 | 2.73 | 0.66 | |
| Normal | Low | 2.59 | 0.10 | 0.29 | 0.33 | 1.20 | 2.84 | 0.67 |
| High | 2.23 | 0.10 | 0.32 | 0.31 | 1.26 | 2.80 | 0.70 | |
| SEM (n = 8) | 0.123 | 0.010 | 0.017 | 0.014 | 0.037 | 0.088 | 0.035 | |
| Main effect | ||||||||
| ME | ||||||||
| Low | 2.38 | 0.10 | 0.32 | 0.31 | 1.25 | 2.71 | 0.63 | |
| Normal | 2.41 | 0.10 | 0.31 | 0.32 | 1.23 | 2.82 | 0.69 | |
| SEM (n = 16) | 0.084 | 0.007 | 0.012 | 0.010 | 0.025 | 0.061 | 0.024 | |
| NDF | ||||||||
| Low | 2.54 | 0.10 | 0.31 | 0.32 | 1.20 | 2.77 | 0.63 | |
| High | 2.25 | 0.10 | 0.32 | 0.31 | 1.28 | 2.76 | 0.68 | |
| SEM (n = 16) | 0.084 | 0.007 | 0.012 | 0.010 | 0.025 | 0.061 | 0.024 | |
| Effect (P-value) | ||||||||
| ME | 0.809 | 0.774 | 0.247 | 0.536 | 0.434 | 0.207 | 0.076 | |
| NDF | 0.020 | 0.827 | 0.844 | 0.578 | 0.025 | 0.926 | 0.144 | |
| ME × NDF | 0.592 | 0.317 | 0.254 | 0.305 | 0.546 | 0.708 | 0.596 | |
Data are least squares means of 8 observations per treatment.
Normal-ME diets contained commercially recommended levels of ME (2,730 kcal AMEn/kg); low-ME diets contained less ME by 50 kcal ME/kg (2,680 kcal AMEn/kg).
High-NDF diets contained 40% higher NDF concentrations than low-NDF diets.
Fatty Liver Indicator
No interactions between dietary levels of ME and NDF for all indicators for fatty liver development were identified (Table 6). For the main effects, high-NDF diets decreased (P < 0.05) L*, a*, and b* values in the liver; however, dietary concentrations of ME did not influence those color values. The hemorrhagic score was also unaffected by dietary levels of ME and NDF. For the main effects, however, high-NDF diets decreased (P < 0.01) total fat concentrations in the liver but low-ME diets increased (P < 0.05) total fat concentrations in the liver.
Table 6.
Effect of dietary concentrations of ME and neutral detergent fiber (NDF) on fatty liver incidence of aged laying hens.1
| Fatty liver incidence |
|||||||
|---|---|---|---|---|---|---|---|
| Liver color 2 |
|||||||
| Item | Score | L* | a* | b* | Hemorrhagic score | Total fat concentration (% DM) | |
| ME3 | NDF4 | ||||||
| Low | Low | 3.00 | 33.3 | 22.8 | 13.9 | 2.46 | 48.1 |
| High | 2.52 | 30.0 | 19.6 | 10.1 | 1.95 | 31.3 | |
| Normal | Low | 2.92 | 33.4 | 21.0 | 13.1 | 2.17 | 29.9 |
| High | 2.63 | 29.6 | 18.4 | 9.5 | 1.54 | 25.8 | |
| SEM (n = 8) | 0.318 | 1.58 | 0.87 | 1.87 | 0.388 | 3.32 | |
| Main effect | |||||||
| ME | |||||||
| Low | 2.76 | 31.6 | 21.0 | 12.0 | 2.21 | 39.7 | |
| Normal | 2.77 | 31.5 | 19.7 | 11.3 | 1.85 | 27.9 | |
| SEM (n = 16) | 0.218 | 1.08 | 0.59 | 1.28 | 0.266 | 2.35 | |
| NDF | |||||||
| Low | 2.96 | 33.4 | 21.9 | 13.5 | 2.31 | 39.0 | |
| High | 2.57 | 29.8 | 19.0 | 9.8 | 1.75 | 28.5 | |
| SEM (n = 16) | 0.218 | 1.08 | 0.59 | 1.28 | 0.266 | 2.35 | |
| Effect (P-value) | |||||||
| ME | 0.977 | 0.919 | 0.083 | 0.682 | 0.351 | 0.012 | |
| NDF | 0.216 | 0.026 | 0.002 | 0.045 | 0.138 | 0.002 | |
| ME × NDF | 0.763 | 0.893 | 0.732 | 0.938 | 0.873 | 0.061 | |
Data are least squares means of 8 observations per treatment.
Liver color was measured by the score scale and CIE color system.
Normal-ME diets contained commercially recommended levels of ME (2,730 kcal AMEn/kg); low-ME diets contained less ME by 50 kcal ME/kg (2,680 kcal AMEn/kg).
High-NDF diets contained 40% higher NDF concentrations than low-NDF diets.
Hepatic Gene Expression in Fat Metabolism
The expression levels of genes related to fatty acid oxidation (CPT1A and PPAR-α) and synthesis (FASN, SREBP-1, ACC, SCD, PPAR-γ, and malic enzyme) were analyzed to study hepatic fat metabolism in aged laying hens as affected by dietary levels of ME and NDF (Table 7). In genes related to fatty acid oxidation, an interaction (P < 0.05) between dietary levels of ME and NDF was found for CPT1A expression. Increasing NDF concentrations in normal-ME diets increased (P < 0.05) CPT1A expression, but this observation was not found for low-ME diets. No interaction was observed for PPAR-α expression, but for the main effects, low-ME diets decreased (P < 0.05) PPAR-α expression, whereas high-NDF diets increased (P < 0.01) PPAR-α expression.
Table 7.
Effect of dietary concentrations of ME and neutral detergent fiber (NDF) on the relative expression of genes related to fatty acid metabolism in the liver of aged laying hens.1
| Gene expression2 |
|||||||||
|---|---|---|---|---|---|---|---|---|---|
| Fatty acid oxidation |
Fatty acid synthesis |
||||||||
| CPT1A | PPAR-α | FASN | SREBP-1 | ACC | SCD | PPAR-γ | Malic enzyme | ||
| ME3 | NDF4 | ||||||||
| Low | Low | 1.00ab | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00a |
| High | 0.68ab | 1.43 | 0.04 | 0.81 | 0.33 | 0.30 | 0.27 | 0.21b | |
| Normal | Low | 0.54b | 1.25 | 0.40 | 2.66 | 0.57 | 0.65 | 0.54 | 0.27b |
| High | 1.39a | 1.51 | 0.67 | 1.65 | 0.23 | 0.28 | 0.18 | 0.12b | |
| SEM (n = 8) | 0.28 | 0.15 | 0.32 | 0.76 | 0.19 | 0.26 | 0.16 | 0.11 | |
| Main effect | |||||||||
| ME | |||||||||
| Low | 0.84 | 1.22 | 0.57 | 0.91 | 0.67 | 0.65 | 0.67 | 0.60 | |
| Normal | 0.97 | 1.38 | 0.61 | 2.16 | 0.40 | 0.47 | 0.36 | 0.20 | |
| SEM (n = 16) | 0.20 | 0.13 | 0.21 | 0.52 | 0.15 | 0.16 | 0.10 | 0.07 | |
| NDF | |||||||||
| Low | 0.77 | 1.13 | 1.06 | 1.83 | 0.79 | 0.83 | 0.77 | 0.64 | |
| High | 1.04 | 1.47 | 0.13 | 1.23 | 0.28 | 0.29 | 0.23 | 0.17 | |
| SEM (n = 16) | 0.20 | 0.13 | 0.22 | 0.53 | 0.15 | 0.16 | 0.10 | 0.07 | |
| Effect (P-value) | |||||||||
| ME | 0.647 | 0.021 | 0.903 | 0.099 | 0.048 | 0.048 | 0.044 | 0.001 | |
| NDF | 0.338 | <0.001 | 0.004 | 0.429 | 0.003 | 0.008 | <0.001 | <0.001 | |
| ME × NDF | 0.040 | 0.346 | 0.774 | 0.583 | 0.263 | 0.233 | 0.173 | 0.004 | |
Means in the same column with different superscripts are different (P < 0.05).
Data are least squares means of 8 observations per treatment.
CPT1A, carnitine palmitoyl transferase 1A; PPAR-α, peroxisome proliferator-activated receptor-α; FASN, fatty acid synthase; SPEBP-1, sterol response element-binding protein 1; ACC, acetyl-CoA carboxylase; SCD, stearoyl-CoA desaturase; PPAR-γ, peroxisome proliferator-activated receptor-γ.
Normal-ME diets contained commercially recommended levels of ME (2,730 kcal AMEn/kg); low-ME diets contained less ME by 50 kcal ME/kg (2,680 kcal AMEn/kg).
High-NDF diets contained 40% higher NDF concentrations than low-NDF diets.
In genes related to fatty acid synthesis, increasing NDF concentrations in low-ME diets decreased (P < 0.05) malic enzyme expression, whereas increasing NDF concentrations in normal-ME diets did not influence its expression, showing an interaction (P < 0.01). However, no interactions were identified for other genes related to fatty acid synthesis. For the main effects, low-ME diets increased (P < 0.05) expressions of ACC, SCD, PPAR-γ, and malic enzyme but high-NDF diets decreased (P < 0.01) expressions of ACC, SCD, PPAR-γ, and malic enzyme. High-NDF diets decreased (P < 0.01) FASN expression, but different levels of ME in diets did not affect FASN expression.
DISCUSSION
The effects of dietary energy levels on productive performance and egg quality of laying hens have been documented; however, inconsistent results of dietary energy concentrations have been observed for productive performance and egg quality in laying hens (Wu et al., 2005; Jalal et al, 2006; Han and Thacker, 2011; Pérez-Bonilla et al., 2012; Ribeiro et al., 2014). In addition, several experiments associated with the effect of dietary fiber concentrations on productive performance, egg quality, and gut health of laying hens have been performed and the results have also been controversial (Roberts et al., 2007; Sousa et al., 2019; Desbruslais et al., 2021). In particular, information pertaining to the interactive effect of dietary concentrations of energy and fiber on productive performance, egg quality, and fatty liver incidence in aged laying hens is largely lacking.
In the current experiment, dietary levels of ME did not affect productive performance in aged laying hens. It is known that laying hens have the ability to adjust FI in response to different energy concentrations in diets (Classen, 2017), whereas multiple factors, such as genotype, diet compositions, feed forms, age, energy to protein ratio, and environment, can affect FI changes of hens in response to different energy concentrations in diets (Classen, 2017). Junqueira et al. (2006) reported no differences in FI by increasing concentrations of dietary ME in aged laying hens, which agrees with the current results. On the other hand, the results of the current experiment indicated that laying hens fed high-NDF diets, regardless of ME levels, exhibited a greater FI than those fed low-NDF diets although the difference in FI was very small. Dietary fiber is known to have a low-energy value and to exert anti-nutritional effects, such as decreased nutrient digestion and absorption, possibly due to facilitated passage rate of intestinal contents in animals (Jha et al., 2019; Desbruslais et al., 2021). However, it was reported that feeding diets containing high insoluble fiber increased the passage rate of intestinal contents, but this increase contributed to enhanced FI in laying hen (Jha et al., 2019). Thus, it is speculated that wheat bran and DDGS as used to increase NDF concentrations in treatment diets contained high amounts of insoluble fiber, which may be the reason for increased FI by high-NDF diets in this experiment. However, no interactive effects of dietary ME and NDF levels were observed in this experiment, indicating that the current levels of ME and NDF in diets may have little effects on productive performance in aged laying hens.
Considering egg quality, significant interactions and main effects of dietary levels of ME and NDF were observed for the egg yolk color in aged laying hens. This observation is likely associated with inclusion of specific feed ingredients for producing different ME and NDF concentrations in treatment diets. Egg yolk color directly reflects dietary concentrations of carotenoids such as lutein and zeaxanthin that are contained at the high amount in DDGS and corn gluten meal (Shin et al., 2015; Grashorn, 2016). In the current experiment, inclusion levels of DDGS and corn gluten meal were increased to produce high-NDF diets, and their inclusion levels were also adjusted in different ME diets.
Normal-ME diets increased eggshell thickness and tended to increase eggshell strength in aged laying hens for the main effects. This result indicated that appropriate ME levels in diets are required to maintain eggshell quality because eggshell formation in the uterus requires high amounts of energy (Jonchère et al., 2012). Interestingly, there was an interaction for eggshell thickness between dietary levels of ME and NDF because increasing NDF levels in low-ME diets had no effects on eggshell thickness, but increased eggshell thickness in aged hens fed normal-ME diets. The reason for this interaction is not clear because information regarding how dietary levels of ME and fiber affect eggshell thickness in aged laying hens is largely limited. Both dietary Ca and P concentrations and their availability are known to be critical to improve eggshell thickness and strength in laying hens (Pelicia et al., 2009). Thus, although calculated total Ca and available P concentrations were equalized among all treatment diets in this experiment, it may be speculated that feed ingredients used in high-ME and high-NDF diets may have more available Ca and P than those used in other treatment diets.
No interactions between dietary levels of ME and NDF on all relative organ weights in aged laying hens were observed; however, for the main effects, high-NDF diets altered the relative weights of the liver and gizzard. In this experiment, aged laying hens fed high-NDF diets had a lower relative weight of the liver than those fed low-NDF diets. Most of previous experiments studying fatty liver diseases have been shown to increase the liver weight with increasing fat concentrations in poultry (Harms et al., 1977; Lee at el., 2010). Therefore, decreased liver weights by feeding high-NDF diets may be an indirect evidence for decreasing fatty liver development, which was supported by our observation that high-NDF diets decreased total fat concentrations in the liver. Moreover, increasing fiber intake is reported to stimulate the intestinal development by increasing feed retention in the intestine (Sousa et al., 2019). Increased weights of the gizzard were observed by feeding high-NDF diets in this experiment, but such an effect was not observed for other intestinal organs.
Laying hens frequently experience with the health problem in the liver due to increasing fat accumulation with age (Zaefarian et al., 2019). The FLHS is one of well-known liver problems in laying hens and it is characterized by enlarged and pale colored liver with marked hemorrhage (Zaefarian et al., 2019). Structurally and functionally weakened liver causes various health problems that often lead to the death of laying hens. It is reported that FLHS is considered the main reason of the mortality in cage-raised laying hens (Shini et al., 2019). According to Dong and Tong (2019), aged laying hens are more prone to FLHS than younger laying hens. However, in most of the previous studies, the FLHS was induced artificially by feeding high fat and energy diets to broiler chickens and young laying hens, such that the research regarding FLHS in aged laying hens is still limited. Therefore, one of the major purposes of the present experiment was to investigate the interactive effect of dietary concentrations of ME and NDF on FLHS development in aged laying hens.
Hepatic fat concentrations in aged laying hens were increased by both low-ME diets and low-NDF diets for the main effects, and feeding low-NDF and low-ME diets induced the highest fat concentrations in the liver, showing the tendency for the interaction. This result may indicate that increasing NDF concentrations in normal-ME diets are effective in decreasing hepatic fat accumulation, which may aid in preventing FLHS development in aged laying hens. This result agrees with previous experiments reporting that increasing concentrations of dietary fiber decreased hepatic fat retentions in poultry (Akiba and Matsumoto, 1982; Akiba et al., 1987; Bogusławska-Tryk et al., 2016). According to Akiba and Matsumoto (1982), dietary fiber can stimulate the secretion of lipoproteins from the liver and decrease de novo fatty acid synthesis in the liver. In the current experiment, feeding high-NDF diets increased hepatic expression of PPAR-α that is related to fatty acid oxidation, but decreased the expression of FASN, ACC, SCD, PPAR-γ, and malic enzyme that are related to fatty acid synthesis. Interactions between dietary levels of ME and NDF for expressions of CPT1A and malic enzyme were also observed. These altered fatty acid metabolisms in aged laying hens are likely the primary reason why high-NDF diets reduced hepatic fat concentrations in this experiment. To the best of our knowledge, this is the first experiment that shows the modification of hepatic fatty acid metabolism and reduction in hepatic fat concentrations by high-NDF diets in aged laying hens.
The observation that hens fed low-ME diets showed a greater fat concentration with less expression of PPAR-α and greater expression of ACC, SCD, PPAR-γ, and malic enzyme in the liver than those fed normal-ME diets was unexpected because decreased energy concentrations in diets generally reduce hepatic fat concentrations in poultry (Whitehead, 1979). The reason for this contrasting observation is difficult to be explained; however, it may be related to differences in dietary fat concentrations between low and normal-ME diets. In this experiment, normal-ME diets contained more fat than low-ME diets because of higher ME concentrations. It is reported that higher fat concentrations in diets may decrease fatty acid synthesis but increase fatty acid oxidation in rats (Zhang et al., 2014). Moreover, increasing fat concentrations as a replacement of carbohydrates in diets were reported to reduce hepatic fat retention in laying hens, possibly through feed-back mechanisms (Haghighi-Rad and Polin, 1982). However, it should be noted that the effects of dietary ME and NDF concentrations on lipid metabolism were determined only based on hepatic fat concentrations and expression of some selected genes related to oxidation and synthesis of fatty acids in the current experiment. Further research is required to verify the alteration of hepatic lipid metabolism in aged laying hens by dietary ME and NDF concentrations at the transcriptomic and proteomic level.
CONCLUSION
Decreasing ME concentrations in diets impairs egg quality and aggravates hepatic fat accumulation in aged laying hens without affecting productive performance. However, increasing NDF concentrations in diets improves egg quality with no negative effects on productive performance in aged laying hens. In addition, increasing NDF concentrations in commercially-recommended ME diets decreases hepatic fat concentrations in aged laying hens by increasing fatty acid oxidation and decreasing fatty acid synthesis in the liver, which may aid in preventing FLHS development in aged laying hens.
ACKNOWLEDGMENTS
This research was carried out with the support of the Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ01256701), Rural Development Administration, Republic of Korea. This research was also supported by the Chung-Ang University Graduate Research Scholarship (Academic scholarship for College of Biotechnology and Natural Resources) in 2023.
DISCLOSURES
The authors declare no conflict of interest for the data presented in this experiment.
REFERENCES
- Akiba Y., Matsumoto T. Effects of force-feeding and dietary cellulose on liver lipid accumulation and lipid composition of liver and plasma in growing chicks. J. Nutr. 1978;108:739–748. doi: 10.1093/jn/108.5.739. [DOI] [PubMed] [Google Scholar]
- Akiba Y., Matsumoto T. Effects of dietary fibers on lipid metabolism in liver and adipose tissue in chicks. J. Nutr. 1982;112:1577–1585. doi: 10.1093/jn/112.8.1577. [DOI] [PubMed] [Google Scholar]
- Akiba Y., Tanaka Y., Matsumoto T. Detection of dietary ingredients reducing hepatic lipid accumulation of layers with aid of a laboratory assay system in growing chicks. J. Poult. Sci. 1987;24:295–303. [Google Scholar]
- AOAC (Association of Official Analytical Chemists) 18th ed. AOAC Int.; Gaithersburg: 2007. Official Methods of Analysis of AOAC International. [Google Scholar]
- Bain M.M., Nys Y., Dunn I.C. Increasing persistency in lay and stabilising egg quality in longer laying cycles. What are the challenges? Br. Poult. Sci. 2016;57:330–338. doi: 10.1080/00071668.2016.1161727. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bogusławska-Tryk M., Piotrowska A., Szymeczko R., Burlikowska K., Głowińska B. Lipid metabolism indices and fatty acids profile in the blood serum of broiler chickens fed a diet with lignocellulose. Braz. J. Poult. Sci. 2016;18:451–456. [Google Scholar]
- Choi Y.I., Ahn H.J., Lee B.K., Oh S.T., An B.K., Kang C.W. Nutritional and hormonal induction of fatty liver syndrome and effects of dietary lipotropic factors in egg-type male chicks. Asian-Australas. J. Anim. Sci. 2012;25:1145–1152. doi: 10.5713/ajas.2011.11418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Classen H.L. Diet energy and feed intake in chickens. Anim. Feed Sci. Technol. 2017;233:13–21. [Google Scholar]
- Desbruslais A., Wealleans A., Gonzalez-Sanchez D., di Benedetto M. Dietary fibre in laying hens: a review of effects on performance, gut health and feather pecking. Worlds Poult. Sci. J. 2021;77:797–823. [Google Scholar]
- Diaz G.J., Squires E.J., Julian R.J. The use of selected plasma enzyme activities for the diagnosis of fatty liver-hemorrhagic syndrome in laying hens. Avian Dis. 1999;43:768–773. [PubMed] [Google Scholar]
- Dong X., Tong J. Different susceptibility to fatty liver-haemorrhagic syndrome in young and older layers and the interaction on blood LDL-C levels between oestradiols and high energy-low protein diets. Br. Poult. Sci. 2019;60:265–271. doi: 10.1080/00071668.2019.1571164. [DOI] [PubMed] [Google Scholar]
- England A., Ruhnke I. The influence of light of different wavelengths on laying hen production and egg quality. Worlds Poult. Sci. J. 2020;76:443–458. [Google Scholar]
- Galea F. Nutrition and food management and their influence on egg quality. XLVIII Scientific Symposium of Poultry; Santiago de Compostela, Spain; 2011. 5–7 October. [Google Scholar]
- Gao X., Liu P., Wu C., Wang T., Liu G., Cao H., Zhang C., Hu G., Guo X. Effects of fatty liver hemorrhagic syndrome on the AMP-activated protein kinase signaling pathway in laying hens. Poult. Sci. 2019;98:2201–2210. doi: 10.3382/ps/pey586. [DOI] [PubMed] [Google Scholar]
- Grashorn M. In: Pages 283–302 in handbook on natural pigments in food and beverages. Carle R., Schweigert R.M., editors. Woodhead Publishing; Sawston, UK: 2016. Feed additives for influencing chicken meat and egg yolk color. [Google Scholar]
- Haghighi-Rad F., Polin D. Lipid alleviates fatty liver hemorrhagic syndrome. Poult. Sci. 1982;61:2465–2472. doi: 10.3382/ps.0612465. [DOI] [PubMed] [Google Scholar]
- Han Y.-K., Thacker P.A. Influence of energy level and glycine supplementation on performance, nutrient digestibility and egg quality in laying hens. Asian-Australas. J. Anim. Sci. 2011;24:1447–1455. [Google Scholar]
- Harms R.H., Roland D.A., Sr., Simpson C.F. Experimentally induced “fatty liver syndrome” condition in laying hens. Poult. Sci. 1977;56:517–520. doi: 10.3382/ps.0560517. [DOI] [PubMed] [Google Scholar]
- Hy-Line . Hy-Line Int; West Des Monies, IA: 2016. Hy-Line Brown Commercial Layer Management Guide. [Google Scholar]
- Jalal M.A., Scheideler S.E., Marx D. Effect of bird cage space and dietary metabolizable energy level on production parameters in laying hens. Poult. Sci. 2006;85:306–311. doi: 10.1093/ps/85.2.306. [DOI] [PubMed] [Google Scholar]
- Jha R., Fouhse J.M., Tiwari U.P., Li L., Willing B.P. Dietary fiber and intestinal health of monogastric animals. Front. Vet. Sci. 2019;6:48. doi: 10.3389/fvets.2019.00048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jonchère V., Brionne A., Gautron J., Nys Y. Identification of uterine ion transporters for mineralisation precursors of the avian eggshell. BMC Physiol. 2012;12:10. doi: 10.1186/1472-6793-12-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Junqueira O.M., de Laurentiz A.C., da Silva Filardi R., Rodrigues E.A., Casartelli E.M. Effects of energy and protein levels on egg quality and performance of laying hens at early second production cycle. J. Appl. Poult. Res. 2006;15:110–115. [Google Scholar]
- Kim J.H., Choi W.J., Kwon C.H., Kil D.Y. Research Note: Improvement of eggshell strength and intensity of brown eggshell color by dietary magnesium and δ-aminolevulinic acid supplementation in laying hens. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee B.K., Kim J.S., Ahn H.J., Hwang J.H., Kim J.M., Lee H.T., An B.K., Kang C.W. Changes in hepatic lipid parameters and hepatic messenger robonucleic acid expression following estradiol administration in laying hens (Gallus domesticus) Poult. Sci. 2010;89:2660–2667. doi: 10.3382/ps.2010-00686. [DOI] [PubMed] [Google Scholar]
- Okrathok S., Thumanu K., Pukkung C., Molee W. Extraction of dietary fibers from cassava pulp and cassava distiller’s dried grains and assessment of their components using Fourier transform infrared spectroscopy to determine their further use as a functional feed in animal diets. Anim. Biosci. 2022;35:1048–1058. doi: 10.5713/ab.21.0430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pelicia K., Garcia E.A., Faitarone A.B.G., Silva A.P., Berto D.A., Molino A.B., Vercese F. Calcium and available phosphorus levels for laying hens in second production cycle. Braz. J. Poult. Sci. 2009;11:39–49. [Google Scholar]
- Pérez-Bonilla A., Novoa S., García J., Mohiti-Asli M., Frikha M., Mateos G.G. Effects of energy concentration of the diet on productive performance and egg quality of brown egg-laying hens differing in initial body weight. Poult. Sci. 2012;91:3156–3166. doi: 10.3382/ps.2012-02526. [DOI] [PubMed] [Google Scholar]
- Pitargue F.M., Kim J.H., Goo D., Delos Reyes J.B., Kil D.Y. Effect of vitamin E sources and inclusion levels in diets on growth performance, meat quality, alpha-tocopherol retention, and intestinal inflammatory cytokine expression in broiler chickens. Poult. Sci. 2019;98:4584–4594. doi: 10.3382/ps/pez149. [DOI] [PubMed] [Google Scholar]
- Ribeiro P.A.P., Matos J.B., Jr, Lara L.J.C., Araújo L.F., Albuquerque R., Baião N.C. Effect of dietary energy concentration on performance parameters and egg quality of white leghorn laying hens. Braz. J. Poult. Sci. 2014;16:381–388. [Google Scholar]
- Roberts S.A., Xin H., Kerr B.J., Russell J.R., Bregendahl K. Effects of dietary fiber and reduced crude protein on nitrogen balance and egg production in laying hens. Poult. Sci. 2007;86:1716–1725. doi: 10.1093/ps/86.8.1716. [DOI] [PubMed] [Google Scholar]
- Shin H.S., Kim J.W., Lee D.G., Lee S., Kil D.Y. Bioavailability of lutein in corn distillers dried grains with solubles relative to lutein in corn gluten meal based on lutein retention in egg yolk. J. Sci. Food Agric. 2015;96:3401–3406. doi: 10.1002/jsfa.7520. [DOI] [PubMed] [Google Scholar]
- Shini A., Shini S., Bryden W.L. Fatty liver haemorrhagic syndrome occurrence in laying hens: impact of production system. Avian Pathol. 2019;48:25–34. doi: 10.1080/03079457.2018.1538550. [DOI] [PubMed] [Google Scholar]
- Sousa L.S.d., Carvalho T.S.M., Nogueira F.A., Saldanha M.M., Vaz D.P., Bertechini A.G., Baião N.C., Lara L.J.C. Fiber source and xylanase on performance, egg quality, and gastrointestinal tract of laying hens. Rev. Bras. Zootec. 2019;48 [Google Scholar]
- Steel R.G.D., Torrie J.H., Dickey D.A. 3rd ed. McGraw-Hill Book Co; New York, NY: 1997. Principles and Procedures of Statistics: A Biometrical Apporoach. [Google Scholar]
- Van Soest P.J., Robertson J.B., Lewis B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991;74:3583–3597. doi: 10.3168/jds.S0022-0302(91)78551-2. [DOI] [PubMed] [Google Scholar]
- Whitehead C.C. Nutritional and metabolic aspects of fatty liver disease in poultry. Vet. Q. 1979;1:150–157. doi: 10.1080/01652176.1979.9693738. [DOI] [PubMed] [Google Scholar]
- Wu G., Bryant M.M., Voitle R.A., Roland Sr D.A. Effect of dietary energy on performance and egg composition of Bovans white and Dekalb white hens during phase I. Poult. Sci. 2005;84:1610–1615. doi: 10.1093/ps/84.10.1610. [DOI] [PubMed] [Google Scholar]
- Zaefarian F., Abdollahi M.R., Cowieson A., Ravindran V. Avian liver: the forgotten organ. Animals. 2019;9:63. doi: 10.3390/ani9020063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang T., Zhao S., Li W., Ma L., Ding M., Li R., Li Y. High-fat diet from perilla oil induces insulin resistance despite lower serum lipids and increases hepatic fatty acid oxidation in rats. Lipids Health Dis. 2014;13:15. doi: 10.1186/1476-511X-13-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu Y., Mao H., Peng G., Zeng Q., Wei Q., Ruan J. Effect of JAK-STAT pathway in regulation of fatty liver hemorrhagic syndrome in chickens. Anim. Biosci. 2021;34:143–153. doi: 10.5713/ajas.19.0874. [DOI] [PMC free article] [PubMed] [Google Scholar]